Homologs in group_1238

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07205 FBDBKF_07205 100.0 Morganella morganii S1 cmoM tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM
EHELCC_03765 EHELCC_03765 100.0 Morganella morganii S2 cmoM tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM
NLDBIP_03765 NLDBIP_03765 100.0 Morganella morganii S4 cmoM tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM
HKOGLL_09380 HKOGLL_09380 100.0 Morganella morganii S5 cmoM tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM
F4V73_RS01390 F4V73_RS01390 92.3 Morganella psychrotolerans cmoM tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM
PMI_RS03560 PMI_RS03560 73.9 Proteus mirabilis HI4320 cmoM tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM

Distribution of the homologs in the orthogroup group_1238

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1238

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8XDG3 1.66e-111 324 59 0 255 1 cmoM tRNA 5-carboxymethoxyuridine methyltransferase Escherichia coli O157:H7
P36566 2.12e-111 324 59 0 255 1 cmoM tRNA 5-carboxymethoxyuridine methyltransferase Escherichia coli (strain K12)
Q8PK00 1.18e-12 68 28 2 175 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas axonopodis pv. citri (strain 306)
Q3BSF8 5.84e-12 67 28 2 175 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q5GZB5 4.71e-10 61 27 3 177 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SHS9 4.71e-10 61 27 3 177 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P2C4 4.71e-10 61 27 3 177 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8P8H2 1.88e-09 60 26 2 175 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RS27 1.88e-09 60 26 2 175 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas campestris pv. campestris (strain B100)
Q4UVL4 1.88e-09 60 26 2 175 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas campestris pv. campestris (strain 8004)
A4XPM7 5.37e-09 58 27 3 128 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas mendocina (strain ymp)
A7MPA9 7.51e-09 58 21 4 210 3 ubiG Ubiquinone biosynthesis O-methyltransferase Cronobacter sakazakii (strain ATCC BAA-894)
Q482G8 8.75e-09 58 31 2 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B2JEZ6 5.21e-08 55 31 2 138 3 ubiG Ubiquinone biosynthesis O-methyltransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q5P7U3 6.68e-08 55 29 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q7NZ91 7.01e-08 55 29 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B6J676 8.48e-08 55 26 3 134 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain CbuK_Q154)
Q3ILA5 9.05e-08 55 25 5 196 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudoalteromonas translucida (strain TAC 125)
A9N9F4 1.11e-07 55 26 3 134 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain RSA 331 / Henzerling II)
Q83A90 1.14e-07 55 26 3 134 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KD75 1.14e-07 55 26 3 134 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain Dugway 5J108-111)
B6J3P6 1.14e-07 55 26 3 134 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain CbuG_Q212)
Q1I3T0 4.84e-07 53 30 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas entomophila (strain L48)
Q9Z439 6.12e-07 52 30 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida
Q88D17 6.59e-07 52 29 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5WA45 6.59e-07 52 29 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0U3W1 6.64e-07 52 24 2 176 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xylella fastidiosa (strain M12)
Q87TH4 6.98e-07 52 26 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
C3LPS5 7.16e-07 52 26 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio cholerae serotype O1 (strain M66-2)
Q9KVQ6 7.16e-07 52 26 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4E5 7.16e-07 52 26 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9HUC0 8.42e-07 52 28 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02EV4 8.42e-07 52 28 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V3F6 8.42e-07 52 28 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas aeruginosa (strain LESB58)
Q9PAM5 9.32e-07 52 24 2 176 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xylella fastidiosa (strain 9a5c)
A6VDI6 9.33e-07 52 29 3 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas aeruginosa (strain PA7)
A1RJD1 1.03e-06 52 28 1 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella sp. (strain W3-18-1)
A4Y759 1.03e-06 52 28 1 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q7WGT9 1.07e-06 52 29 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B0KM36 1.08e-06 52 29 5 135 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain GB-1)
Q9Z5E9 1.19e-06 50 31 4 118 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE (Fragment) Pseudomonas oleovorans
B1J2S8 1.28e-06 52 29 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain W619)
Q2L2T5 1.41e-06 51 28 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bordetella avium (strain 197N)
Q5QZ53 1.5e-06 51 28 2 139 3 ubiG Ubiquinone biosynthesis O-methyltransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A0L3L9 1.54e-06 51 31 6 133 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q5ZT34 1.59e-06 51 35 3 110 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q87ND5 1.68e-06 51 24 3 165 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7VZG7 1.74e-06 51 29 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q21H69 1.78e-06 51 28 5 135 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A8A296 1.89e-06 51 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O9:H4 (strain HS)
Q7MQ33 1.96e-06 51 25 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio vulnificus (strain YJ016)
Q8DDP9 1.96e-06 51 25 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio vulnificus (strain CMCP6)
A7MTX1 2.03e-06 51 25 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio campbellii (strain ATCC BAA-1116)
Q87BG5 2.11e-06 51 24 2 176 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I705 2.11e-06 51 24 2 176 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xylella fastidiosa (strain M23)
B3PH48 2.34e-06 50 28 2 108 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Cellvibrio japonicus (strain Ueda107)
A4SM99 2.41e-06 50 26 2 138 3 ubiG Ubiquinone biosynthesis O-methyltransferase Aeromonas salmonicida (strain A449)
Q606J9 2.6e-06 50 27 6 165 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B2VIL6 2.64e-06 50 23 2 154 3 ubiG Ubiquinone biosynthesis O-methyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
D8MPW4 2.7e-06 50 25 3 174 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Erwinia billingiae (strain Eb661)
A4VGE5 2.98e-06 50 28 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Stutzerimonas stutzeri (strain A1501)
D2T333 3.32e-06 50 32 3 112 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Erwinia pyrifoliae (strain DSM 12163 / CIP 106111 / Ep16/96)
Q3KJC5 3.72e-06 50 26 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas fluorescens (strain Pf0-1)
Q9HZ63 3.79e-06 50 29 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9NZJ6 3.8e-06 50 24 2 142 1 COQ3 Ubiquinone biosynthesis O-methyltransferase, mitochondrial Homo sapiens
Q02PX7 3.86e-06 50 29 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V9J5 3.97e-06 50 29 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas aeruginosa (strain LESB58)
C6DBN5 4.1e-06 50 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B7LM95 4.17e-06 50 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
C3K8U4 4.2e-06 50 28 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas fluorescens (strain SBW25)
Q12S23 4.52e-06 50 26 5 134 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B8E6B6 4.52e-06 50 22 3 124 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS223)
A9KYL8 4.61e-06 50 22 3 124 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS195)
A6WIE9 4.61e-06 50 22 3 124 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS185)
A3D9F2 4.61e-06 50 22 3 124 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS155 / ATCC BAA-1091)
A9L2Y4 4.84e-06 50 25 2 139 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella baltica (strain OS195)
A6WNN7 4.84e-06 50 25 2 139 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella baltica (strain OS185)
A3D499 4.84e-06 50 25 2 139 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EA88 4.84e-06 50 25 2 139 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella baltica (strain OS223)
Q8E9R7 5.4e-06 50 24 4 133 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A1S6C9 5.72e-06 49 29 1 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A6V2Q4 5.73e-06 49 30 1 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas aeruginosa (strain PA7)
Q47GP8 5.95e-06 49 28 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Dechloromonas aromatica (strain RCB)
Q885T9 6.98e-06 49 29 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q21UL3 7.19e-06 49 27 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q088H8 7.41e-06 49 23 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella frigidimarina (strain NCIMB 400)
Q4K8M4 7.45e-06 49 29 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B7MXR3 7.45e-06 49 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O81 (strain ED1a)
Q4ZZG3 7.77e-06 49 26 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas syringae pv. syringae (strain B728a)
Q48PJ4 7.77e-06 49 26 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q1R9I4 7.81e-06 49 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain UTI89 / UPEC)
B7MFZ8 7.81e-06 49 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UFP4 7.88e-06 49 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q0TFL0 7.96e-06 49 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7NN47 8.26e-06 49 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A1RP78 8.29e-06 49 22 3 124 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sp. (strain W3-18-1)
A4Y2Q5 8.29e-06 49 22 3 124 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q6D7X5 8.31e-06 49 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q87UZ2 8.86e-06 49 26 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B1LLI3 9.59e-06 49 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
B7VGS0 9.67e-06 48 26 2 138 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio atlanticus (strain LGP32)
Q1QEI9 9.68e-06 49 28 0 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q3K8T6 9.69e-06 48 29 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas fluorescens (strain Pf0-1)
C5BRL2 1.02e-05 49 26 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Teredinibacter turnerae (strain ATCC 39867 / T7901)
B5YX17 1.04e-05 48 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XE29 1.04e-05 48 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O157:H7
Q3YZX6 1.07e-05 48 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shigella sonnei (strain Ss046)
Q820C5 1.07e-05 48 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shigella flexneri
Q0T2P9 1.07e-05 48 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shigella flexneri serotype 5b (strain 8401)
B1IXV6 1.07e-05 48 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
E3G327 1.09e-05 48 32 3 123 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Enterobacter lignolyticus (strain SCF1)
Q31Z65 1.1e-05 48 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shigella boydii serotype 4 (strain Sb227)
B2TW20 1.1e-05 48 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I7I7 1.1e-05 48 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain SE11)
B7M5R7 1.1e-05 48 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O8 (strain IAI1)
B7LAP9 1.1e-05 48 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain 55989 / EAEC)
Q32DV8 1.11e-05 48 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
B7N5J4 1.11e-05 48 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P17993 1.11e-05 48 22 2 163 1 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain K12)
B1X8C6 1.11e-05 48 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain K12 / DH10B)
C4ZU73 1.11e-05 48 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
A7ZP50 1.11e-05 48 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0AA73 1.2e-05 48 25 2 162 3 ubiG Ubiquinone biosynthesis O-methyltransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
C1DHS2 1.22e-05 48 25 4 140 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q28VP7 1.27e-05 48 32 2 122 3 ubiG Ubiquinone biosynthesis O-methyltransferase Jannaschia sp. (strain CCS1)
Q31IM5 1.31e-05 48 25 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q0HZP7 1.38e-05 48 22 3 124 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sp. (strain MR-7)
Q0HEA1 1.38e-05 48 22 3 124 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sp. (strain MR-4)
A0L1M4 1.38e-05 48 22 3 124 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sp. (strain ANA-3)
Q4FVG3 1.43e-05 48 28 0 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B0TJ16 1.55e-05 48 24 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella halifaxensis (strain HAW-EB4)
P37431 1.64e-05 48 21 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TPG0 1.64e-05 48 21 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella schwarzengrund (strain CVM19633)
B4SYU8 1.64e-05 48 21 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella newport (strain SL254)
B4TBE3 1.64e-05 48 21 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella heidelberg (strain SL476)
B5FNR7 1.64e-05 48 21 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella dublin (strain CT_02021853)
B5EYW1 1.64e-05 48 21 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella agona (strain SL483)
Q4ZQ90 1.7e-05 48 28 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas syringae pv. syringae (strain B728a)
Q48FM4 1.7e-05 48 28 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8Z560 1.73e-05 48 21 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella typhi
Q7N2M5 1.83e-05 48 22 2 154 3 ubiG Ubiquinone biosynthesis O-methyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7W5Z6 1.89e-05 48 28 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q21IR9 2.19e-05 48 22 2 162 3 ubiG Ubiquinone biosynthesis O-methyltransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q5QYG2 2.26e-05 48 25 3 110 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A7MU79 2.3e-05 48 24 3 165 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio campbellii (strain ATCC BAA-1116)
A5II90 2.36e-05 48 24 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Legionella pneumophila (strain Corby)
B0SW81 2.36e-05 48 30 1 106 3 ubiG Ubiquinone biosynthesis O-methyltransferase Caulobacter sp. (strain K31)
P08442 2.42e-05 48 32 2 113 4 syc1184_c Uncharacterized protein syc1184_c Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
A9MJY3 2.49e-05 47 21 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q5X0X6 2.76e-05 47 24 3 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Legionella pneumophila (strain Paris)
C3K6J1 2.76e-05 47 29 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas fluorescens (strain SBW25)
C1DRQ3 2.76e-05 47 28 1 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
C0Q093 2.89e-05 47 21 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella paratyphi C (strain RKS4594)
B5RCA1 2.89e-05 47 21 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R249 2.89e-05 47 21 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella enteritidis PT4 (strain P125109)
Q57M77 2.89e-05 47 21 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella choleraesuis (strain SC-B67)
A8G0S7 2.94e-05 47 22 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sediminis (strain HAW-EB3)
Q1IDA6 3.09e-05 47 29 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas entomophila (strain L48)
B4EWC9 3.19e-05 47 25 2 108 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Proteus mirabilis (strain HI4320)
E3HCT1 3.3e-05 47 27 4 103 3 bioC2 Malonyl-[acyl-carrier protein] O-methyltransferase 2 Ilyobacter polytropus (strain ATCC 51220 / DSM 2926 / LMG 16218 / CuHBu1)
P59911 3.49e-05 47 24 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B5XNZ3 3.62e-05 47 21 2 154 3 ubiG Ubiquinone biosynthesis O-methyltransferase Klebsiella pneumoniae (strain 342)
A8LQ43 3.89e-05 47 27 5 187 3 ubiG Ubiquinone biosynthesis O-methyltransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q2NSL7 4.1e-05 47 24 2 153 3 ubiG Ubiquinone biosynthesis O-methyltransferase Sodalis glossinidius (strain morsitans)
Q3T131 4.12e-05 47 24 2 141 2 COQ3 Ubiquinone biosynthesis O-methyltransferase, mitochondrial Bos taurus
Q3SK91 4.49e-05 47 26 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Thiobacillus denitrificans (strain ATCC 25259)
A4JCG7 4.49e-05 47 30 1 122 3 ubiG Ubiquinone biosynthesis O-methyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q5WSQ8 4.65e-05 47 23 3 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Legionella pneumophila (strain Lens)
A8H966 4.67e-05 47 23 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q87DI1 4.81e-05 47 25 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2IA21 4.81e-05 47 25 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Xylella fastidiosa (strain M23)
B1KR07 4.85e-05 47 24 4 133 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella woodyi (strain ATCC 51908 / MS32)
A8ADY5 5.15e-05 47 21 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B8CI06 5.17e-05 47 21 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella piezotolerans (strain WP3 / JCM 13877)
A4WCN5 5.35e-05 47 22 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Enterobacter sp. (strain 638)
Q0BHA0 5.36e-05 47 30 1 122 3 ubiG Ubiquinone biosynthesis O-methyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YV26 5.36e-05 47 30 1 122 3 ubiG Ubiquinone biosynthesis O-methyltransferase Burkholderia ambifaria (strain MC40-6)
B0KTX4 5.62e-05 46 29 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas putida (strain GB-1)
Q88M10 5.67e-05 46 29 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W7G3 5.67e-05 46 29 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A1SRS4 5.67e-05 47 25 4 120 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A1SAJ8 5.73e-05 47 27 5 135 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q98G87 6.39e-05 46 28 5 181 3 ubiG Ubiquinone biosynthesis O-methyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B4EZ30 6.61e-05 46 20 2 178 3 ubiG Ubiquinone biosynthesis O-methyltransferase Proteus mirabilis (strain HI4320)
Q5ZRH9 6.67e-05 46 23 3 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A1JIF2 6.83e-05 46 24 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1TSA0 6.96e-05 46 26 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Paracidovorax citrulli (strain AAC00-1)
Q31GD8 7.09e-05 46 32 1 106 3 ubiG Ubiquinone biosynthesis O-methyltransferase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q89AK7 7.13e-05 46 28 2 98 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q11E01 7.23e-05 46 29 5 182 3 ubiG Ubiquinone biosynthesis O-methyltransferase Chelativorans sp. (strain BNC1)
A4YKT6 7.23e-05 46 28 4 164 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bradyrhizobium sp. (strain ORS 278)
B1JS96 7.47e-05 46 22 2 154 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66CZ4 7.47e-05 46 22 2 154 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TNI8 7.47e-05 46 22 2 154 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia pestis (strain Pestoides F)
Q1CFZ1 7.47e-05 46 22 2 154 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R284 7.47e-05 46 22 2 154 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZGR6 7.47e-05 46 22 2 154 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia pestis
B2K9A4 7.47e-05 46 22 2 154 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C9H5 7.47e-05 46 22 2 154 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FKF4 7.47e-05 46 22 2 154 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B0TT38 8.6e-05 46 27 1 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella halifaxensis (strain HAW-EB4)
B1J5G4 8.62e-05 46 28 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas putida (strain W619)
Q9CKD6 8.65e-05 46 23 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pasteurella multocida (strain Pm70)
B1JP75 8.77e-05 46 23 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66FT0 8.77e-05 46 23 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TR39 8.77e-05 46 23 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis (strain Pestoides F)
Q1CNB4 8.77e-05 46 23 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis bv. Antiqua (strain Nepal516)
A9R431 8.77e-05 46 23 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis bv. Antiqua (strain Angola)
Q8D1I3 8.77e-05 46 23 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis
B2K0Y4 8.77e-05 46 23 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FDE0 8.77e-05 46 23 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8H499 9.09e-05 46 27 1 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q2SY32 9.12e-05 46 29 3 138 3 ubiG Ubiquinone biosynthesis O-methyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63RZ8 9.12e-05 46 29 3 138 3 ubiG Ubiquinone biosynthesis O-methyltransferase Burkholderia pseudomallei (strain K96243)
Q3JPX1 9.12e-05 46 29 3 138 3 ubiG Ubiquinone biosynthesis O-methyltransferase Burkholderia pseudomallei (strain 1710b)
Q62M18 9.12e-05 46 29 3 138 3 ubiG Ubiquinone biosynthesis O-methyltransferase Burkholderia mallei (strain ATCC 23344)
A4WW91 9.16e-05 46 31 2 118 3 ubiG Ubiquinone biosynthesis O-methyltransferase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A6TBT7 9.25e-05 46 21 2 154 3 ubiG Ubiquinone biosynthesis O-methyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B6J5Y2 0.000102 46 31 2 119 3 ubiG Ubiquinone biosynthesis O-methyltransferase Coxiella burnetii (strain CbuK_Q154)
A8FSS4 0.000105 46 34 4 103 3 rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD Shewanella sediminis (strain HAW-EB3)
A8GGX8 0.000106 46 23 3 155 3 ubiG Ubiquinone biosynthesis O-methyltransferase Serratia proteamaculans (strain 568)
Q1CBG0 0.000108 46 23 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis bv. Antiqua (strain Antiqua)
A9KGL7 0.000112 45 27 3 165 3 ubiG Ubiquinone biosynthesis O-methyltransferase Coxiella burnetii (strain Dugway 5J108-111)
Q820B5 0.000127 45 31 2 119 3 ubiG Ubiquinone biosynthesis O-methyltransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NBI0 0.000127 45 31 2 119 3 ubiG Ubiquinone biosynthesis O-methyltransferase Coxiella burnetii (strain RSA 331 / Henzerling II)
B6J1W2 0.000127 45 31 2 119 3 ubiG Ubiquinone biosynthesis O-methyltransferase Coxiella burnetii (strain CbuG_Q212)
A8G8B8 0.000135 45 26 3 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Serratia proteamaculans (strain 568)
Q8FFP0 0.000136 45 23 2 138 3 ubiG Ubiquinone biosynthesis O-methyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B8EI29 0.000149 45 30 9 205 3 ubiG Ubiquinone biosynthesis O-methyltransferase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
P65347 0.000151 45 30 5 136 3 BQ2027_MB0092 Uncharacterized methyltransferase Mb0092 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WK03 0.000151 45 30 5 136 3 Rv0089 Uncharacterized methyltransferase Rv0089 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WK02 0.000151 45 30 5 136 3 MT0098 Uncharacterized methyltransferase MT0098 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B1Y2L3 0.000152 45 29 1 118 3 ubiG Ubiquinone biosynthesis O-methyltransferase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q7MM27 0.000155 45 26 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio vulnificus (strain YJ016)
Q8D8E0 0.000155 45 26 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio vulnificus (strain CMCP6)
E3H9W1 0.000166 45 25 6 134 3 bioC1 Malonyl-[acyl-carrier protein] O-methyltransferase 1 Ilyobacter polytropus (strain ATCC 51220 / DSM 2926 / LMG 16218 / CuHBu1)
B5BCS0 0.000172 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella paratyphi A (strain AKU_12601)
Q5PCY1 0.000172 45 20 2 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
C3LLV3 0.000187 45 26 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio cholerae serotype O1 (strain M66-2)
Q9KSJ9 0.000187 45 26 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F1U0 0.000187 45 26 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B5FDT8 0.000207 45 25 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Aliivibrio fischeri (strain MJ11)
B3PI89 0.000209 45 28 6 142 3 bioC Biotin biosynthesis bifunctional protein BioHC Cellvibrio japonicus (strain Ueda107)
Q9PD92 0.000215 45 28 5 124 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Xylella fastidiosa (strain 9a5c)
A3QIE1 0.000223 45 21 3 125 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q5LWM6 0.000232 45 32 2 118 3 ubiG Ubiquinone biosynthesis O-methyltransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q0HXI0 0.000242 45 36 3 91 3 rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD Shewanella sp. (strain MR-7)
A7GSD9 0.000253 45 29 4 107 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q6G5K3 0.00027 44 30 5 147 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q1GCH8 0.000273 44 27 5 181 3 ubiG Ubiquinone biosynthesis O-methyltransferase Ruegeria sp. (strain TM1040)
C6DI77 0.000278 44 23 2 108 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6FFY1 0.000291 44 25 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q2K3S8 0.000292 44 29 6 181 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B9JB78 0.000309 44 29 6 181 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q5E5J8 0.000323 44 24 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A0KWN3 0.00033 44 27 1 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella sp. (strain ANA-3)
Q0HIX5 0.000333 44 27 1 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella sp. (strain MR-4)
A1U3K1 0.000334 44 27 2 119 3 ubiG Ubiquinone biosynthesis O-methyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q2SN12 0.000344 44 26 2 107 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Hahella chejuensis (strain KCTC 2396)
Q7VKW2 0.000355 44 22 3 165 3 ubiG Ubiquinone biosynthesis O-methyltransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q16D32 0.000358 44 27 4 180 3 ubiG Ubiquinone biosynthesis O-methyltransferase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B0VMN8 0.000361 44 23 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain SDF)
B9KPP7 0.00037 44 30 2 118 3 ubiG Ubiquinone biosynthesis O-methyltransferase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q8UA66 0.000375 44 27 6 174 3 ubiG Ubiquinone biosynthesis O-methyltransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
B0V5X4 0.000378 44 23 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain AYE)
B7IBN2 0.000378 44 23 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain AB0057)
B7H2Y9 0.000378 44 23 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain AB307-0294)
Q8EEG9 0.000379 44 27 1 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q92MK1 0.000427 44 33 3 104 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhizobium meliloti (strain 1021)
Q609G2 0.000438 44 22 4 193 3 ubiG Ubiquinone biosynthesis O-methyltransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q46Y42 0.000441 44 29 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
B2I023 0.00045 44 23 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain ACICU)
C3MHQ9 0.000455 44 33 3 104 3 ubiG Ubiquinone biosynthesis O-methyltransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q1QS47 0.000457 44 28 5 128 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q0CCX8 0.000522 44 25 1 99 3 gedG Methyltransferase gedG Aspergillus terreus (strain NIH 2624 / FGSC A1156)
B8H209 0.000523 43 28 1 106 3 ubiG Ubiquinone biosynthesis O-methyltransferase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A9X1 0.000523 43 28 1 106 3 ubiG Ubiquinone biosynthesis O-methyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q13VB4 0.000532 43 28 2 138 3 ubiG Ubiquinone biosynthesis O-methyltransferase Paraburkholderia xenovorans (strain LB400)
Q8EBQ3 0.00063 44 35 3 91 3 rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7MZ81 0.000643 43 26 3 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1MBA9 0.000689 43 31 2 106 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A9ADW3 0.000749 43 29 1 122 3 ubiG Ubiquinone biosynthesis O-methyltransferase Burkholderia multivorans (strain ATCC 17616 / 249)
B4EB49 0.000749 43 29 1 122 3 ubiG Ubiquinone biosynthesis O-methyltransferase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q6DAQ7 0.000766 43 22 2 108 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A3PNM3 0.000817 43 29 2 118 3 ubiG Ubiquinone biosynthesis O-methyltransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q8Y0Z5 0.000873 43 28 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q1BY35 0.001 43 29 1 122 3 ubiG Ubiquinone biosynthesis O-methyltransferase Burkholderia orbicola (strain AU 1054)
B1JXR2 0.001 43 29 1 122 3 ubiG Ubiquinone biosynthesis O-methyltransferase Burkholderia orbicola (strain MC0-3)
A0K5L4 0.001 43 29 1 122 3 ubiG Ubiquinone biosynthesis O-methyltransferase Burkholderia cenocepacia (strain HI2424)
Q3J8U2 0.001 43 24 1 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q39IG8 0.001 43 29 1 122 3 ubiG Ubiquinone biosynthesis O-methyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_09595
Feature type CDS
Gene cmoM
Product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM
Location 70925 - 71713 (strand: -1)
Length 789 (nucleotides) / 262 (amino acids)

Contig

Accession ZDB_366
Length 191897 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1238
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF08241 Methyltransferase domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2227 Coenzyme transport and metabolism (H) H 2-polyprenyl-3-methyl-5-hydroxy-6-metoxy-1,4-benzoquinol methylase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06219 tRNA 5-carboxymethoxyuridine methyltransferase [EC:2.1.1.-] - -

Protein Sequence

MVDRNFDDIAEKFTRNIYGTTKGQIREAVVWQDLDALLTRLKPGPLRILDAGGGDGFFSRRLAALGHQVVLCDLSEEMIARAQQAALDDGVAENMSFIHCAAQDIALHTEGAFDLVLFHAVLEWITDQKGAIEALTAIIAGGGALSLMFYNANGLVMRNAILGNFHLATPEIQRRRKRSLSPQNPLMPEQVYQWLDDCRLTIEAKTGVRVFHDYLQSRLLQNRDFPALLALEQRYCRQEPYISLGRYIHVMARKPIRRMDNE

Flanking regions ( +/- flanking 50bp)

ACCGCCGCAGACTGACCCGAAATATCCCCCGGAACTGAACACAGGTTTTCATGGTTGATCGTAATTTTGACGATATCGCGGAGAAATTCACCCGCAATATCTATGGCACAACAAAAGGGCAAATCCGCGAAGCGGTGGTCTGGCAGGATCTGGACGCCTTACTGACCCGGCTGAAACCGGGTCCGCTGCGCATTCTGGATGCGGGCGGCGGTGACGGTTTTTTCTCCCGCCGTCTGGCTGCACTGGGGCATCAGGTGGTATTGTGCGACCTGTCAGAAGAGATGATTGCCCGCGCACAACAGGCCGCGCTGGATGACGGCGTGGCAGAAAATATGTCCTTTATTCATTGTGCGGCACAGGATATCGCACTTCACACTGAAGGGGCGTTTGATCTGGTATTATTTCATGCCGTTTTGGAGTGGATCACAGATCAAAAAGGTGCAATTGAAGCACTGACCGCTATAATAGCGGGCGGTGGTGCATTATCGTTAATGTTTTACAATGCGAACGGACTTGTGATGCGAAATGCGATATTAGGCAATTTTCATCTGGCAACCCCGGAAATTCAGCGCCGCCGCAAGCGTTCGTTATCGCCGCAGAATCCCCTTATGCCGGAACAGGTTTATCAGTGGCTGGATGATTGCCGTCTGACGATTGAGGCAAAAACCGGCGTGCGGGTTTTCCATGATTATCTGCAGAGCCGCCTGTTACAAAACCGTGATTTCCCGGCGCTGCTGGCCCTGGAGCAACGCTATTGCCGTCAGGAGCCTTATATCAGCTTAGGCCGCTATATTCACGTTATGGCACGAAAACCGATCAGAAGGATGGACAATGAGTGAGTTTACCCAAACAGTCCCGGAACTCGTGGCATGGGCGCGAAAGAATGATT