Homologs in group_1005

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05615 FBDBKF_05615 64.3 Morganella morganii S1 pspF phage shock protein operon transcriptional activator
EHELCC_11975 EHELCC_11975 64.3 Morganella morganii S2 pspF phage shock protein operon transcriptional activator
NLDBIP_12315 NLDBIP_12315 64.3 Morganella morganii S4 pspF phage shock protein operon transcriptional activator
LHKJJB_12175 LHKJJB_12175 64.3 Morganella morganii S3 pspF phage shock protein operon transcriptional activator
HKOGLL_10790 HKOGLL_10790 64.3 Morganella morganii S5 pspF phage shock protein operon transcriptional activator
F4V73_RS03690 F4V73_RS03690 63.4 Morganella psychrotolerans pspF phage shock protein operon transcriptional activator

Distribution of the homologs in the orthogroup group_1005

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1005

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P37344 3.37e-168 473 69 2 335 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
P09570 1.39e-69 228 48 2 242 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
Q00934 1.18e-67 221 40 3 310 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P30667 7.2e-66 221 48 1 232 1 nifA Nif-specific regulatory protein Azospirillum brasilense
P54929 1.46e-65 220 48 1 229 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
Q06065 2.71e-65 216 49 1 223 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
P27713 2.82e-65 218 48 1 233 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
Q53206 8.68e-65 218 40 5 344 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P12626 2.15e-64 215 40 4 323 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
P71229 4.35e-63 215 49 1 221 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
B4T3B0 1.09e-62 210 39 6 330 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
B5F363 1.23e-62 210 39 6 330 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
A9MFX7 1.34e-62 210 39 6 330 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P25852 1.36e-62 208 41 6 317 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P12627 1.74e-62 210 44 1 230 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
Q8X613 1.88e-62 207 41 6 317 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
Q8ZMJ8 1.9e-62 209 39 6 330 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 1.9e-62 209 39 6 330 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
Q88RJ6 2e-62 208 48 2 230 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8Z4C6 2.09e-62 209 39 8 332 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 2.09e-62 209 39 8 332 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 2.09e-62 209 39 8 332 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 2.09e-62 209 39 8 332 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
B5RDG4 2.3e-62 209 39 8 332 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q5PF20 2.45e-62 209 39 8 332 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
C0PWN2 2.82e-62 209 39 8 332 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
B5FSZ0 2.82e-62 209 39 6 330 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
P14375 3.87e-62 207 39 4 317 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
Q9APD9 8.57e-62 206 42 6 307 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
B4TF23 1.63e-61 207 38 6 330 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
P24426 2.34e-61 202 47 2 232 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
Q8Z333 2.78e-61 205 43 3 273 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
Q3YYF5 4.01e-61 206 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
P03027 4.33e-61 206 46 1 233 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
P56266 4.42e-61 206 46 1 233 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
B7M9E6 4.85e-61 206 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
P45671 4.91e-61 205 40 6 319 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
P54930 6.07e-61 206 41 8 323 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
A8A3I6 6.8e-61 205 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
B1IUX0 7.33e-61 205 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q31X73 7.4e-61 205 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
B7LEC0 7.97e-61 205 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
Q9HU19 8.63e-61 204 39 5 328 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
D5ARW9 1.31e-60 206 46 1 233 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P0CY94 1.46e-60 206 46 1 233 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
B7MZ04 1.47e-60 204 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
Q8FEN6 1.55e-60 204 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7UHC1 1.62e-60 204 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P29267 1.7e-60 204 39 5 321 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P23747 1.86e-60 203 46 2 230 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9K4U8 3.22e-60 204 37 2 326 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B6I695 3.69e-60 203 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
Q0TEH1 3.85e-60 203 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N6T9 4.15e-60 203 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q1R7Z1 4.86e-60 203 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 4.86e-60 203 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 4.86e-60 203 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
B1LQ27 5.07e-60 203 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
A7ZQD8 6.07e-60 203 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
A8ANR6 7.04e-60 202 37 4 331 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7LW25 1.26e-59 202 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q04848 1.38e-59 201 38 7 345 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
B5Z370 1.94e-59 201 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 1.94e-59 201 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
B7NSI9 2.22e-59 201 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P10577 2.33e-59 201 37 6 342 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
Q88AQ2 2.85e-59 199 46 2 230 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P17899 3.15e-59 200 38 5 321 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q32CL9 3.89e-59 201 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
P59402 4.33e-59 201 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 4.33e-59 201 38 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
P37013 4.51e-59 201 37 6 326 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 4.51e-59 201 37 6 326 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 4.51e-59 201 37 6 326 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
Q3K999 5.82e-59 196 40 5 310 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
B5XVA2 9.31e-59 200 36 3 332 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
P0AFB8 1.02e-58 199 38 3 327 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 1.02e-58 199 38 3 327 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
Q87MX7 1.95e-58 197 39 5 319 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A6TCX4 2.05e-58 199 36 3 328 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P0C5S5 2.26e-58 197 38 5 319 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 2.26e-58 197 38 5 319 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
P54931 4.18e-58 200 46 2 236 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A4WDR5 6.72e-58 197 37 5 325 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
P03029 7.31e-58 196 47 1 226 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
P06519 8.33e-58 199 46 1 229 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
P28787 9.46e-58 196 45 1 230 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
P09133 1.25e-57 199 48 3 230 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P41789 2.47e-57 195 47 1 226 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
G3XCV0 2.74e-57 196 37 3 338 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7MFY9 8.13e-57 195 36 1 324 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
P19323 9.11e-57 198 47 1 230 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
P26047 1.36e-56 197 37 6 329 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
Q845S7 1.98e-56 190 38 5 313 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
Q7MM78 4.1e-56 191 39 5 319 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 4.1e-56 191 39 5 319 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
P0CL46 8.26e-56 196 47 1 230 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WAA4 8.52e-56 196 47 1 230 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
Q8D4F9 8.57e-56 192 36 4 331 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
A8GG93 1.68e-55 191 39 7 335 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
Q9ZIB7 2.26e-55 191 43 1 230 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
Q9KT84 2.59e-55 189 37 4 316 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0AFU5 4.53e-55 189 43 1 232 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 4.53e-55 189 43 1 232 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
P10576 5.07e-55 189 37 7 340 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
O87455 5.96e-55 190 35 3 329 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q46802 1.13e-54 191 39 6 310 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
Q43965 2.01e-54 189 38 7 323 1 mopR Phenol regulator MopR Acinetobacter guillouiae
P05407 2.98e-54 189 35 5 358 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q6D8R9 3.1e-54 188 34 4 334 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9K4V0 3.97e-54 188 38 4 327 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P09828 6.71e-54 187 44 2 236 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
Q9I4N3 1.21e-53 186 43 1 220 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P38022 1.64e-53 185 37 8 324 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
Q5E3W8 1.67e-53 186 35 2 309 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
P74839 1.98e-53 186 45 5 233 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O85057 4.84e-53 186 37 6 325 1 None Limonene hydroxylase Geobacillus stearothermophilus
A0KEJ0 3.03e-52 182 37 6 335 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
O54426 3.89e-52 182 39 4 258 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
P77743 1.02e-51 182 43 6 241 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
A4STH5 2.25e-51 180 47 1 206 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
P0A2D7 1.1e-50 179 39 4 258 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 1.1e-50 179 39 4 258 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
P37931 1.48e-50 173 42 2 214 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
P03028 1.71e-50 179 46 2 232 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
O25408 2.46e-50 174 43 2 217 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
P54529 5.95e-50 179 43 5 239 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
P07604 7.97e-50 176 38 4 258 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
P13632 6.61e-47 167 43 1 204 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
P10046 2.32e-46 166 44 1 206 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
P37930 1.44e-45 160 33 5 312 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
Q01265 2.94e-45 159 34 4 287 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
P26316 1.3e-44 157 40 2 214 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
Q9KN48 2.78e-44 162 41 1 228 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O31551 2.81e-44 163 40 3 230 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
P31908 6.69e-43 157 44 1 218 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q04849 2.39e-42 155 33 7 326 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P28614 9.13e-42 157 34 8 336 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P36219 5.82e-41 148 39 3 224 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
P44694 2e-38 142 35 2 236 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P26408 2.48e-35 137 31 6 331 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
Q68WH4 1.92e-29 120 31 8 280 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZCY9 4.52e-29 119 31 8 280 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q4UL27 1.07e-28 118 30 8 280 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P38035 3.87e-27 114 33 6 256 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
Q1RJS1 2.19e-26 112 30 8 280 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
P76016 6.1e-25 108 33 2 204 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
Q92HC2 1.21e-24 107 29 8 280 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P54156 1.46e-24 105 34 6 229 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
P45512 1.88e-24 107 30 2 220 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
P55610 1.49e-18 90 26 8 320 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P09432 2.63e-18 89 32 6 217 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P23914 3.52e-18 89 35 8 190 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
D0ZLR9 3.45e-17 86 37 4 152 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)
P06184 1.91e-06 52 26 7 235 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06650
Feature type CDS
Gene pspF
Product phage shock protein operon transcriptional activator
Location 1454644 - 1455648 (strand: 1)
Length 1005 (nucleotides) / 334 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1005
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00158 Sigma-54 interaction domain
PF02954 Bacterial regulatory protein, Fis family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3829 Transcription (K)
Signal transduction mechanisms (T)		 KT RocR-type transcriptional regulator, contains PAS, AAA-type ATPase, and DNA-binding Fis domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03974 psp operon transcriptional activator - -

Protein Sequence

MQENLETIIGVDSHFIDVLEQTSALAQLKKPVLIIGERGTGKELIAHRLHYLSPWWQGPFISINCSALNDNLLDSELFGHEAGAFTGAKNRHQGRFERADGGSLFLDELATAPMLVQEKLLRVIEYGHLERVGGSQSLHVDVRLICATNADLPAMADEGKFRADLLDRLAFDVIRLPPLRERKADIMLLAENFAIAMCQELGLPFFPGFSDNARQILLDYRWPGNIRELKNVVERSVYRHGTSERELDNIIIDPFARFSSSTIAEQPQPQKEMIFSLPPLPLDLRQWQHSTEKNLLEQALKESRYNQKMAAEKLALSYDQLRGLIKKHHIKLSV

Flanking regions ( +/- flanking 50bp)

ACACTACTGATAGACTGGTGAGAAATACCTCAATATGGTGATTTTAACCAATGCAAGAGAATTTAGAGACAATAATTGGTGTTGATAGTCATTTTATCGATGTTTTAGAACAAACCTCAGCCCTCGCTCAACTCAAAAAACCAGTATTGATTATTGGTGAACGTGGTACAGGTAAAGAGCTTATCGCTCATCGATTACACTATTTATCACCTTGGTGGCAAGGACCATTTATTTCCATTAACTGTTCGGCATTAAACGATAATTTGCTTGATTCAGAGCTGTTTGGTCATGAAGCGGGGGCATTTACCGGAGCGAAAAACCGCCATCAAGGACGTTTTGAGCGTGCCGATGGCGGCTCTCTTTTTCTTGATGAACTAGCCACTGCACCGATGCTGGTGCAAGAAAAGTTGCTACGCGTTATTGAGTATGGCCATTTAGAACGAGTGGGAGGTAGTCAATCGCTGCATGTCGATGTGCGCCTTATCTGTGCCACTAACGCAGATCTACCGGCAATGGCGGACGAGGGTAAATTTCGTGCTGATTTACTGGATAGATTGGCCTTTGACGTAATTCGCCTGCCCCCTTTAAGAGAGCGTAAAGCCGATATTATGCTACTGGCTGAAAACTTTGCGATTGCTATGTGCCAAGAGTTAGGGTTGCCCTTTTTCCCCGGTTTTAGTGACAATGCCCGCCAAATTCTTTTAGATTACCGTTGGCCGGGGAATATTCGCGAACTAAAAAATGTGGTTGAACGTTCTGTTTATCGCCATGGCACCAGTGAGCGTGAACTGGATAATATTATTATCGACCCTTTTGCGCGCTTTTCGTCTTCAACCATAGCTGAGCAACCTCAGCCTCAAAAGGAGATGATCTTTTCATTACCGCCATTACCGCTAGATTTACGCCAGTGGCAACATAGCACAGAAAAAAACTTACTAGAGCAAGCATTGAAAGAGAGTCGTTATAACCAGAAGATGGCGGCAGAAAAATTAGCATTGAGCTATGATCAATTACGCGGATTAATAAAAAAACATCACATAAAATTGTCGGTCTAGTTTTGTATAAGATGAGCAAAGACAGAATGAAATACAGACAAAAAAAAAGC