Homologs in group_1005

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05615 FBDBKF_05615 86.6 Morganella morganii S1 pspF phage shock protein operon transcriptional activator
EHELCC_11975 EHELCC_11975 86.6 Morganella morganii S2 pspF phage shock protein operon transcriptional activator
NLDBIP_12315 NLDBIP_12315 86.6 Morganella morganii S4 pspF phage shock protein operon transcriptional activator
LHKJJB_12175 LHKJJB_12175 86.6 Morganella morganii S3 pspF phage shock protein operon transcriptional activator
HKOGLL_10790 HKOGLL_10790 86.6 Morganella morganii S5 pspF phage shock protein operon transcriptional activator
PMI_RS06650 PMI_RS06650 63.4 Proteus mirabilis HI4320 pspF phage shock protein operon transcriptional activator

Distribution of the homologs in the orthogroup group_1005

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1005

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P37344 5.32e-146 417 62 0 325 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
P09570 5.68e-73 238 43 4 315 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
P27713 5.62e-71 233 41 5 346 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
Q06065 5.05e-70 228 41 3 318 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
P54929 8.51e-69 229 48 1 231 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
P30667 8.86e-69 229 48 1 231 1 nifA Nif-specific regulatory protein Azospirillum brasilense
P71229 1.14e-68 229 51 1 221 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
P54930 1.7e-68 226 41 4 314 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
Q9APD9 3.35e-67 220 44 4 299 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
P03027 7.21e-67 221 42 6 325 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
P56266 1.09e-66 221 42 4 314 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
P0CY94 2.44e-66 221 39 4 352 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
D5ARW9 2.46e-66 221 39 4 352 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P14375 6.69e-66 217 42 4 303 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
Q53206 1.56e-65 220 40 6 340 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P24426 2.43e-65 213 39 7 339 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
P03029 4.15e-65 216 41 3 325 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
P0AFB8 5.78e-65 215 41 4 324 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 5.78e-65 215 41 4 324 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P25852 1.21e-64 214 40 4 310 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X613 1.42e-64 213 41 4 303 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
P12627 1.82e-64 215 43 1 241 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
P41789 2.85e-64 213 41 5 326 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z333 5.43e-64 212 41 3 305 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
P54931 2.39e-63 214 48 1 231 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P12626 3.02e-63 212 44 1 241 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
P28787 4.11e-63 211 49 1 211 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
Q04848 2.28e-62 209 39 6 333 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P10577 5.65e-62 208 38 6 341 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
P23747 7.56e-62 206 50 1 218 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P09133 2.14e-61 209 50 1 214 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P10576 2.3e-61 206 39 6 332 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
P0AFU5 1.65e-60 203 38 3 314 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 1.65e-60 203 38 3 314 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
P45671 6.28e-60 202 48 3 235 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
A8ANR6 6.51e-60 203 38 4 325 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P09828 7.15e-60 203 38 4 340 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
Q3K999 2.36e-59 197 46 1 219 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
Q845S7 5.69e-59 197 45 1 227 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
A6TCX4 9.78e-59 200 37 4 338 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P29267 1.04e-58 199 38 5 318 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9I4N3 1.66e-58 198 46 1 222 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A4WDR5 2.79e-58 199 44 2 243 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
Q00934 3.49e-58 197 38 4 306 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B5XVA2 4.01e-58 198 36 5 342 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
E1WAA4 5.23e-58 202 40 2 264 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
B6I695 5.42e-58 198 38 4 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
P0CL46 6.63e-58 201 41 2 263 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P03028 6.95e-58 198 39 5 341 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
A7ZQD8 7.12e-58 197 38 4 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
B1LQ27 7.51e-58 197 38 4 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
Q43965 7.75e-58 199 41 5 302 1 mopR Phenol regulator MopR Acinetobacter guillouiae
C0PWN2 8.43e-58 197 38 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
Q5PF20 9.56e-58 197 38 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z4C6 1.01e-57 197 38 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 1.01e-57 197 38 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 1.01e-57 197 38 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 1.01e-57 197 38 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
B5RDG4 1.05e-57 197 38 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5F363 1.4e-57 197 37 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
A9MFX7 1.67e-57 197 37 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8ZMJ8 1.73e-57 196 37 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 1.73e-57 196 37 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
P59402 1.98e-57 196 38 4 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 1.98e-57 196 38 4 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
B7M9E6 2.2e-57 196 38 4 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
B7LW25 2.39e-57 196 38 4 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q0TEH1 2.63e-57 196 38 4 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q3YYF5 2.66e-57 196 38 4 320 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
B5FSZ0 2.89e-57 196 37 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
Q88RJ6 2.96e-57 194 47 2 230 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q32CL9 3.02e-57 196 38 4 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
Q1R7Z1 3.02e-57 196 38 4 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 3.02e-57 196 38 4 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 3.02e-57 196 38 4 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
B7N6T9 3.05e-57 196 38 4 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7LEC0 3.35e-57 196 38 4 320 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
A8A3I6 3.69e-57 196 38 4 320 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
B5Z370 3.84e-57 196 37 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 3.84e-57 196 37 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
B1IUX0 3.89e-57 196 38 4 320 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q31X73 4.05e-57 196 38 4 320 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
P19323 4.21e-57 199 43 1 230 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
B7UHC1 4.7e-57 195 37 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P37013 4.8e-57 195 37 3 323 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 4.8e-57 195 37 3 323 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 4.8e-57 195 37 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
B7MZ04 4.8e-57 195 37 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
Q8FEN6 4.85e-57 195 37 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7NSI9 4.85e-57 195 37 4 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B4TF23 8.46e-57 195 37 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
P0C5S5 1.46e-56 193 45 1 226 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 1.46e-56 193 45 1 226 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
P05407 2.53e-56 195 36 4 350 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B4T3B0 2.96e-56 193 37 3 323 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
P54529 4.32e-56 196 43 2 235 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
Q9HU19 4.66e-56 192 48 3 221 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5E3W8 4.92e-56 193 44 1 216 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9K4U8 5.35e-56 193 44 1 232 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q87MX7 5.59e-56 191 45 1 226 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q88AQ2 7.71e-56 191 46 2 230 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A8GG93 1.09e-55 192 38 7 322 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
Q9KT84 2.31e-55 190 43 1 232 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P17899 5.38e-55 189 44 2 224 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
G3XCV0 7.55e-55 189 45 1 229 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7MM78 1e-54 188 45 1 226 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 1e-54 188 45 1 226 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
Q7MFY9 1.13e-54 189 44 1 217 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
O87455 1.76e-54 189 37 3 303 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P26047 1.95e-54 191 35 4 323 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
P06519 2.67e-54 189 44 1 229 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
Q6D8R9 3.11e-54 188 45 2 215 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A4STH5 3.32e-54 188 46 1 205 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
Q8D4F9 4.09e-54 188 43 1 217 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
Q46802 2.07e-53 187 44 2 214 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
A0KEJ0 2.57e-52 183 45 2 222 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
O25408 3.37e-50 174 42 4 234 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
O85057 6.2e-50 177 43 3 230 1 None Limonene hydroxylase Geobacillus stearothermophilus
Q9K4V0 1.87e-49 176 44 1 232 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P74839 4.12e-49 175 43 4 229 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9KN48 4.54e-49 175 41 1 243 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P13632 3.96e-48 171 35 2 303 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
P10046 9.29e-48 169 34 6 321 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
P0A2D7 5.9e-47 169 32 5 320 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 5.9e-47 169 32 5 320 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
O54426 9.37e-47 168 31 5 326 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
P07604 1.31e-46 168 32 4 325 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
P38022 2.21e-46 166 41 4 235 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
P77743 2.69e-46 167 43 5 227 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
Q9ZIB7 4.2e-46 167 35 3 259 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
P28614 6.97e-45 166 34 7 341 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q01265 1.85e-44 157 36 4 238 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
O31551 6.06e-44 162 33 4 322 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
P31908 4.68e-43 158 47 2 207 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P37931 5.05e-43 153 39 2 211 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
P26316 1.57e-42 152 39 2 211 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
Q04849 2.42e-42 155 35 3 256 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P37930 1.47e-41 150 40 2 200 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
P44694 9.82e-41 148 36 2 233 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P26408 6.24e-39 147 33 3 295 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
P36219 4.95e-38 141 36 4 237 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
Q68WH4 1.72e-29 120 32 4 228 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZCY9 3.48e-29 120 32 4 228 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
P54156 1.93e-28 115 34 6 232 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
Q4UL27 1.95e-28 118 30 3 223 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P38035 1.05e-27 116 34 6 237 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
P76016 1.17e-26 114 33 2 209 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
P45512 3.89e-26 112 28 6 287 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
Q1RJS1 5.94e-26 110 30 4 222 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
Q92HC2 7.95e-23 102 30 3 213 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P55610 8.96e-23 102 27 7 320 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P09432 6.98e-20 93 27 8 316 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
D0ZLR9 1.03e-19 94 39 5 154 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)
P23914 1.69e-19 93 40 3 128 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
P06184 6.95e-07 54 24 10 319 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P56269 8.62e-06 48 30 2 104 3 nifA Nif-specific regulatory protein (Fragment) Azotobacter chroococcum mcd 1

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS03690
Feature type CDS
Gene pspF
Product phage shock protein operon transcriptional activator
Location 784077 - 785093 (strand: -1)
Length 1017 (nucleotides) / 338 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1005
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00158 Sigma-54 interaction domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3829 Transcription (K)
Signal transduction mechanisms (T)		 KT RocR-type transcriptional regulator, contains PAS, AAA-type ATPase, and DNA-binding Fis domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03974 psp operon transcriptional activator - -

Protein Sequence

MNNTPDTLIGIDNTFIDALENVSRLAKIARPVLICGERGTGKELFAHRLHYLSPRWDEPFITINCAALNDNLLDSELFGHESGAFTGAQRRHQGRFERADGGTLFLDELGTAPLNVQEKLLRVIEYGEYERVGGQQTLKADVRIVCATNADLPALAAEGHFRADLLDRLAFDVVTIPPLRCRPRDLSELANHFAVQMCQEMGTSFFAGFSPHAIKQMQDYAWPGNIRELKNVVERSLYRQGDTTVPLAALIINPFVTAIGVQNGQAATDSSLPPLPFSLKQWQHTQESDALNAALHQTQFNQREAARLLDLTYHQFRGLLKKHALTGADRNENALLPD

Flanking regions ( +/- flanking 50bp)

AAGTGGTCTTATTCACCACTAAGTGGTCAGATTAACCATGAAAAAATACAATGAATAATACCCCTGATACGCTGATTGGTATTGATAATACCTTTATAGATGCGCTGGAAAATGTCTCTCGGCTGGCGAAAATTGCCCGCCCGGTGCTGATTTGCGGCGAGCGCGGCACCGGCAAAGAATTATTCGCGCATCGCCTGCATTATCTCTCACCCCGCTGGGATGAGCCATTTATTACTATAAATTGTGCAGCACTGAACGATAATCTGCTCGATTCCGAGCTGTTCGGGCACGAGTCCGGCGCGTTTACCGGTGCTCAGCGCCGCCATCAGGGGCGTTTTGAGCGCGCGGACGGCGGCACACTGTTTCTCGATGAACTGGGTACCGCGCCGCTGAATGTGCAGGAAAAATTATTGCGCGTCATTGAATATGGCGAGTATGAGCGGGTCGGCGGGCAGCAGACACTGAAAGCGGATGTGCGGATAGTGTGCGCAACCAATGCCGATTTACCGGCACTCGCGGCAGAGGGACACTTTCGCGCAGATCTGCTCGACCGTCTGGCGTTTGATGTGGTGACTATTCCGCCGCTGCGCTGCCGTCCGCGTGATTTGTCAGAACTGGCAAACCATTTTGCCGTACAAATGTGCCAGGAAATGGGCACGTCGTTTTTTGCCGGGTTTTCACCGCATGCTATAAAGCAGATGCAGGATTATGCCTGGCCGGGAAATATCCGCGAGCTGAAAAATGTGGTGGAACGCTCACTTTATCGTCAGGGCGATACCACTGTGCCGCTGGCAGCACTTATTATTAATCCGTTTGTCACCGCTATTGGCGTGCAAAACGGGCAGGCTGCCACAGATAGTTCTCTGCCGCCGCTGCCGTTTTCCCTGAAACAGTGGCAACATACACAGGAGTCTGATGCGCTGAATGCCGCACTGCATCAAACTCAGTTTAATCAGCGGGAGGCTGCCCGGCTGCTGGATCTGACTTATCATCAGTTCCGCGGATTGCTGAAAAAACACGCATTAACCGGGGCGGATCGCAATGAAAACGCCCTTTTGCCCGATTAAATGCTTCCGTTTTTGGTTAGTCGCACAAATTGCGATATAATACGGCGTTC