Homologs in group_1238

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07205 FBDBKF_07205 92.3 Morganella morganii S1 cmoM tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM
EHELCC_03765 EHELCC_03765 92.3 Morganella morganii S2 cmoM tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM
NLDBIP_03765 NLDBIP_03765 92.3 Morganella morganii S4 cmoM tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM
LHKJJB_09595 LHKJJB_09595 92.3 Morganella morganii S3 cmoM tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM
HKOGLL_09380 HKOGLL_09380 92.3 Morganella morganii S5 cmoM tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM
PMI_RS03560 PMI_RS03560 73.5 Proteus mirabilis HI4320 cmoM tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM

Distribution of the homologs in the orthogroup group_1238

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1238

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8XDG3 9.53e-113 327 59 0 259 1 cmoM tRNA 5-carboxymethoxyuridine methyltransferase Escherichia coli O157:H7
P36566 1.02e-112 327 59 0 259 1 cmoM tRNA 5-carboxymethoxyuridine methyltransferase Escherichia coli (strain K12)
Q8PK00 7.7e-10 60 24 3 185 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas axonopodis pv. citri (strain 306)
Q3BSF8 4.55e-09 58 24 3 185 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
D8MPW4 7.46e-09 58 28 4 174 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Erwinia billingiae (strain Eb661)
A4XPM7 1.49e-08 57 27 3 128 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas mendocina (strain ymp)
Q5P7U3 2.08e-08 57 30 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q87TH4 2.77e-08 56 29 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
C3LPS5 3.22e-08 56 29 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio cholerae serotype O1 (strain M66-2)
Q9KVQ6 3.22e-08 56 29 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4E5 3.22e-08 56 29 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A7MTX1 7.42e-08 55 27 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio campbellii (strain ATCC BAA-1116)
Q7MQ33 8.29e-08 55 27 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio vulnificus (strain YJ016)
Q8DDP9 8.29e-08 55 27 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio vulnificus (strain CMCP6)
B6J676 1.6e-07 54 26 3 134 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain CbuK_Q154)
A9N9F4 1.66e-07 54 26 3 134 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain RSA 331 / Henzerling II)
Q8E9R7 1.96e-07 54 26 4 133 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q83A90 1.97e-07 54 26 3 134 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KD75 1.97e-07 54 26 3 134 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain Dugway 5J108-111)
B6J3P6 1.97e-07 54 26 3 134 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain CbuG_Q212)
B8E6B6 2.04e-07 54 25 4 132 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS223)
A9KYL8 2.08e-07 54 25 4 132 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS195)
A6WIE9 2.08e-07 54 25 4 132 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS185)
A3D9F2 2.08e-07 54 25 4 132 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q12S23 3.33e-07 53 28 5 135 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q606J9 3.42e-07 53 29 6 165 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
D2T333 3.48e-07 53 33 3 112 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Erwinia pyrifoliae (strain DSM 12163 / CIP 106111 / Ep16/96)
Q8P8H2 3.5e-07 53 23 3 177 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RS27 3.5e-07 53 23 3 177 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas campestris pv. campestris (strain B100)
Q4UVL4 3.5e-07 53 23 3 177 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas campestris pv. campestris (strain 8004)
A1RP78 3.84e-07 53 25 4 132 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sp. (strain W3-18-1)
A4Y2Q5 3.84e-07 53 25 4 132 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q482G8 5.87e-07 52 28 2 118 3 ubiG Ubiquinone biosynthesis O-methyltransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A1SAJ8 7.55e-07 52 29 5 135 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q5GZB5 7.9e-07 52 24 4 179 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SHS9 7.9e-07 52 24 4 179 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P2C4 7.9e-07 52 24 4 179 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A8LQ43 1.06e-06 52 28 6 187 3 ubiG Ubiquinone biosynthesis O-methyltransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q1QEI9 1.1e-06 52 28 0 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1I3T0 1.16e-06 52 30 5 136 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas entomophila (strain L48)
Q0HZP7 1.22e-06 52 25 4 132 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sp. (strain MR-7)
Q0HEA1 1.22e-06 52 25 4 132 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sp. (strain MR-4)
A0L1M4 1.22e-06 52 25 4 132 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sp. (strain ANA-3)
Q4FVG3 1.27e-06 52 28 0 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B0TJ16 1.33e-06 51 27 5 134 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella halifaxensis (strain HAW-EB4)
Q9Z439 1.34e-06 51 30 5 136 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida
Q088H8 1.39e-06 51 25 4 132 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella frigidimarina (strain NCIMB 400)
Q9HUC0 1.85e-06 51 28 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02EV4 1.85e-06 51 28 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V3F6 1.85e-06 51 28 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas aeruginosa (strain LESB58)
A6VDI6 2.01e-06 51 28 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas aeruginosa (strain PA7)
Q88D17 2.42e-06 50 29 5 136 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5WA45 2.42e-06 50 29 5 136 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q16D32 2.51e-06 50 29 7 183 3 ubiG Ubiquinone biosynthesis O-methyltransferase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B0U3W1 2.59e-06 50 25 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xylella fastidiosa (strain M12)
Q9PAM5 2.93e-06 50 25 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xylella fastidiosa (strain 9a5c)
Q31IM5 3.45e-06 50 26 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q21H69 3.64e-06 50 30 5 135 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A0L3L9 3.69e-06 50 28 6 142 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B1KR07 3.97e-06 50 25 4 133 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella woodyi (strain ATCC 51908 / MS32)
Q9Z5E9 4.07e-06 49 30 4 118 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE (Fragment) Pseudomonas oleovorans
A1JIF2 4.48e-06 50 26 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1J2S8 4.75e-06 50 29 5 136 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain W619)
A4WW91 5.42e-06 50 26 4 180 3 ubiG Ubiquinone biosynthesis O-methyltransferase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
B0KM36 5.46e-06 50 28 5 135 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain GB-1)
B1JP75 5.61e-06 50 26 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66FT0 5.61e-06 50 26 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TR39 5.61e-06 50 26 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis (strain Pestoides F)
Q1CNB4 5.61e-06 50 26 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis bv. Antiqua (strain Nepal516)
A9R431 5.61e-06 50 26 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis bv. Antiqua (strain Angola)
Q8D1I3 5.61e-06 50 26 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis
B2K0Y4 5.61e-06 50 26 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FDE0 5.61e-06 50 26 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8G0S7 5.66e-06 50 25 4 133 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sediminis (strain HAW-EB3)
A1SRS4 6.51e-06 49 26 4 123 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q28VP7 6.56e-06 49 26 4 180 3 ubiG Ubiquinone biosynthesis O-methyltransferase Jannaschia sp. (strain CCS1)
Q3ILA5 6.92e-06 49 24 3 162 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudoalteromonas translucida (strain TAC 125)
Q89AK7 7.04e-06 49 29 2 100 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q87BG5 7.06e-06 49 25 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I705 7.06e-06 49 25 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xylella fastidiosa (strain M23)
A4SM99 8.15e-06 49 26 2 138 3 ubiG Ubiquinone biosynthesis O-methyltransferase Aeromonas salmonicida (strain A449)
Q1CBG0 8.37e-06 49 26 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis bv. Antiqua (strain Antiqua)
B8CI06 8.69e-06 49 24 4 133 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella piezotolerans (strain WP3 / JCM 13877)
B3PH48 9.25e-06 49 28 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Cellvibrio japonicus (strain Ueda107)
A4VGE5 9.46e-06 49 28 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Stutzerimonas stutzeri (strain A1501)
B2JEZ6 1.01e-05 48 29 1 122 3 ubiG Ubiquinone biosynthesis O-methyltransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A7MPA9 1.02e-05 48 20 4 209 3 ubiG Ubiquinone biosynthesis O-methyltransferase Cronobacter sakazakii (strain ATCC BAA-894)
P08442 1.1e-05 49 31 2 113 4 syc1184_c Uncharacterized protein syc1184_c Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q2L2T5 1.27e-05 48 26 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bordetella avium (strain 197N)
Q3KJC5 1.59e-05 48 25 4 135 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas fluorescens (strain Pf0-1)
B4EWC9 1.61e-05 48 26 2 108 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Proteus mirabilis (strain HI4320)
Q1GCH8 1.66e-05 48 26 4 180 3 ubiG Ubiquinone biosynthesis O-methyltransferase Ruegeria sp. (strain TM1040)
C3K8U4 2.04e-05 48 27 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas fluorescens (strain SBW25)
P59911 2.36e-05 48 24 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7NZ91 2.54e-05 47 25 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7WGT9 2.55e-05 47 26 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9CKD6 2.73e-05 48 24 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pasteurella multocida (strain Pm70)
B9KPP7 3.01e-05 47 27 5 181 3 ubiG Ubiquinone biosynthesis O-methyltransferase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
A8G8B8 3.17e-05 47 26 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Serratia proteamaculans (strain 568)
Q3SK91 3.21e-05 47 26 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Thiobacillus denitrificans (strain ATCC 25259)
B2VIL6 3.64e-05 47 22 2 154 3 ubiG Ubiquinone biosynthesis O-methyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A8A296 3.96e-05 47 21 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O9:H4 (strain HS)
E3HCT1 4.08e-05 47 28 4 103 3 bioC2 Malonyl-[acyl-carrier protein] O-methyltransferase 2 Ilyobacter polytropus (strain ATCC 51220 / DSM 2926 / LMG 16218 / CuHBu1)
E3G327 4.14e-05 47 30 2 110 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Enterobacter lignolyticus (strain SCF1)
Q7VZG7 4.22e-05 47 26 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A3QIE1 4.42e-05 47 25 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q47GP8 4.54e-05 47 27 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Dechloromonas aromatica (strain RCB)
A3PNM3 4.66e-05 47 27 5 181 3 ubiG Ubiquinone biosynthesis O-methyltransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q6FFY1 6.35e-05 46 25 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q7MZ81 6.77e-05 46 26 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q5LWM6 6.92e-05 46 30 2 118 3 ubiG Ubiquinone biosynthesis O-methyltransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q0CCX8 7.1e-05 47 26 1 99 3 gedG Methyltransferase gedG Aspergillus terreus (strain NIH 2624 / FGSC A1156)
B7LM95 7.32e-05 46 21 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q5ZT34 8.1e-05 46 30 3 110 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
C6DI77 9.02e-05 46 25 2 108 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q8UA66 0.0001 46 30 6 175 3 ubiG Ubiquinone biosynthesis O-methyltransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9NZJ6 0.000107 46 23 4 167 1 COQ3 Ubiquinone biosynthesis O-methyltransferase, mitochondrial Homo sapiens
Q02PX7 0.000109 45 27 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B8EI29 0.000109 46 28 4 152 3 ubiG Ubiquinone biosynthesis O-methyltransferase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
P65347 0.000118 45 29 5 135 3 BQ2027_MB0092 Uncharacterized methyltransferase Mb0092 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WK03 0.000118 45 29 5 135 3 Rv0089 Uncharacterized methyltransferase Rv0089 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WK02 0.000118 45 29 5 135 3 MT0098 Uncharacterized methyltransferase MT0098 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q5X0X6 0.000128 45 25 3 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Legionella pneumophila (strain Paris)
Q3IYM5 0.000133 45 27 5 181 3 ubiG Ubiquinone biosynthesis O-methyltransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A1RJD1 0.000133 45 26 1 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella sp. (strain W3-18-1)
B7UFP4 0.000134 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B0SW81 0.000136 45 27 1 106 3 ubiG Ubiquinone biosynthesis O-methyltransferase Caulobacter sp. (strain K31)
Q609G2 0.00014 45 23 3 162 3 ubiG Ubiquinone biosynthesis O-methyltransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A4Y759 0.000142 45 26 1 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A5II90 0.000144 45 24 3 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Legionella pneumophila (strain Corby)
B6J5Y2 0.000149 45 30 2 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Coxiella burnetii (strain CbuK_Q154)
A9KGL7 0.000159 45 27 3 165 3 ubiG Ubiquinone biosynthesis O-methyltransferase Coxiella burnetii (strain Dugway 5J108-111)
B7MXR3 0.00016 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O81 (strain ED1a)
Q0TFL0 0.000164 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B5XNZ3 0.000164 45 20 2 154 3 ubiG Ubiquinone biosynthesis O-methyltransferase Klebsiella pneumoniae (strain 342)
Q1R9I4 0.000166 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain UTI89 / UPEC)
B7MFZ8 0.000166 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7NN47 0.000177 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q820B5 0.000179 45 31 2 119 3 ubiG Ubiquinone biosynthesis O-methyltransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NBI0 0.000179 45 31 2 119 3 ubiG Ubiquinone biosynthesis O-methyltransferase Coxiella burnetii (strain RSA 331 / Henzerling II)
B6J1W2 0.000179 45 31 2 119 3 ubiG Ubiquinone biosynthesis O-methyltransferase Coxiella burnetii (strain CbuG_Q212)
B7V9J5 0.000182 45 27 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas aeruginosa (strain LESB58)
Q5WSQ8 0.000185 45 24 3 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Legionella pneumophila (strain Lens)
Q9HZ63 0.000189 45 27 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6G5K3 0.000196 45 29 4 141 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q0AME1 0.000197 45 26 1 118 3 ubiG Ubiquinone biosynthesis O-methyltransferase Maricaulis maris (strain MCS10)
P64842 0.000201 45 26 3 116 3 BQ2027_MB1440C Uncharacterized protein Mb1440c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WLY7 0.000201 45 26 3 116 1 Rv1405c Uncharacterized protein Rv1405c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WLY6 0.000201 45 26 3 116 3 MT1449 Uncharacterized protein MT1449 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B5YX17 0.000201 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XE29 0.000201 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O157:H7
Q31Z65 0.000203 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shigella boydii serotype 4 (strain Sb227)
B2TW20 0.000203 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I7I7 0.000203 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain SE11)
B7M5R7 0.000203 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O8 (strain IAI1)
B7LAP9 0.000203 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain 55989 / EAEC)
B1LLI3 0.000205 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
Q3YZX6 0.000207 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shigella sonnei (strain Ss046)
Q820C5 0.000207 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shigella flexneri
Q0T2P9 0.000207 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shigella flexneri serotype 5b (strain 8401)
C6DBN5 0.000208 45 21 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A6V2Q4 0.000209 45 23 2 161 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas aeruginosa (strain PA7)
Q32DV8 0.000211 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
B7N5J4 0.000211 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P17993 0.000211 45 20 2 163 1 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain K12)
B1X8C6 0.000211 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain K12 / DH10B)
C4ZU73 0.000211 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
A7ZP50 0.000211 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
B1IXV6 0.000215 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q98G87 0.000227 45 28 6 182 3 ubiG Ubiquinone biosynthesis O-methyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q6DAQ7 0.000238 45 24 2 108 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q4UME7 0.00025 45 23 6 203 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q5QZ53 0.000288 44 26 2 139 3 ubiG Ubiquinone biosynthesis O-methyltransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q4K8M4 0.000292 44 23 2 162 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q2K3S8 0.000327 44 30 2 106 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q11E01 0.000332 44 29 5 182 3 ubiG Ubiquinone biosynthesis O-methyltransferase Chelativorans sp. (strain BNC1)
Q7W5Z6 0.000349 44 25 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P37431 0.000364 44 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TPG0 0.000364 44 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella schwarzengrund (strain CVM19633)
B4SYU8 0.000364 44 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella newport (strain SL254)
B4TBE3 0.000364 44 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella heidelberg (strain SL476)
B5FNR7 0.000364 44 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella dublin (strain CT_02021853)
B5EYW1 0.000364 44 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella agona (strain SL483)
A4YKT6 0.000367 44 25 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bradyrhizobium sp. (strain ORS 278)
Q5ZRH9 0.000372 44 24 3 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A6TBT7 0.000378 44 20 2 154 3 ubiG Ubiquinone biosynthesis O-methyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q885T9 0.000378 44 26 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8Z560 0.000382 44 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella typhi
Q92MK1 0.000401 44 33 2 107 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhizobium meliloti (strain 1021)
B8H209 0.00042 44 26 1 106 3 ubiG Ubiquinone biosynthesis O-methyltransferase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A9X1 0.00042 44 26 1 106 3 ubiG Ubiquinone biosynthesis O-methyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q87ND5 0.000463 43 23 3 165 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6D7X5 0.000465 44 20 2 162 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A9MJY3 0.000518 43 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q92H07 0.000543 44 24 4 169 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q3K8T6 0.000548 43 27 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas fluorescens (strain Pf0-1)
Q0AA73 0.00055 43 24 2 162 3 ubiG Ubiquinone biosynthesis O-methyltransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q1MBA9 0.000558 43 32 2 107 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q31GD8 0.000565 43 30 1 106 3 ubiG Ubiquinone biosynthesis O-methyltransferase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A7MQL7 0.000571 43 24 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Cronobacter sakazakii (strain ATCC BAA-894)
A0A067XMV2 0.000599 43 24 1 102 2 ptaH Methyltransferase ptaH Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
C0Q093 0.000683 43 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella paratyphi C (strain RKS4594)
B5RCA1 0.000683 43 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R249 0.000683 43 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella enteritidis PT4 (strain P125109)
Q57M77 0.000683 43 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella choleraesuis (strain SC-B67)
E3H9W1 0.000684 43 28 4 103 3 bioC1 Malonyl-[acyl-carrier protein] O-methyltransferase 1 Ilyobacter polytropus (strain ATCC 51220 / DSM 2926 / LMG 16218 / CuHBu1)
B9JB78 0.000729 43 28 6 181 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
B0V5X4 0.000736 43 22 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain AYE)
B0VMN8 0.000736 43 22 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain SDF)
B7IBN2 0.000736 43 22 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain AB0057)
B7H2Y9 0.000736 43 22 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain AB307-0294)
C3MHQ9 0.000743 43 32 3 107 3 ubiG Ubiquinone biosynthesis O-methyltransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A9L2Y4 0.000767 43 24 2 139 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella baltica (strain OS195)
A6WNN7 0.000767 43 24 2 139 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella baltica (strain OS185)
A3D499 0.000767 43 24 2 139 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EA88 0.000767 43 24 2 139 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella baltica (strain OS223)
Q66L51 0.000821 43 25 8 195 2 coq5 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial Danio rerio
Q21UL3 0.000837 43 23 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B2I023 0.000862 43 22 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain ACICU)
B0TZP1 0.000893 43 23 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A4WCN5 0.001 43 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Enterobacter sp. (strain 638)
Q4ZQ90 0.001 43 25 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas syringae pv. syringae (strain B728a)
Q48FM4 0.001 43 25 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01390
Feature type CDS
Gene cmoM
Product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM
Location 302661 - 303446 (strand: 1)
Length 786 (nucleotides) / 261 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1238
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF08241 Methyltransferase domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2227 Coenzyme transport and metabolism (H) H 2-polyprenyl-3-methyl-5-hydroxy-6-metoxy-1,4-benzoquinol methylase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06219 tRNA 5-carboxymethoxyuridine methyltransferase [EC:2.1.1.-] - -

Protein Sequence

MVDRNFDDIAEKFTRNIYGTTKGQIREAVVWQDLVALLTRLRPGPLRILDAGGGDGFFSRRLAAMGHHVVLCDLSEEMILRAQKAAEDDGVAENMSFIHCAAQDIALHTDGEFDLILFHAVLEWITDQKGAIEALTAIITGGGVLSLMFYNANGLVMRNAILGNFHLATPDMQRRRKRSLSPQNPLMPEQVYQWLDDCRLTIEAKTGVRVFHDYLQSRQLQNRDFPALLALEQRYCRQEPYISLGRYIHVMARKPEQKDGQ

Flanking regions ( +/- flanking 50bp)

ACCGGCGGAAACTTACCGATAAAATACTCCCGGACTGAATACAGGTTTTCATGGTTGATCGTAATTTTGACGATATCGCGGAAAAATTCACCCGCAATATATATGGCACAACAAAAGGGCAAATCCGTGAAGCGGTTGTCTGGCAGGATCTTGTTGCCTTACTGACACGTCTGCGGCCGGGTCCGCTGCGCATTCTTGATGCCGGTGGCGGTGACGGGTTCTTTTCCCGCCGCCTTGCGGCAATGGGCCATCATGTTGTTTTATGTGATCTGTCCGAAGAGATGATTTTGCGCGCACAGAAGGCCGCAGAGGACGATGGCGTGGCAGAAAATATGTCCTTTATTCATTGCGCAGCCCAGGATATCGCACTTCATACTGACGGTGAGTTTGATTTGATCTTGTTTCATGCCGTTCTGGAGTGGATAACTGATCAAAAAGGTGCAATTGAAGCGCTGACCGCTATAATAACGGGCGGTGGAGTATTGTCGTTAATGTTTTACAATGCGAACGGACTTGTCATGCGAAATGCGATATTAGGCAATTTTCATCTGGCAACGCCGGACATGCAGCGCCGCCGCAAGCGTTCATTATCGCCGCAGAATCCCCTTATGCCTGAACAGGTTTATCAGTGGCTGGATGACTGCCGCCTTACCATTGAGGCGAAAACCGGGGTGCGGGTTTTTCATGATTATCTGCAAAGCCGTCAGTTACAAAACCGCGATTTTCCGGCGCTGCTGGCACTGGAGCAACGTTATTGCCGTCAGGAGCCTTACATCAGTTTAGGCCGCTATATTCATGTTATGGCACGGAAACCCGAACAGAAGGATGGACAATGAGTGAGTTTACCCAAACAGTCCCCGAGCTTGTGGCATGGGCGCGAAAAAAT