Homologs in group_1922

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14300 FBDBKF_14300 93.3 Morganella morganii S1 fabB beta-ketoacyl-ACP synthase I
EHELCC_07980 EHELCC_07980 93.3 Morganella morganii S2 fabB beta-ketoacyl-ACP synthase I
NLDBIP_08305 NLDBIP_08305 93.3 Morganella morganii S4 fabB beta-ketoacyl-ACP synthase I
LHKJJB_05960 LHKJJB_05960 93.3 Morganella morganii S3 fabB beta-ketoacyl-ACP synthase I
HKOGLL_04955 HKOGLL_04955 93.3 Morganella morganii S5 fabB beta-ketoacyl-ACP synthase I
PMI_RS08800 PMI_RS08800 87.1 Proteus mirabilis HI4320 fabB beta-ketoacyl-ACP synthase I

Distribution of the homologs in the orthogroup group_1922

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1922

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A953 0.0 689 81 2 405 1 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Escherichia coli (strain K12)
P0A954 0.0 689 81 2 405 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P43710 0.0 585 70 2 406 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q02K94 0.0 568 68 1 405 1 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q89AY4 0.0 513 60 4 406 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P57193 3.7e-168 479 56 4 406 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8KA28 1.55e-161 462 58 5 407 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
O34340 1.05e-87 275 42 9 412 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Bacillus subtilis (strain 168)
Q83E37 1.64e-86 271 41 11 413 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
P56902 1.68e-86 272 41 9 424 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Rhizobium meliloti (strain 1021)
Q9KQH9 3.15e-84 266 40 10 415 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P55338 2.23e-83 263 40 9 413 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Vibrio harveyi
P0AAI8 9.58e-78 249 38 7 413 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Shigella flexneri
P0AAI5 9.58e-78 249 38 7 413 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli (strain K12)
P0AAI6 9.58e-78 249 38 7 413 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAI7 9.58e-78 249 38 7 413 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli O157:H7
P73283 3.79e-76 245 38 9 414 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8NXE1 2.53e-75 243 39 12 415 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MW2)
Q6GAU2 2.53e-75 243 39 12 415 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MSSA476)
Q5HHA1 2.53e-75 243 39 12 415 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain COL)
Q7A6F8 5.07e-75 242 39 12 415 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain N315)
Q99VA6 5.07e-75 242 39 12 415 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GIA3 1.4e-74 241 39 12 414 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MRSA252)
Q8L3X9 2.11e-72 236 38 13 433 1 KAS 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Arabidopsis thaliana
Q5TKS0 3.3e-72 234 39 12 409 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 (Fragment) Staphylococcus aureus
O94297 2.47e-70 230 34 11 424 3 SPBC887.13c Putative 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P52410 3.65e-68 226 36 11 418 1 KAS1 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic Arabidopsis thaliana
Q9D404 1.38e-67 224 34 13 423 1 Oxsm 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Mus musculus
Q9NWU1 6.6e-67 222 35 11 420 1 OXSM 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Homo sapiens
P23902 1.95e-63 213 35 10 416 1 KAS12 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic Hordeum vulgare
Q9C9P4 3.65e-62 212 35 11 416 1 KAS2 3-oxoacyl-[acyl-carrier-protein] synthase II, chloroplastic Arabidopsis thaliana
P72331 1.42e-60 204 33 7 408 3 nodE Nodulation protein E Rhizobium sp. (strain N33)
Q0VCA7 8.6e-60 204 34 11 418 2 OXSM 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Bos taurus
P06230 4.09e-58 197 33 11 413 3 nodE Nodulation protein E Rhizobium meliloti (strain 1021)
P9WQD7 9.96e-56 192 33 11 408 1 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD6 9.96e-56 192 33 11 408 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63457 9.96e-56 192 33 11 408 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P06231 1.1e-54 189 33 11 412 3 nodE Nodulation protein E Rhizobium meliloti
P9WQD9 5.58e-54 187 35 12 398 1 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD8 5.58e-54 187 35 12 398 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
H8ESN0 5.58e-54 187 35 12 398 2 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain ATCC 35801 / TMC 107 / Erdman)
P63455 5.58e-54 187 35 12 398 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P04684 1.22e-53 186 31 5 406 3 nodE Nodulation protein E Rhizobium leguminosarum bv. trifolii
O69473 3.1e-52 182 31 9 409 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium leprae (strain TN)
P04683 1.36e-51 181 33 12 414 3 nodE Nodulation protein E Rhizobium leguminosarum bv. viciae
P39525 4.24e-51 180 30 15 449 1 CEM1 3-oxoacyl-[acyl-carrier-protein] synthase homolog Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9CBS7 4.29e-51 179 34 11 398 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium leprae (strain TN)
Q02059 3.02e-50 179 33 13 424 1 SCO5087 Actinorhodin polyketide putative beta-ketoacyl synthase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q05356 2.2e-49 175 32 14 416 3 sch1 Putative polyketide beta-ketoacyl synthase 1 Streptomyces halstedii
Q02578 2.44e-45 164 30 17 424 3 curA Putative polyketide beta-ketoacyl synthase 1 Streptomyces cyaneus
P23155 1.92e-44 162 30 16 425 3 SCO5318 Putative polyketide beta-ketoacyl synthase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P16540 4.69e-43 158 31 11 417 3 gra-orf1 Granaticin polyketide putative beta-ketoacyl synthase 1 Streptomyces violaceoruber
P41175 7.32e-43 158 30 13 421 3 None Putative polyketide beta-ketoacyl synthase 1 Streptomyces virginiae
P16538 7.5e-42 155 30 9 421 1 tcmK Tetracenomycin polyketide synthase ketoacyl synthase alpha subunit Streptomyces glaucescens
P43678 2.18e-40 151 31 12 423 3 None Oxytetracycline polyketide putative beta-ketoacyl synthase 1 Streptomyces rimosus
P40804 3.3e-36 140 28 9 398 1 pksF Polyketide biosynthesis malonyl-ACP decarboxylase PksF Bacillus subtilis (strain 168)
Q54IX3 1.07e-30 128 26 13 435 3 pks26 Probable polyketide synthase 26 Dictyostelium discoideum
Q55E72 1.54e-28 122 27 15 449 1 stlA Probable polyketide synthase 1 Dictyostelium discoideum
I6X8D2 2.79e-27 118 31 8 292 1 pks13 Polyketide synthase Pks13 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
B3FWU0 5.4e-27 117 30 12 341 1 rdc5 Reducing polyketide synthase rdc5 Metacordyceps chlamydosporia
Q54FQ3 2.44e-25 112 27 7 291 3 pks29 Probable polyketide synthase 29 Dictyostelium discoideum
Q54FQ2 2.85e-25 112 28 8 291 3 pks30 Probable polyketide synthase 30 Dictyostelium discoideum
Q869X2 3.55e-25 112 25 12 346 3 pks17 Probable polyketide synthase 17 Dictyostelium discoideum
Q54FC8 2.09e-24 109 27 7 290 3 pks39 Probable polyketide synthase 39 Dictyostelium discoideum
Q54FN2 2.81e-24 109 28 7 285 3 pks34 Probable polyketide synthase 34 Dictyostelium discoideum
Q558W4 3.33e-24 108 27 8 306 3 pks15 Probable polyketide synthase 15 Dictyostelium discoideum
Q54FD2 3.74e-24 108 27 7 290 3 pks38 Probable polyketide synthase 38 Dictyostelium discoideum
Q869W9 4.66e-24 108 25 14 432 2 pks16 Probable polyketide synthase 16 Dictyostelium discoideum
Q54FN7 5.22e-24 108 26 7 295 3 pks33 Probable polyketide synthase 33 Dictyostelium discoideum
P16539 6.94e-24 105 27 17 415 1 tcmL Tetracenomycin polyketide synthase ketoacyl synthase beta subunit Streptomyces glaucescens
B0G170 1.88e-23 106 26 7 286 3 pks28 Probable polyketide synthase 28 Dictyostelium discoideum
C8VJR7 3.02e-23 106 26 15 418 1 alnA Highly reducing polyketide synthase alnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q54FP8 3.25e-23 105 27 8 290 3 pks32 Probable polyketide synthase 32 Dictyostelium discoideum
Q54FQ1 3.7e-23 105 28 8 284 3 pks31 Probable polyketide synthase 31 Dictyostelium discoideum
W7LKX1 8.51e-23 104 29 8 302 2 FUM1 Highly reducing polyketide synthase FUM1 Gibberella moniliformis (strain M3125 / FGSC 7600)
Q71SP7 1.01e-22 104 27 16 422 1 FASN Fatty acid synthase Bos taurus
Q54G30 1.23e-22 104 26 7 289 3 pks27 Probable polyketide synthase 27 Dictyostelium discoideum
A0A075TRC0 2.55e-22 103 25 9 348 1 patK 6-methylsalicylic acid synthase Penicillium expansum
S0EEY3 3.36e-22 103 28 14 388 1 FUS1 Fusarin C synthetase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q54KU3 1.51e-21 100 25 9 349 3 pks25 Probable polyketide synthase 25 Dictyostelium discoideum
G3Y419 1.89e-21 100 26 11 351 1 yanA 6-methylsalicylic acid synthase Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
Q55CN6 1.94e-21 100 25 9 277 3 pks3 Probable polyketide synthase 3 Dictyostelium discoideum
A1D8I9 2.39e-21 100 28 11 358 3 nscA Non-reducing polyketide synthase nscA Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q54B49 2.47e-21 100 27 10 305 3 pks45 Probable polyketide synthase 45 Dictyostelium discoideum
P12276 2.73e-21 100 29 14 340 1 FASN Fatty acid synthase Gallus gallus
Q559A9 3.32e-21 100 23 9 348 3 pks13 Probable polyketide synthase 13 Dictyostelium discoideum
Q4WQZ5 3.98e-21 99 28 15 343 2 tpcC Atrochrysone carboxylic acid synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
W7MLD7 3.98e-21 99 28 13 388 1 FUS1 Fusarin C synthetase Gibberella moniliformis (strain M3125 / FGSC 7600)
Q02579 4e-21 97 26 16 428 3 curB Putative polyketide beta-ketoacyl synthase 2 Streptomyces cyaneus
Q4WA61 4.17e-21 99 27 11 358 3 nscA Non-reducing polyketide synthase nscA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q54B51 6.32e-21 99 26 10 305 3 pks44 Probable polyketide synthase 44 Dictyostelium discoideum
A0A6S5ZY48 6.95e-21 99 28 7 295 2 g433 Highly reducing polyketide synthase g433 Fusarium sp.
D7PHZ2 7.17e-21 99 26 14 430 1 vrtA Non-reducing polyketide synthase vrtA Penicillium aethiopicum
P12785 7.27e-21 99 28 12 335 1 Fasn Fatty acid synthase Rattus norvegicus
P19096 7.75e-21 99 28 13 336 1 Fasn Fatty acid synthase Mus musculus
O31782 9.1e-21 98 27 11 354 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
O31782 5.54e-16 84 27 14 357 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
O31782 3.83e-14 78 23 16 430 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
Q54KU5 1.09e-20 98 27 9 293 3 pks24 Probable polyketide synthase 24 Dictyostelium discoideum
Q9ZGI5 1.1e-20 98 29 8 296 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q9ZGI5 2.91e-17 88 26 11 347 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q9ZGI5 9.49e-14 77 27 12 350 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
A0A0Y0M151 1.13e-20 98 28 10 342 1 cla2 Highly reducing polyketide synthase cla2 Cladosporium cladosporioides
A0A3G9H990 1.31e-20 98 29 8 277 1 ALT1 Highly reducing polyketide synthase ALT1 Alternaria alternata
A0A6J4B487 1.42e-20 98 27 14 396 3 LUC5 Hybrid PKS-NRPS synthetase LUC5 Fusarium sp.
G2Q9A5 1.42e-20 98 27 9 314 1 mycA Hybrid PKS-NRPS synthetase mycA Thermothelomyces thermophilus (strain ATCC 42464 / BCRC 31852 / DSM 1799)
A0A1W5T1U1 1.66e-20 97 31 13 286 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum
Q558Y6 1.72e-20 97 23 15 448 3 pks14 Probable polyketide synthase 14 Dictyostelium discoideum
B0G138 2.03e-20 97 24 8 289 3 pks21 Probable polyketide synthase 21 Dictyostelium discoideum
S7ZFK6 2.2e-20 97 31 13 286 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum (strain 114-2 / CGMCC 5302)
A0A0G0AID6 2.32e-20 97 27 15 390 1 thnA Hybrid PKS-NRPS synthetase thnA Trichoderma harzianum
A0A0M4L8I7 2.51e-20 97 27 11 354 1 aurA Highly reducing polyketide synthase aurA Calcarisporium arbuscula
B8N8R0 2.85e-20 97 26 13 358 2 afvB Non-reducing polyketide synthase afvB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
C5H885 2.93e-20 97 28 12 345 3 rads1 Reducing polyketide synthase rads1 Floropilus chiversii
C5FM57 4.64e-20 96 28 11 358 3 nscA Non-reducing polyketide synthase nscA Arthroderma otae (strain ATCC MYA-4605 / CBS 113480)
P49327 4.72e-20 96 28 13 335 1 FASN Fatty acid synthase Homo sapiens
Q54T36 4.74e-20 96 23 7 289 3 pks19 Probable polyketide synthase 19 Dictyostelium discoideum
P40806 4.76e-20 96 26 10 356 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 8.22e-20 95 24 13 423 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 1.72e-15 82 26 12 361 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
Q2T4N1 5.3e-20 96 28 8 297 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 1.57e-13 76 26 10 352 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 2.55e-13 75 25 12 350 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 9.5e-12 70 26 10 305 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q3S2U6 5.37e-20 96 26 11 371 1 mokB Lovastatin diketide synthase mokB Monascus pilosus
D9N1A1 6.42e-20 95 27 9 346 2 ACTTS3 Highly reducing polyketide synthase ACTTS3 Alternaria alternata
P9WEZ4 7.3e-20 95 26 10 341 2 pytA Hybrid PKS-NRPS synthetase pytA Aspergillus terreus
Q86JI5 7.72e-20 95 23 14 449 2 pks5 Probable polyketide synthase 5 Dictyostelium discoideum
B6HNK3 7.89e-20 95 27 18 424 3 sorA Highly reducing polyketide synthase sorA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A0A482N9V7 9.28e-20 95 27 10 348 1 iccA Hybrid PKS-NRPS synthetase iccA Talaromyces variabilis
Q54ED7 9.37e-20 95 24 8 295 3 pks40 Probable polyketide synthase 40 Dictyostelium discoideum
E4V2N2 9.98e-20 95 28 11 358 3 nscA Non-reducing polyketide synthase nscA Arthroderma gypseum (strain ATCC MYA-4604 / CBS 118893)
P96202 1.08e-19 95 26 14 427 1 ppsC Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7TXL8 1.08e-19 95 26 14 427 1 ppsC Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0CZH1 1.09e-19 94 26 10 341 2 pytA Hybrid PKS-NRPS synthetase pytA (Fragment) Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0D159 1.19e-19 95 29 13 304 2 ATEG_00325 Hybrid PKS-NRPS synthetase ATEG_00325 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
G0R6S8 1.24e-19 95 28 19 424 2 sor1 Highly reducing polyketide synthase sor1 Hypocrea jecorina (strain QM6a)
M2XHZ5 1.27e-19 95 27 12 389 2 pksA Norsolorinic acid synthase Dothistroma septosporum (strain NZE10 / CBS 128990)
Q30DW5 1.27e-19 95 27 12 389 2 pksA Norsolorinic acid synthase Dothistroma septosporum
S7Z800 1.48e-19 95 29 10 287 3 opdA Hybrid PKS-NRPs synthetase opdA Penicillium oxalicum (strain 114-2 / CGMCC 5302)
A0A167LUQ4 1.48e-19 95 27 13 393 3 fumoS Fumosorinone synthetase Cordyceps fumosorosea (strain ARSEF 2679)
Q5ATG8 1.53e-19 95 25 14 391 1 apdA Hybrid PKS-NRPS synthetase apdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q4W944 1.7e-19 94 27 13 381 1 encA Atrochrysone carboxylic acid synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
K2QVI8 1.74e-19 94 28 9 284 1 dpmpA Non-reducing polyketide synthase dpmpA Macrophomina phaseolina (strain MS6)
A0A017SEX7 1.74e-19 94 28 8 281 1 fogA Highly reducing polyketide synthase fogA Aspergillus ruber (strain CBS 135680)
Q03132 2.35e-19 94 26 9 335 1 eryA 6-deoxyerythronolide-B synthase EryA2, modules 3 and 4 Saccharopolyspora erythraea
Q03132 4.85e-15 81 25 11 340 1 eryA 6-deoxyerythronolide-B synthase EryA2, modules 3 and 4 Saccharopolyspora erythraea
A0A1L9WLD9 2.57e-19 94 29 14 345 1 AacuL Atrochrysone carboxylic acid synthase AacuL Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
Q84HC6 2.61e-19 94 23 10 360 1 ncsB Neocarzinostatin naphthoate synthase Streptomyces carzinostaticus
A0A1L7U4V5 2.8e-19 94 26 7 310 2 FMN1 Reducing polyketide synthase 8 Fusarium mangiferae
K3VA96 2.9e-19 94 25 8 339 3 PKS40 Highly reducing polyketide synthase 40 Fusarium pseudograminearum (strain CS3096)
A0A193PS74 3.03e-19 94 28 14 413 1 stbA Non-reducing polyketide synthase stbA Stachybotrys bisbyi
A0A2P1DP91 3.05e-19 94 24 9 348 1 macA 6-methylsalicylic acid synthase Penicillium terrestre
Q2ABP6 3.23e-19 94 27 16 394 1 pksF Reducing polyketide synthase pksF Alternaria solani
P22367 3.31e-19 94 24 9 347 1 None 6-methylsalicylic acid synthase Penicillium patulum
E9F5E7 3.46e-19 94 28 9 284 1 subA Non-reducing polyketide synthase subA Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
P9WES9 3.47e-19 94 27 7 275 1 PFUR17_0229 Non-reducing polyketide synthase PFUR17_0229 Pseudevernia furfuracea
B0G100 3.53e-19 94 23 13 448 3 pks7 Probable polyketide synthase 7 Dictyostelium discoideum
Q7TXM0 3.53e-19 93 28 10 344 1 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q54ED6 3.66e-19 93 21 9 355 3 pks41 Probable polyketide synthase 41 Dictyostelium discoideum
F2S6Z9 4.36e-19 93 27 9 355 3 nscA Non-reducing polyketide synthase nscA Trichophyton tonsurans (strain CBS 112818)
Q54TW0 4.48e-19 93 25 9 292 2 pks18 Probable polyketide synthase 18 Dictyostelium discoideum
Q55DM7 4.73e-19 93 25 18 450 3 pks2 Probable polyketide synthase 2 Dictyostelium discoideum
I1RVD8 5.04e-19 93 28 10 343 3 PKS6 Highly reducing polyketide synthase PKS6 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
F2PWS5 6.6e-19 92 27 9 355 3 nscA Non-reducing polyketide synthase nscA Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
D4CZZ2 7.13e-19 92 27 11 358 3 nscA Non-reducing polyketide synthase nscA Trichophyton verrucosum (strain HKI 0517)
A0A2Z5TM64 7.17e-19 92 27 10 351 3 himA Polyketide synthase-nonribosomal peptide synthetase hybrid himA Aspergillus japonicus
D4AWH3 8.3e-19 92 27 11 358 3 nscA Non-reducing polyketide synthase nscA Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
F2T0M0 8.61e-19 92 27 11 358 3 nscA Non-reducing polyketide synthase nscA Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
A0A067XNI2 8.72e-19 92 27 14 344 2 ptaA Non-reducing polyketide synthase ptaA Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
P9WEX6 9.23e-19 92 28 9 284 1 dpmaA Non-reducing polyketide synthase dpmaA Metarhizium anisopliae
Q5KTM9 9.51e-19 92 27 9 338 1 alt5 Highly reducing polyketide synthase alt5 Alternaria solani
A0A0U5GK88 9.59e-19 92 28 15 357 1 ausV Highly reducing polyketide synthase ausV Aspergillus calidoustus
A0A1L9WN37 1.02e-18 92 25 12 348 1 acuA 6-methylsalicylic acid synthase acuA Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
B0G0Z9 1.13e-18 92 22 12 445 3 pks6 Probable polyketide synthase 6 Dictyostelium discoideum
A0A481WNP4 1.14e-18 92 28 9 281 3 traA Hybrid PKS-NRPS synthetase traA Penicillium crustosum
P9WQE7 1.21e-18 92 27 10 344 1 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q5BEJ4 1.22e-18 92 29 13 294 1 afoG Asperfuranone polyketide synthase afoG Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P0DO30 1.23e-18 92 26 11 374 1 iliA Hybrid PKS-NRPS synthetase iliA Neonectria sp. (strain DH2)
E9KMQ2 1.38e-18 92 28 7 275 2 PKS16 Non-reducing polyketide synthase PKS16 Cladonia grayi
P9WQE6 1.4e-18 92 27 10 344 3 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A0A0N7D745 1.43e-18 92 28 9 306 2 Dhc5 Non-reducing polyketide synthase Dhc5 Alternaria cinerariae
A0A4P8DJV2 1.58e-18 91 25 11 355 3 dmxL2 Highly reducing polyketide synthase dmxL2 Cryptosporiopsis sp. (strain 8999)
P23156 1.63e-18 90 26 15 421 3 SCO5317 Putative polyketide beta-ketoacyl synthase 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q7SHI6 1.64e-18 91 30 8 279 2 srdA Highly reducing polyketide synthase srdA Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A0A2L0P0K3 1.78e-18 91 27 10 354 1 TwmB Polyketide synthase-nonribosomal peptide synthetase TwmB Talaromyces wortmannii
A0A8F4S8Q3 1.98e-18 91 27 13 355 1 gkaA Hybrid PKS-NRPS synthetase gkaA Penicillium citrinum
A0A1B3PEI8 2.09e-18 91 26 8 271 1 ORF-B Polyunsaturated fatty acid synthase subunit B Thraustochytrium sp. (strain ATCC 26185 / S-3)
B6F209 2.64e-18 91 24 13 424 1 cpaA Cyclo-acetoacetyl-L-tryptophan synthase Aspergillus oryzae
Q86AE3 2.74e-18 91 23 14 446 2 pks9 Probable polyketide synthase 9/36 Dictyostelium discoideum
A0A6H0YV38 2.75e-18 90 27 7 275 2 crz7 Non-reducing polyketide synthase crz7 Cladonia metacorallifera
A0A1B4XBH3 3.05e-18 90 25 8 346 3 sdnO Highly reducing polyketide synthase sdnO Sordaria araneosa
Q8J0F5 3.24e-18 90 26 7 292 1 mlcB Compactin diketide synthase mlcB Penicillium citrinum
S3D9F1 3.64e-18 90 26 8 297 1 gloL Highly reducing polyketide synthase gloL Glarea lozoyensis (strain ATCC 20868 / MF5171)
G4MVZ2 3.64e-18 90 25 10 355 1 ACE1 Polyketide synthase-nonribosomal peptide synthetase ACE1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
G9N4B2 3.64e-18 90 27 8 276 1 virA Highly reducing polyketide synthase virA Hypocrea virens (strain Gv29-8 / FGSC 10586)
A0A8F4S6Z6 3.92e-18 90 29 11 303 1 pydA Hybrid PKS-NRPS synthetase pydA Acremonium sp.
A0A6F9DXA0 4.1e-18 90 25 16 421 1 men1 Partially reducing polyketide synthase men1 Menisporopsis theobromae
B3FWT6 4.4e-18 90 29 10 299 1 rdc1 Non-reducing polyketide synthase rdc1 Metacordyceps chlamydosporia
B6QK81 4.49e-18 90 30 11 283 3 pks12 Non-reducing polyketide synthase pks12 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
D7RJN6 4.49e-18 90 30 11 283 3 pks12 Non-reducing polyketide synthase pks12 Talaromyces marneffei
N4WHA7 4.54e-18 90 26 9 287 3 PKS2 Reducing polyketide synthase PKS2 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
A0A3T0QHT6 5.57e-18 90 27 10 304 1 pvhA Hybrid PKS-NRPS synthetase pvhA Talaromyces variabilis
Q12053 5.68e-18 90 27 11 371 1 aflC Norsolorinic acid synthase Aspergillus parasiticus (strain ATCC 56775 / NRRL 5862 / SRRC 143 / SU-1)
A0A0N0DCA3 6.15e-18 90 28 8 275 2 DEP5 Reducing polyketide synthase DEP5 Fusarium langsethiae
A0R1E8 7.18e-18 89 26 9 337 1 pks5 Mycocerosic acid synthase-like polyketide synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
B8MKY6 7.45e-18 89 29 11 281 1 tstA Highly reducing polyketide synthase tstA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
A0A0E4AZP0 8.05e-18 89 27 10 306 3 fsa1 Hybrid PKS-NRPS synthetase fsa1 Fusarium sp. (strain FN080326)
P40872 8.1e-18 89 26 10 346 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
P40872 8.56e-14 77 25 8 284 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
P40872 1.84e-12 73 24 12 359 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
A0A5C1RDA3 8.15e-18 89 26 8 349 3 orf7 Highly reducing polyketide synthase Didymella fabae
A0A7R7ZK98 8.28e-18 89 27 14 360 3 AcPKS Atrochrysone carboxylic acid synthase Aspergillus chevalieri
A0A1P8NTI3 8.87e-18 89 29 11 321 2 pks8 Non-reducing polyketide synthase 8 Pestalotiopsis microspora
P9WET2 9.4e-18 89 28 7 285 1 Preu6 Non-reducing polyketide synthase Preu6 Preussia isomera
A2QX22 1.06e-17 89 27 11 336 1 adaA Non-reducing polyketide synthase adaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
B8NJG3 1.15e-17 89 29 9 287 3 lepA Hybrid PKS-NRPS synthetase lepA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
G3KLH6 1.15e-17 89 27 11 336 1 adaA Non-reducing polyketide synthase adaA Aspergillus niger
S4W172 1.29e-17 89 27 10 306 1 eqxS Equisetin synthetase eqxS Fusarium heterosporum
B8MV60 1.36e-17 89 26 13 380 3 tpeB Non-reducing polyketide synthase tpeB Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
B0G103 1.37e-17 89 22 14 421 3 pks10 Probable polyketide synthase 10 Dictyostelium discoideum
Q05470 1.53e-17 89 25 12 412 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 5.53e-16 84 24 13 441 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 2.73e-13 75 26 8 301 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 5.18e-13 74 30 14 302 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
A0A098D8A0 1.62e-17 88 27 9 340 2 ZEA2 Highly reducing polyketide synthase ZEA2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q5SBL6 1.66e-17 88 26 14 387 3 fsdS Fusaridione A synthetase fsdS Fusarium heterosporum
A0A1L9WQM9 1.67e-17 88 28 11 306 2 acrA Highly reducing polyketide synthase acrA Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A1CFL8 1.7e-17 88 23 10 347 1 patK 6-methylcalicylic acide synthase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
S0DS59 1.74e-17 88 27 11 295 2 PKS-NRPS1 Trichosetin synthetase PKS-NRPS1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q9R9J1 1.82e-17 88 27 13 366 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
A0A7L9EYL1 1.96e-17 88 26 14 356 1 xenE Hybrid PKS-NRPS synthetase xenE Xenoacremonium sinensis
A1KQG0 2.25e-17 88 29 11 338 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P9WQE9 2.27e-17 88 29 11 338 1 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE8 2.27e-17 88 29 11 338 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U9F4 2.27e-17 88 29 11 338 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q7TVK8 2.27e-17 88 29 11 338 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0A5C1RD96 2.34e-17 88 28 9 282 3 pksAC Non-reducing polyketide synthase AC Didymella fabae
L7X8J4 2.43e-17 88 26 9 339 1 curS1 Highly reducing polyketide synthase curS1 Aspergillus terreus
A0A0S6XH49 2.6e-17 88 26 11 344 1 frbB Highly reducing polyketide synthase frbB Fungal sp. (strain No.11243)
A0A0H4ADX3 2.86e-17 87 26 12 336 2 None Non-reducing polyketide synthase PKS19 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
B0G101 2.96e-17 87 23 13 449 3 pks8 Probable polyketide synthase 8/35 Dictyostelium discoideum
A0JJU1 3.23e-17 87 25 12 381 1 tenS Tenellin synthetase Beauveria bassiana
Q02251 3.31e-17 87 28 9 300 1 mas Mycocerosic acid synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q3S2T9 3.32e-17 87 28 11 310 1 mokA Lovastatin nonaketide synthase mokA Monascus pilosus
Q9ZGI4 3.37e-17 87 26 10 342 1 pikAII Narbonolide/10-deoxymethynolide synthase PikA2, modules 3 and 4 Streptomyces venezuelae
Q9ZGI4 1.49e-16 85 26 7 282 1 pikAII Narbonolide/10-deoxymethynolide synthase PikA2, modules 3 and 4 Streptomyces venezuelae
D4AU31 3.59e-17 87 25 10 341 3 swnK PKS-NRPS hybrid synthetase swnK Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
E9F8M3 3.84e-17 87 25 11 338 1 swnK PKS-NRPS hybrid synthetase swnK Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
I6XD69 3.86e-17 87 26 10 342 1 pks12 Mycoketide-CoA synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
I6XD69 4.93e-16 84 26 7 283 1 pks12 Mycoketide-CoA synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0A2Z5XAL7 4.1e-17 87 28 12 303 1 phm1 Hybrid PKS-NRPS synthetase phm1 Pyrenochaetopsis sp.
Q5BH30 4.63e-17 87 28 15 363 3 mdpG Atrochrysone carboxylic acid synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q4WKW9 4.97e-17 87 29 7 271 1 fgnA Fumigermin synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q2HBN0 5e-17 87 27 9 307 1 cghG Hybrid PKS-NRPS synthetase cghG Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q5B0D0 5.25e-17 87 27 11 337 1 aptA Non-reducing polyketide synthase aptA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q03131 5.51e-17 87 26 10 339 1 eryA 6-deoxyerythronolide-B synthase EryA1, modules 1 and 2 Saccharopolyspora erythraea
Q03131 5.18e-13 74 28 10 314 1 eryA 6-deoxyerythronolide-B synthase EryA1, modules 1 and 2 Saccharopolyspora erythraea
A0A8D5M692 5.99e-17 87 27 7 276 1 esdpA Non-reducing polyketide synthase esdpA Penicillium shearii
J4KMC1 6.7e-17 87 25 12 382 1 tenS Tenellin synthetase Beauveria bassiana (strain ARSEF 2860)
Q0CJ59 7.33e-17 86 24 11 349 1 atX 6-methylsalicylic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
E9F646 8.41e-17 86 26 8 339 1 Pks1 Polyketide synthase 1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
A0A411KUP8 8.97e-17 86 27 11 352 1 ucsA Hybrid PKS-NRPS synthetase ucsA Acremonium sp.
A0A1V6NYI6 9.42e-17 86 27 11 308 3 verA Highly reducing polyketide synthase verA Penicillium polonicum
B3FWT3 9.75e-17 86 26 9 342 1 hpm8 Reducing polyketide synthase hmp8 Hypomyces subiculosus
G3J453 1.04e-16 86 29 8 267 1 cm3B Highly reducing polyketide synthase cm3B Cordyceps militaris (strain CM01)
A0A1B7YCC9 1.09e-16 86 27 7 285 1 dpchA Non-reducing polyketide synthase dpchA Colletotrichum higginsianum (strain IMI 349063)
W3X8X8 1.11e-16 86 26 9 287 1 fnsA Naringenin synthase Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
A0A6F8RNP4 1.11e-16 86 26 14 393 1 grgA Reducing polyketide synthase grgA Penicillium sp.
G0REX6 1.42e-16 85 28 10 302 1 iliA Hybrid PKS-NRPS synthetase iliA Hypocrea jecorina (strain QM6a)
P96284 1.43e-16 84 26 10 343 1 pks15 Putative inactive phenolphthiocerol synthesis polyketide synthase type I Pks15 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
I1RL11 1.51e-16 85 28 10 285 1 dpfgA Non-reducing polyketide synthase dpfgA Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A1L7U3D7 1.53e-16 85 27 8 277 2 FPY1 Highly reducing polyketide synthase 40 Fusarium mangiferae
A0A0R8YWJ7 1.59e-16 85 29 10 285 1 mpas Methylphloroacetophenone synthase Cladonia uncialis
G3JUI8 1.61e-16 85 27 9 290 1 milA Highly reducing polyketide synthase milA Cordyceps militaris (strain CM01)
K2QYX5 1.61e-16 85 27 10 303 1 mpsA Hybrid PKS-NRPS synthetase mpsA Macrophomina phaseolina (strain MS6)
L7XAV2 1.72e-16 85 28 9 307 1 curS2 Non-reducing polyketide synthase curS2 Aspergillus terreus
Q0D1N9 1.83e-16 85 26 8 297 1 terA Non-reducing polyketide synthase terA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
N4WHE3 1.87e-16 85 28 14 347 3 PKS1 Reducing polyketide synthase PKS1 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
A0A455LLX1 2e-16 85 27 15 376 1 atnH Highly reducing polyketide synthase atnH Arthrinium sp.
P0CU67 2.06e-16 85 27 11 362 1 claG Atrochrysone carboxylic acid synthase Passalora fulva
W6QDA2 2.11e-16 85 33 7 204 1 anuA Highly reducing polyketide synthase anuA Penicillium roqueforti (strain FM164)
A0A2U8NEV6 2.41e-16 85 26 8 338 1 Pks1 Polyketide synthase 1 Metarhizium acridum (strain CQMa 102)
P0CU84 2.5e-16 85 27 10 291 1 apmlA Highly reducing polyketide synthase apmlA Arthrinium phaeospermum
Q9ZGI3 2.52e-16 85 26 7 282 1 pikAIII Narbonolide/10-deoxymethynolide synthase PikA3, module 5 Streptomyces venezuelae
Q02062 2.53e-16 83 24 12 411 1 SCO5088 Actinorhodin polyketide putative beta-ketoacyl synthase 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
G4N296 2.56e-16 85 28 8 279 2 PKS19 Highly reducing polyketide synthase 19 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A0A0C6E0I7 2.62e-16 85 24 9 349 1 bet1 Highly reducing polyketide synthase bet1 Neocamarosporium betae
Q5BA83 2.77e-16 85 26 8 334 3 easB Highly reducing polyketide synthase easB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q0CCY3 2.85e-16 84 28 9 281 1 gedC Atrochrysone carboxylic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q7TXL7 2.97e-16 84 27 11 343 1 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQE3 3.08e-16 84 27 11 343 1 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit D Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE2 3.08e-16 84 27 11 343 3 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A0A0A0RM07 3.45e-16 84 23 12 342 1 MLNS Mellein synthase Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
P9WEQ0 3.52e-16 84 27 11 355 3 olcA Non-reducing polyketide synthase olcA Penicillium canescens
A0A0B4FTU6 3.72e-16 84 26 8 339 1 Pks1 Polyketide synthase 1 Metarhizium anisopliae (strain ARSEF 549)
A0A0B4ESU9 4.07e-16 84 26 8 339 1 Pks1 Polyketide synthase 1 Metarhizium brunneum (strain ARSEF 3297)
A0A1B3PEI6 4.24e-16 84 24 15 391 1 ORF-A Polyunsaturated fatty acid synthase subunit A Thraustochytrium sp. (strain ATCC 26185 / S-3)
Q12397 4.31e-16 84 27 14 389 2 stcA Norsolorinic acid synthase stcA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
G4NEB1 4.39e-16 84 33 7 225 1 NEC1 Highly reducing polyketide synthase NEC1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
P9WET5 4.74e-16 84 27 12 355 1 Preu4 Non-reducing polyketide synthase Preu4 Preussia isomera
B8MYS6 5.43e-16 84 24 14 435 1 pks27 Non-reducing polyketide synthase pks27 Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
A0A097ZPE0 5.51e-16 84 27 9 290 1 andM Non-reducing polyketide synthase andM Emericella variicolor
A0A179H0J7 5.58e-16 84 27 6 285 2 lcsC Highly reducing polyketide synthase lcsC Purpureocillium lilacinum
Q0CF73 6.28e-16 84 23 9 345 1 ATEG_07661 Non-reducing polyketide synthase ATEG_07661 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A2QK66 7.18e-16 83 25 13 358 3 ktnS Kotanin synthase Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q86ZD9 7.41e-16 83 25 12 347 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain C2932)
Q4WLD4 7.56e-16 83 28 14 339 1 pyr2 Non-reducing polyketide synthase pyr2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A0B4G9F9 7.7e-16 83 26 8 339 1 Pks1 Polyketide synthase 1 Metarhizium guizhouense (strain ARSEF 977)
A0A084API3 7.74e-16 83 24 15 420 3 SAT13 Highly reducing polyketide synthase SAT13 Stachybotrys chartarum (strain CBS 109288 / IBT 7711)
G0R6S9 8.34e-16 83 25 8 285 2 sor2 Non-reducing polyketide synthase sor2 Hypocrea jecorina (strain QM6a)
A0A348HAX6 8.86e-16 83 29 10 272 1 phiA Highly reducing polyketide synthase phiA Fungal sp. (strain ATCC 74256)
A0A411PQP9 9.04e-16 83 26 15 348 3 Agnpks1 Atrochrysone carboxylic acid synthase Agnpks1 Paecilomyces divaricatus
P9WET9 9.38e-16 83 27 13 359 1 PvBS090_009107 Non-reducing polyketide synthase PvBS090_009107 Byssochlamys spectabilis
Q7TXK8 9.44e-16 83 27 10 337 1 pks15/1 Phenolphthiocerol synthesis polyketide synthase type I Pks15/1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0A0B4H4F0 9.46e-16 83 26 8 339 1 Pks1 Polyketide synthase 1 Metarhizium majus (strain ARSEF 297)
A0A1W7M1U5 1.05e-15 83 25 11 372 1 pgmA Non-reducing polyketide synthase pgmA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A455LXK0 1.08e-15 83 26 11 312 2 ntnG Non-reducing polyketide synthase ntnG Nectria sp.
A0A0N9HNS9 1.13e-15 82 25 11 354 3 desS Desertorin synthase Aspergillus desertorum
O53901 1.17e-15 82 27 11 340 1 pks5 Mycocerosic acid synthase-like polyketide synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
B6QK76 1.23e-15 82 24 16 403 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
D7RJN5 1.23e-15 82 24 16 403 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei
D7PI15 1.3e-15 82 27 12 306 1 gsfA Non-reducing polyketide synthase gsfA Penicillium aethiopicum
Q54D44 1.47e-15 82 24 7 280 3 pks42 Probable polyketide synthase 42 Dictyostelium discoideum
Q0C9L7 1.49e-15 82 27 12 329 1 ctvA Highly reducing polyketide synthase ctvA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
W7MT31 1.57e-15 82 28 9 288 1 FUB1 Reducing polyketide synthase FUB1 Gibberella moniliformis (strain M3125 / FGSC 7600)
I1S166 1.71e-15 82 26 9 320 2 FSL1 Fusarielin synthase FSL1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q54FI3 2.05e-15 82 24 9 338 1 StlB Polyketide synthase 37 Dictyostelium discoideum
Q2UB00 2.08e-15 82 25 12 366 3 ppsB Reducing polyketide synthase ppsB Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A0A3G9GQ29 2.25e-15 82 27 9 337 1 cdmE 6-hydroxymellein synthase cdmE Talaromyces verruculosus
Q8J0F7 2.31e-15 82 26 8 308 1 mlcA Compactin nonaketide synthase, polyketide synthase component Penicillium citrinum
B8NYX0 2.33e-15 82 23 8 346 2 fluP Cluster 41 polyketide synthase Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
Q03133 2.66e-15 82 26 8 282 1 eryA 6-deoxyerythronolide-B synthase EryA3, modules 5 and 6 Saccharopolyspora erythraea
Q03133 1.86e-06 54 24 11 338 1 eryA 6-deoxyerythronolide-B synthase EryA3, modules 5 and 6 Saccharopolyspora erythraea
A0A1W5T1T1 2.76e-15 82 26 15 375 2 poxF Highly reducing polyketide synthase poxF Penicillium oxalicum
A0A3T0ZHJ0 2.9e-15 81 26 6 285 1 cle1 Triacetic acid lactone synthase cle1 Aspergillus versicolor
D7UQ44 2.93e-15 81 27 9 271 1 sol1 Prosolanapyrone synthase Alternaria solani
B8MV59 3.46e-15 81 23 15 430 3 tpeA Partially reducing polyketide synthase tpeA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
A0A443HK81 3.63e-15 81 25 13 392 1 VdtA Non-reducing polyketide synthase VdtA Byssochlamys spectabilis
Q2HEW5 3.78e-15 81 27 8 286 2 cheA PKS-NRPS hybrid synthetase cheA Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A0A089FSA4 3.95e-15 81 25 11 321 3 prlS Hybrid PKS-NRPS synthetase prlS Fungal sp. (strain NRRL 50135)
Q5BBP5 3.96e-15 81 24 11 351 1 pkhB Highly reducing polyketide synthase pkhB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P9WET1 4.28e-15 81 27 9 281 1 Preu7 Non-reducing polyketide synthase Preu7 Preussia isomera
Q0CF75 4.58e-15 81 27 11 293 1 ATEG_07659 Highly reducing polyketide synthase ATEG_07659 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
B6HN77 4.8e-15 81 27 8 285 3 sorB Non-reducing polyketide synthase sorB Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A0A1B5L6A0 4.87e-15 80 22 12 388 1 UVI_02036160 Non-reducing polyketide synthase ustP Ustilaginoidea virens
F9XMW3 5.07e-15 80 28 8 278 3 PKS1 Non-reducing polyketide synthase PKS1 Zymoseptoria tritici (strain CBS 115943 / IPO323)
A0A2I2F262 5.07e-15 80 27 10 361 1 acdB PKS-NRPS hybrid synthetase acdB Aspergillus candidus
A0A0F7U103 5.21e-15 80 25 8 277 3 ausA Non-reducing polyketide synthase ausA Penicillium brasilianum
A0A0B4H8J1 5.35e-15 80 26 12 353 2 Pks2 Polyketide synthase 2 Metarhizium brunneum (strain ARSEF 3297)
A0A0N7D4P6 5.47e-15 80 26 11 342 2 Dhc3 Highly reducing polyketide synthase Dhc3 Alternaria cinerariae
A0A455M7S4 5.68e-15 80 25 10 330 1 atnG Non-reducing polyketide synthase atnG Arthrinium sp.
S0DTP6 5.74e-15 80 24 8 372 2 FSR1 Non-reducing polyketide synthase fsr1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q54QD3 5.75e-15 80 24 16 439 3 pks22 Probable polyketide synthase 22 Dictyostelium discoideum
A0A7L8UVC9 6.01e-15 80 28 11 296 3 ffsA Polyketide synthase-nonribosomal peptide synthetase ffsA Aspergillus flavipes
A0A089QRB9 6.03e-15 80 25 9 327 1 msl3 Mycolipanoate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
S7RK07 6.22e-15 80 25 12 372 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Gloeophyllum trabeum (strain ATCC 11539 / FP-39264 / Madison 617)
A1CLY8 6.88e-15 80 28 9 299 3 ccsA Polyketide synthase-nonribosomal peptide synthetase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
M2YKT6 7.18e-15 80 25 15 395 2 hps1 Hybrid PKS-NRPS synthetase 1 Dothistroma septosporum (strain NZE10 / CBS 128990)
B1GVX7 7.38e-15 80 26 11 350 2 BOA6 Reducing polyketide synthase BOA6 Botryotinia fuckeliana (strain B05.10)
P9WET3 9.74e-15 80 27 8 278 1 Preu8 Non-reducing polyketide synthase Preu8 Preussia isomera
A0A0D2YG10 9.98e-15 80 28 10 288 1 FUB1 Reducing polyketide synthase FUB1 Fusarium oxysporum f. sp. lycopersici (strain 4287 / CBS 123668 / FGSC 9935 / NRRL 34936)
A0A2I1C3X5 1.12e-14 79 29 7 231 1 nsrB Atrochrysone carboxylic acid synthase nsrB Aspergillus novofumigatus (strain IBT 16806)
Q0CRQ5 1.14e-14 80 27 9 284 1 ATEG_03629 5-methylorsellinic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A084B9Z6 1.15e-14 80 25 7 274 3 SAT8 Non-reducing polyketide synthase SAT8 Stachybotrys chartarum (strain CBS 109288 / IBT 7711)
B2HIL7 1.16e-14 79 26 10 339 1 pks15/1 Phenolphthiocerol synthesis polyketide synthase type I Pks15/1 Mycobacterium marinum (strain ATCC BAA-535 / M)
Q4WAZ9 1.23e-14 79 25 8 315 2 NRPS14 PKS-NRPS hybrid synthetase psoA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
M1WG96 1.26e-14 79 26 13 368 2 CPUR_05437 Non-reducing polyketide synthase CPUR_05437 Claviceps purpurea (strain 20.1)
Q07017 1.32e-14 79 25 10 333 3 orfB Oleandomycin polyketide synthase, modules 5 and 6 Streptomyces antibioticus
Q07017 1.69e-14 79 25 9 342 3 orfB Oleandomycin polyketide synthase, modules 5 and 6 Streptomyces antibioticus
Q50LG3 1.32e-14 79 26 10 342 3 AFT9-1 Highly reducing polyketide synthase AFT9-1 Alternaria alternata
A0A455M2Y3 1.39e-14 79 28 9 273 2 ntnH Highly reducing polyketide synthase ntnH Nectria sp.
A0A2I2F2N6 1.42e-14 79 24 7 279 1 cfoA Chalcone synthase cfoA Aspergillus candidus
F1DBA9 1.51e-14 79 24 8 295 1 mpaC Non-reducing polyketide synthase mapC Penicillium brevicompactum
Q5BEJ6 1.52e-14 79 22 10 347 1 afoE Iterative polyketide synthase afoE Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A481WQB6 1.62e-14 79 25 11 385 1 claF Clavatol synthase claF Penicillium crustosum
A0A2I1BSV9 1.62e-14 79 24 15 415 1 nvfA Non-reducing polyketide synthase nvfA Aspergillus novofumigatus (strain IBT 16806)
P36189 1.62e-14 77 26 14 370 1 FASN Fatty acid synthase (Fragment) Anser anser anser
A0A1U8QN18 1.73e-14 79 24 12 377 1 sdgA Highly reducing polyketide synthase sdgA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1E1FFN8 1.92e-14 79 25 8 277 3 prhL Non-reducing polyketide synthase prhL Penicillium brasilianum
Q54QD1 1.94e-14 79 23 16 439 3 pks23 Probable polyketide synthase 23 Dictyostelium discoideum
P0DUK1 1.94e-14 79 27 12 344 3 pspA Highly reducing polyketide synthase pspA Penicillium soppii
P9WET6 2.13e-14 79 26 11 344 1 Preu3 Non-reducing polyketide synthase Preu3 Preussia isomera
Q9Y7D5 2.3e-14 79 27 11 344 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus
S0DRI1 2.33e-14 79 28 10 288 1 FUB1 Reducing polyketide synthase FUB1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A0B5KU17 2.45e-14 79 24 8 295 1 mpaC' Non-reducing polyketide synthase mapC' Penicillium brevicompactum
A0A6F9DYX9 2.83e-14 78 25 7 317 1 men2 Non-reducing polyketide synthase men2 Menisporopsis theobromae
A0A0B4I1J8 3.06e-14 78 25 13 406 2 Pks2 Polyketide synthase 2 Metarhizium majus (strain ARSEF 297)
Q0UK48 3.25e-14 78 25 10 343 1 sthA Highly reducing polyketide synthase sthA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
O31784 3.9e-14 78 25 14 380 1 pksR Polyketide synthase PksR Bacillus subtilis (strain 168)
O31784 3.35e-11 69 24 18 440 1 pksR Polyketide synthase PksR Bacillus subtilis (strain 168)
Q0C8M3 3.98e-14 78 25 7 307 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q9Y8A5 4.2e-14 78 25 7 307 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus
A0A0B4I1L1 4.74e-14 78 25 11 354 2 Pks2 Polyketide synthase 2 Metarhizium guizhouense (strain ARSEF 977)
A0A3G1DJH7 4.94e-14 77 25 11 347 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
D2E9X0 5.25e-14 77 25 7 274 2 DEP5 Reducing polyketide synthase DEP5 Alternaria brassicicola
Q9HU15 6.21e-14 77 28 10 272 1 fabY Beta-ketoacyl-[acyl-carrier-protein] synthase FabY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0V6Q6 8.53e-14 77 29 6 219 1 phmA Polyketide synthase-nonribosomal peptide synthetase phmA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A0A2V5GX43 8.81e-14 77 26 12 350 3 pyvA Hybrid PKS-NRPS synthetase pyvA Aspergillus violaceofuscus (strain CBS 115571)
C5H882 8.84e-14 77 26 9 293 3 radS2 Non-reducing polyketide synthase rads2 Floropilus chiversii
A0A4P8WAE5 9.5e-14 77 26 11 317 3 pyiS Polyketide synthase-nonribosomal peptide synthetase pyiS Pyricularia grisea
Q5AXA9 9.55e-14 77 25 9 355 1 pkgA Non-reducing polyketide synthase pkgA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1Y0BRF1 9.85e-14 77 23 17 438 3 adrD Non-reducing polyketide synthase adrD Penicillium roqueforti
W6QL47 1e-13 77 25 9 287 3 mpaC Non-reducing polyketide synthase mapC Penicillium roqueforti (strain FM164)
A0A455R5P9 1.04e-13 77 29 11 291 1 ascC Non-reducing polyketide synthase ascC Acremonium egyptiacum
G3XMD1 1.06e-13 77 24 8 291 1 azaB Highly reducing polyketide synthase azaB Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
J4UHQ6 1.16e-13 76 23 9 361 1 OpS1 Orsellinic acid synthase Beauveria bassiana (strain ARSEF 2860)
Q2T4N2 1.17e-13 77 24 6 283 3 thaH Polyketide synthase ThaH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N2 1.18e-10 67 29 6 208 3 thaH Polyketide synthase ThaH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
M3A326 1.21e-13 76 26 8 282 2 PKS8-1 Non-reducing polyketide synthase PKS8-1 Pseudocercospora fijiensis (strain CIRAD86)
A0A0B4FLB2 1.23e-13 76 25 11 354 2 Pks2 Polyketide synthase 2 Metarhizium anisopliae (strain ARSEF 549)
E9ET39 1.39e-13 76 25 11 354 2 Pks2 Polyketide synthase 2 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
A0A161CEU9 1.5e-13 76 24 5 282 1 citS Citrinin polyketide synthase Monascus ruber
Q65Z23 1.5e-13 76 24 5 282 1 pksCT Citrinin polyketide synthase Monascus purpureus
A0A0U4ZX08 1.61e-13 76 27 9 276 1 drtA Low-reducing polyketide synthase drtA Aspergillus calidoustus
E5A7D9 1.72e-13 76 24 12 384 2 pks5 Highly reducing polyketide synthase pks5 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
Q4WZA8 2.12e-13 75 25 13 384 1 alb1 Conidial pigment polyketide synthase alb1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A1R3RGK0 2.14e-13 75 26 7 272 1 otaA Highly reducing polyketide synthase otaA Aspergillus carbonarius (strain ITEM 5010)
Q03149 2.65e-13 75 25 8 337 1 wA Conidial yellow pigment biosynthesis polyketide synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q7TXL9 2.86e-13 75 26 9 375 1 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQE5 2.94e-13 75 26 9 375 1 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE4 2.94e-13 75 26 9 375 3 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A2R6H1 2.95e-13 75 26 11 341 2 otaA Highly reducing polyketide synthase otaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
P9WEX0 3.13e-13 75 27 7 270 1 dpasA Non-reducing polyketide synthase dpasA Apiospora sacchari
A0A3G1DJF3 3.2e-13 75 27 7 288 2 pks2 Squalestatin hexaketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
Q5W262 3.27e-13 75 26 10 280 1 pigJ Beta-ketoacyl synthase PigJ Serratia sp. (strain ATCC 39006)
A0A443HK66 3.43e-13 75 28 9 280 3 VdtX Highly reducing polyketide synthase VdtX Byssochlamys spectabilis
B4XYB8 3.84e-13 75 27 11 341 1 aziB 5-methyl-1-naphthoate synthase Streptomyces sahachiroi
Q05357 4.45e-13 73 26 15 422 3 sch2 Putative polyketide beta-ketoacyl synthase 2 Streptomyces halstedii
A0A411L027 4.54e-13 75 26 11 307 3 buaA Hybrid PKS-NRPS synthetase buaA Petromyces alliaceus
A7UMW1 4.81e-13 74 24 10 354 2 PKS1 Non-reducing polyketide synthase 1 Elsinoe fawcettii
S0EET5 5.84e-13 74 26 17 415 2 PKS19 Polyketide synthase 19 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A142C799 6.17e-13 74 24 11 366 1 phnA Non-reducing polyketide synthase phnA Penicillium herquei
Q5BG07 6.79e-13 74 27 8 269 1 pkdA Non-reducing polyketide synthase pkdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B3FWS8 6.92e-13 74 25 9 291 1 hpm3 Non-reducing polyketide synthase hmp3 Hypomyces subiculosus
A0A098D6U0 7.11e-13 74 26 11 313 1 ZEA1 Non-reducing polyketide synthase ZEA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
B6HV32 7.97e-13 74 22 14 442 1 adrD Non-reducing polyketide synthase adrD Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
S0DZM7 8.26e-13 73 22 10 358 1 bik1 Bikaverin polyketide synthase bik1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A0A2KT65 8.39e-13 73 26 11 357 2 melA Conidial yellow pigment biosynthesis polyketide synthase melA Penicillium expansum
A5ABG0 9.06e-13 73 26 12 342 1 pynA Hybrid PKS-NRPS synthetase pynA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A0A0S2CHA9 9.18e-13 73 25 10 285 1 pigA Non-reducing polyketide synthase pigA Monascus ruber
A0A481WR96 9.97e-13 73 25 11 298 3 claI Highly reducing polyketide synthase claI Penicillium crustosum
Q4WAY3 1.16e-12 73 27 8 275 1 af370 Fumagillin dodecapentaenoate synthase af370 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
W3X7U2 1.3e-12 73 25 9 282 2 PfmaE Conidial pigment polyketide synthase PfmaE Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
A0A4P8DJU2 1.33e-12 73 27 12 284 3 dmx-nrPKS Atrochrysone carboxylic acid synthase Cryptosporiopsis sp. (strain 8999)
P9WET8 1.44e-12 73 27 8 272 2 Preu1 Highly reducing polyketide synthase Preu1 Preussia isomera
Q5B7U4 1.46e-12 73 23 7 280 1 pkiA Non-reducing polyketide synthase pkiA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
S0EMV0 1.6e-12 73 27 8 271 1 GPY1 Highly reducing polyketide synthase GPY1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A1V6PAF7 1.8e-12 73 25 10 290 1 calA Highly reducing polyketide synthase calA Penicillium decumbens
A0A0A2JW91 2.01e-12 72 25 14 380 1 cnsI Highly reducing polyketide synthase cnsI Penicillium expansum
B8M9J9 2.02e-12 72 25 7 270 1 tropA 3-methylorcinaldehyde synthase tropA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
A0A0D1DNX1 2.21e-12 72 31 12 260 2 fas2 Fatty acid synthase 2 Ustilago maydis (strain 521 / FGSC 9021)
Q6DQW3 2.3e-12 72 25 12 359 1 CTB1 Non-reducing polyketide synthase CTB1 Cercospora nicotianae
A0A345BJN0 2.4e-12 72 25 11 357 1 clz14 Squalestatin hexaketide synthase clz14 Cochliobolus lunatus
A0A179H2I8 3.76e-12 72 28 6 217 2 lcsB Highly reducing polyketide synthase lcsB Purpureocillium lilacinum
A0A8F4SKJ7 4.57e-12 72 24 8 287 1 atr1 Non-reducing polyketide synthase atr1 Stereocaulon alpinum
R4WH05 4.7e-12 71 24 13 379 3 ACRTS2 Highly reducing polyketide synthase ACRTS2 Alternaria alternata
A0A2G5IC96 4.75e-12 71 24 11 359 3 CTB1 Non-reducing polyketide synthase CTB1 Cercospora beticola
P41176 4.94e-12 70 30 7 202 3 None Putative polyketide beta-ketoacyl synthase 2 Streptomyces virginiae
P9WQE1 5.72e-12 71 24 7 273 1 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE0 5.72e-12 71 24 7 273 3 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q5AUX7 5.88e-12 71 28 10 273 1 dbaI Non-reducing polyketide synthase dbaI Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A125R003 5.98e-12 71 28 6 205 1 cla3 Non-reducing polyketide synthase cla3 Cladosporium cladosporioides
Q7TXL6 6.19e-12 71 24 7 273 1 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5ATJ7 6.8e-12 71 25 7 273 1 ausA Non-reducing polyketide synthase ausA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
E9EHG2 7.16e-12 71 26 13 353 2 Pks2 Polyketide synthase 2 Metarhizium acridum (strain CQMa 102)
A0A0U5GFS8 7.56e-12 71 26 9 275 1 ausA Non-reducing polyketide synthase ausA Aspergillus calidoustus
Q0C8A4 8.54e-12 70 25 8 275 1 trt4 Non-reducing polyketide synthase trt4 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q5B8A0 1.01e-11 70 28 11 271 1 pkfA Non-reducing polyketide synthase pkfA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
V5Y0F7 1.09e-11 70 25 10 310 3 AFT16-1 Reducing polyketide synthase AFT16-1 Alternaria alternata
Q0CS88 1.64e-11 70 29 10 302 2 tazB Highly reducing polyketide synthase tazB Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P9WET4 1.93e-11 69 25 13 347 1 Preu5 Highly reducing polyketide synthase Preu5 Preussia isomera
P9WEV0 2.17e-11 69 26 7 275 3 valA Highly reducing polyketide synthase valA Aspergillus terreus
P0DUT7 2.85e-11 69 24 7 272 1 Ba17a Highly reducing polyketide synthase 17 Metarhizium anisopliae
A0A2U8NET4 3.43e-11 68 25 10 347 1 Pks1 Polyketide synthase 1 Metarhizium album (strain ARSEF 1941)
Q5AUX1 4.15e-11 68 28 8 253 1 orsA Orsellinic acid synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q0C8L6 4.15e-11 68 26 12 318 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus (strain NIH 2624 / FGSC A1156)
G3XNF4 4.23e-11 68 24 10 371 1 ATPKS PKS-NRPS hybrid synthetase ATPKS Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
A0A0K0MCJ4 4.55e-11 68 23 8 285 1 cazM Iterative polyketide synthase CazM Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A0A067MTM1 5.39e-11 68 24 10 347 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Botryobasidium botryosum (strain FD-172 SS1)
G0LET7 5.82e-11 68 27 12 281 2 BOA9 Reducing polyketide synthase BOA9 Botryotinia fuckeliana (strain B05.10)
Q00681 6.39e-11 68 29 9 270 2 stcJ Fatty acid synthase alpha subunit stcJ Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
G3XLL5 7.12e-11 68 24 10 359 3 albA Non-reducing polyketide synthase albA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
I1RF58 7.42e-11 68 25 9 315 1 PKS12 Non-reducing polyketide synthase PKS12 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A5PHD6 7.52e-11 68 25 5 282 1 aspks1 3-methylorcinaldehyde synthase Sarocladium schorii
A2QUI2 8.43e-11 67 24 10 359 3 albA Non-reducing polyketide synthase albA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q9ZGI2 8.99e-11 67 24 11 338 1 pikAIV Narbonolide/10-deoxymethynolide synthase PikA4, module 6 Streptomyces venezuelae
Q0UI00 9.98e-11 67 24 14 364 1 elcA Non-reducing polyketide synthase elcA (Fragment) Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
G3XMC4 1.35e-10 67 23 8 286 1 azaA Non-reducing polyketide synthase azaA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
E5AE40 1.75e-10 67 25 12 341 2 PKS2 Highly reducing polyketide synthase PKS2 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
I1RLA7 1.85e-10 66 22 10 317 2 FGR1 Highly reducing polyketide synthase 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A1L9UCG2 1.95e-10 66 24 10 359 3 albA Non-reducing polyketide synthase albA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A3G9K3K9 2.28e-10 66 25 9 285 1 hisps Hispidin synthase Neonothopanus nambi
A2QTE9 3.43e-10 65 23 8 286 3 epaA Non-reducing polyketide synthase epaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
P9WET7 6.72e-10 65 24 9 262 2 Preu2 Reducing polyketide synthase Preu2 Preussia isomera
P9WET0 8.67e-10 64 27 7 219 1 Preu9 Polyketide synthase-like protein Preu9 Preussia isomera
A0A2H3CTK0 1.31e-09 63 25 8 290 1 armB Orsellinic acid synthase armB Armillaria gallica
A0A4P8GHJ1 1.38e-09 63 24 7 267 1 eupA 3-methylorcinaldehyde synthase Phoma sp.
A0A284RE13 1.46e-09 63 25 8 290 1 armB Orsellinic acid synthase ArmB Armillaria ostoyae
G1XU04 2.57e-09 63 22 10 367 1 AOL_s00215g283 6-methylsalicylic acid synthase AOL_s00215g283 Arthrobotrys oligospora (strain ATCC 24927 / CBS 115.81 / DSM 1491)
B6H999 4.38e-09 62 25 14 353 1 xilA Highly reducing polyketide synthase xilA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A0A9P5GG56 8.66e-09 61 24 14 354 1 xilA Highly reducing polyketide synthase xilA Penicillium crustosum
Q10289 8.83e-09 61 35 2 108 1 fas2 Fatty acid synthase subunit alpha Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0A0F7GFS4 1.63e-08 60 23 11 338 1 tasS Hybrid PKS-NRPS synthetase tasS Hapsidospora irregularis
A0A345BJP0 3.67e-08 59 23 13 346 3 clz2 Squalestatin tetraketide synthase clz2 Cochliobolus lunatus
Q5BBP8 3.99e-08 59 20 7 282 1 pkhA Non-reducing polyketide synthase pkhA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AZ32 4.04e-08 59 28 8 214 1 pkbA Non-reducing polyketide synthase pkbA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
I3ZNU9 9.29e-08 58 25 9 290 1 armB Orsellinic acid synthase armB Armillaria mellea
S5NIA2 6.09e-07 55 34 3 123 3 TOXH Fatty acid synthase subunit alpha Cochliobolus carbonum
A0A068ABB7 1.02e-06 55 26 11 289 1 Bref-PKS Highly reducing polyketide synthase Eupenicillium brefeldianum
A0A1D5AG16 1.09e-06 54 34 4 113 1 pigJ Fatty acid synthase alpha subunit pigJ Monascus ruber
Q0CSA2 1.27e-06 54 25 9 202 1 tazA Non-reducing polyketide synthase tazA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
G4N137 1.35e-06 54 24 5 197 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q2TXF0 1.52e-06 54 37 2 108 3 oryfasA Fatty acid synthase subunit alpha Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P19097 2.04e-06 53 35 2 108 1 FAS2 Fatty acid synthase subunit alpha Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A084R1H6 2.67e-06 53 23 10 275 3 ATR6 Highly reducing polyketide synthase ATR6 Stachybotrys chlorohalonata (strain IBT 40285)
S0DL59 3.37e-06 53 32 1 117 1 apf5 Fatty acid synthase apf5 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q765N2 6.52e-06 52 35 1 99 3 FAS2 Fatty acid synthase subunit alpha Lachancea kluyveri
G8BAW7 7.69e-06 52 34 2 108 2 FAS2 Fatty acid synthase subunit alpha Candida parapsilosis (strain CDC 317 / ATCC MYA-4646)
P43098 1.44e-05 51 32 2 118 1 FAS2 Fatty acid synthase subunit alpha Candida albicans
I1R9A6 1.7e-05 50 28 4 170 3 FG00036 Fatty acid synthase subunit alpha Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P9WES2 2.16e-05 50 22 6 246 1 None Atrochrysone carboxylic acid synthase PKS4 Calonarius odorifer

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS02605
Feature type CDS
Gene fabB
Product beta-ketoacyl-ACP synthase I
Location 549349 - 550563 (strand: 1)
Length 1215 (nucleotides) / 404 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1922
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00109 Beta-ketoacyl synthase, N-terminal domain
PF02801 Beta-ketoacyl synthase, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0304 Lipid transport and metabolism (I)
Secondary metabolites biosynthesis, transport and catabolism (Q)		 IQ 3-oxoacyl-(acyl-carrier-protein) synthase

Kegg Ortholog Annotation(s)

Protein Sequence

MKRAVITGLGIISSIGNNQEEVLASLREGRSGITFSEEFKEMGMRSHVWGNVKLDTAGLIDRKPARFMSDASVYAYLSMEQAIADAGLTPEQVGSIRTGVVAGSGGGSPRNQVAGSDGMRAKGLRGVGPYMVPRAMASGVSANLATPFKVKGVNYSISSACSTSAHCIGHAVELIQLGKQDVVFAGGGEELCWEMSCEFDAMGALSTKYNETPEKASRTYDQDRDGFVIAGGGGMVVVEELEHALARGAHIYGEVVGYGATSDGADMVAPSGEGAARCMQMAMQGLDAPIDYINTHGTSTPVGDTKELEAIHEVFGDHTPALSATKAMTGHSLGAAGVHEAIYSLLMLEHGFIAPSINVENLDEKAVGMDIITKPTERKLTTVMSNSFGFGGTNATLVMRKYQG

Flanking regions ( +/- flanking 50bp)

AGCTAAAGTATCGCTAAAATCCCGTAATACATAAATGACAGAGGTAATGAATGAAGCGTGCAGTAATCACTGGTCTGGGGATTATTTCAAGTATTGGTAATAACCAGGAAGAAGTACTGGCTTCTTTGAGAGAAGGTCGTTCCGGGATCACGTTCTCAGAAGAGTTTAAAGAAATGGGAATGCGCAGCCATGTCTGGGGTAACGTCAAACTGGATACTGCCGGTCTCATTGATCGTAAACCTGCCCGTTTCATGAGTGATGCGTCTGTTTACGCCTATCTTTCCATGGAGCAGGCTATTGCGGACGCCGGTCTGACCCCTGAGCAGGTAGGCAGTATCCGTACCGGGGTTGTTGCCGGTTCCGGCGGCGGTTCTCCGCGCAATCAGGTTGCCGGTTCTGACGGTATGCGCGCCAAAGGGCTGCGTGGTGTCGGACCTTATATGGTGCCGCGCGCCATGGCATCCGGTGTGTCTGCAAACCTTGCAACACCGTTTAAAGTTAAAGGTGTTAACTACTCTATCAGCTCCGCCTGTTCAACCTCCGCGCACTGTATTGGTCACGCGGTAGAGCTTATCCAGCTGGGTAAACAGGATGTGGTGTTTGCCGGCGGCGGTGAAGAACTGTGCTGGGAAATGAGCTGCGAATTTGACGCAATGGGCGCACTGTCAACCAAATACAACGAGACGCCGGAAAAAGCGTCCCGTACTTACGACCAGGATCGCGATGGTTTCGTTATCGCCGGTGGCGGTGGTATGGTCGTGGTGGAAGAGCTGGAACATGCTCTGGCACGCGGCGCACACATTTATGGTGAGGTTGTCGGTTACGGCGCAACATCGGATGGCGCGGACATGGTTGCACCATCAGGTGAAGGCGCTGCCCGTTGTATGCAGATGGCGATGCAGGGCTTGGATGCACCGATTGACTACATCAATACACACGGCACATCAACGCCGGTAGGTGATACCAAAGAGCTGGAAGCGATTCATGAAGTGTTCGGTGATCATACCCCGGCACTGTCAGCGACCAAAGCGATGACCGGTCACTCTCTGGGTGCCGCGGGTGTTCATGAAGCGATTTACAGCCTGCTGATGCTGGAGCATGGTTTTATCGCGCCGAGCATTAACGTGGAAAATCTTGATGAGAAAGCGGTGGGGATGGATATCATCACCAAACCGACTGAGCGCAAGCTGACTACCGTTATGTCGAACAGTTTTGGTTTCGGCGGAACGAACGCAACCTTAGTCATGCGTAAATATCAGGGCTAATCTATACCCTTATTTATTCAAACCGCAGGTTCGTTGGCTGCAACCTGAAT