Homologs in group_1296

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07205 FBDBKF_07205 73.9 Morganella morganii S1 cmoM tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM
EHELCC_03765 EHELCC_03765 73.9 Morganella morganii S2 cmoM tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM
NLDBIP_03765 NLDBIP_03765 73.9 Morganella morganii S4 cmoM tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM
LHKJJB_09595 LHKJJB_09595 73.9 Morganella morganii S3 cmoM tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM
HKOGLL_09380 HKOGLL_09380 73.9 Morganella morganii S5 cmoM tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM
F4V73_RS01390 F4V73_RS01390 73.5 Morganella psychrotolerans cmoM tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM

Distribution of the homologs in the orthogroup group_1296

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1296

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8XDG3 2.23e-108 316 56 0 254 1 cmoM tRNA 5-carboxymethoxyuridine methyltransferase Escherichia coli O157:H7
P36566 2.49e-108 316 56 0 254 1 cmoM tRNA 5-carboxymethoxyuridine methyltransferase Escherichia coli (strain K12)
Q7MQ33 5.92e-08 55 32 3 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio vulnificus (strain YJ016)
Q8DDP9 5.92e-08 55 32 3 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio vulnificus (strain CMCP6)
A7MTX1 1.59e-07 54 32 3 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio campbellii (strain ATCC BAA-1116)
Q87TH4 1.71e-07 54 32 3 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
C3LPS5 2.98e-07 53 33 3 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio cholerae serotype O1 (strain M66-2)
Q9KVQ6 2.98e-07 53 33 3 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4E5 2.98e-07 53 33 3 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q3BSF8 8.12e-07 52 25 1 135 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q68W57 1.34e-06 51 29 3 120 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A0L3L9 1.72e-06 51 27 6 143 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q8PK00 1.94e-06 51 25 1 135 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas axonopodis pv. citri (strain 306)
B3PH48 1.98e-06 51 30 2 108 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Cellvibrio japonicus (strain Ueda107)
Q8UA66 2.01e-06 51 26 6 178 3 ubiG Ubiquinone biosynthesis O-methyltransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q0CCX8 2.31e-06 51 26 1 99 3 gedG Methyltransferase gedG Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A1S6C9 2.46e-06 50 28 1 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q98G87 3.28e-06 50 25 5 184 3 ubiG Ubiquinone biosynthesis O-methyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q3T131 3.64e-06 50 27 3 140 2 COQ3 Ubiquinone biosynthesis O-methyltransferase, mitochondrial Bos taurus
Q0CJC6 4.46e-06 50 27 0 109 2 pgmE Methyltransferase pgmE Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A1W5SKE9 4.58e-06 50 27 0 109 2 pgmE Methyltransferase pgmE Aspergillus terreus
Q7NZ91 4.63e-06 50 23 2 139 3 ubiG Ubiquinone biosynthesis O-methyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B4EWC9 6.04e-06 49 29 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Proteus mirabilis (strain HI4320)
Q8P8H2 6.15e-06 49 22 3 162 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RS27 6.15e-06 49 22 3 162 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas campestris pv. campestris (strain B100)
Q4UVL4 6.15e-06 49 22 3 162 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas campestris pv. campestris (strain 8004)
Q5QZ53 9.27e-06 49 25 3 151 3 ubiG Ubiquinone biosynthesis O-methyltransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A9L2Y4 9.91e-06 48 24 2 143 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella baltica (strain OS195)
A6WNN7 9.91e-06 48 24 2 143 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella baltica (strain OS185)
A3D499 9.91e-06 48 24 2 143 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EA88 9.91e-06 48 24 2 143 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella baltica (strain OS223)
Q5GZB5 1.01e-05 48 22 3 162 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SHS9 1.01e-05 48 22 3 162 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P2C4 1.01e-05 48 22 3 162 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q9ZCP3 1.09e-05 48 31 2 82 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia prowazekii (strain Madrid E)
C4K2K3 1.15e-05 48 27 3 120 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia peacockii (strain Rustic)
E3G327 1.17e-05 48 29 3 121 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Enterobacter lignolyticus (strain SCF1)
A1RJD1 1.25e-05 48 26 1 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella sp. (strain W3-18-1)
A4Y759 1.31e-05 48 26 1 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B0TT38 1.98e-05 48 27 1 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella halifaxensis (strain HAW-EB4)
A7GSD9 2.1e-05 48 29 5 135 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q12S23 2.45e-05 48 29 5 123 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
C6DI77 2.64e-05 47 25 2 111 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B0TJ16 2.79e-05 47 30 5 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella halifaxensis (strain HAW-EB4)
Q9NZJ6 2.95e-05 48 22 3 157 1 COQ3 Ubiquinone biosynthesis O-methyltransferase, mitochondrial Homo sapiens
B9JB78 3.27e-05 47 25 6 186 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
A4SM99 3.39e-05 47 24 2 138 3 ubiG Ubiquinone biosynthesis O-methyltransferase Aeromonas salmonicida (strain A449)
Q1I3T0 4.85e-05 47 28 4 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas entomophila (strain L48)
Q6DAQ7 4.91e-05 47 25 2 111 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5QYG2 5.7e-05 47 27 4 111 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A8G0S7 5.86e-05 47 28 4 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sediminis (strain HAW-EB3)
Q9Z439 6.01e-05 47 28 4 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida
B3PI89 6.54e-05 47 31 4 111 3 bioC Biotin biosynthesis bifunctional protein BioHC Cellvibrio japonicus (strain Ueda107)
P64842 6.56e-05 47 27 2 117 3 BQ2027_MB1440C Uncharacterized protein Mb1440c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WLY7 6.56e-05 47 27 2 117 1 Rv1405c Uncharacterized protein Rv1405c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WLY6 6.56e-05 47 27 2 117 3 MT1449 Uncharacterized protein MT1449 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q21H69 6.66e-05 46 30 3 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A8G8B8 7.25e-05 46 27 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Serratia proteamaculans (strain 568)
B1JP75 7.38e-05 46 27 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66FT0 7.38e-05 46 27 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TR39 7.38e-05 46 27 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis (strain Pestoides F)
Q1CNB4 7.38e-05 46 27 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis bv. Antiqua (strain Nepal516)
A9R431 7.38e-05 46 27 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis bv. Antiqua (strain Angola)
Q8D1I3 7.38e-05 46 27 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis
B2K0Y4 7.38e-05 46 27 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FDE0 7.38e-05 46 27 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q1CBG0 7.45e-05 46 27 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis bv. Antiqua (strain Antiqua)
Q088H8 7.52e-05 46 28 5 124 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella frigidimarina (strain NCIMB 400)
A9KYL8 8.33e-05 46 26 4 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS195)
A6WIE9 8.33e-05 46 26 4 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS185)
A3D9F2 8.33e-05 46 26 4 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS155 / ATCC BAA-1091)
A1RP78 8.57e-05 46 26 4 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sp. (strain W3-18-1)
A4Y2Q5 8.57e-05 46 26 4 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B8E6B6 8.64e-05 46 26 4 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS223)
Q2J419 8.73e-05 46 25 4 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhodopseudomonas palustris (strain HaA2)
A8GT99 8.75e-05 46 26 3 120 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia rickettsii (strain Sheila Smith)
B0BUT9 8.75e-05 46 26 3 120 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia rickettsii (strain Iowa)
A8F2G9 8.83e-05 46 26 3 120 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia massiliae (strain Mtu5)
C3K8U4 8.86e-05 46 26 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas fluorescens (strain SBW25)
B1KR07 9.31e-05 46 29 5 124 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella woodyi (strain ATCC 51908 / MS32)
C3PLF4 9.78e-05 46 26 3 120 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia africae (strain ESF-5)
Q92GT5 9.97e-05 46 26 3 120 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia conorii (strain ATCC VR-613 / Malish 7)
B0SW81 0.000105 46 21 3 185 3 ubiG Ubiquinone biosynthesis O-methyltransferase Caulobacter sp. (strain K31)
Q73HZ4 0.000105 45 29 3 100 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Wolbachia pipientis wMel
Q11E01 0.000112 45 26 5 186 3 ubiG Ubiquinone biosynthesis O-methyltransferase Chelativorans sp. (strain BNC1)
Q0HIX5 0.00014 45 24 1 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella sp. (strain MR-4)
A7HTX8 0.000156 45 27 2 122 3 ubiG Ubiquinone biosynthesis O-methyltransferase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q6D3C1 0.000161 45 28 4 118 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1J2S8 0.000162 45 28 4 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain W619)
B8CI06 0.000197 45 29 5 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella piezotolerans (strain WP3 / JCM 13877)
Q9Z5E9 0.000202 44 28 3 101 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE (Fragment) Pseudomonas oleovorans
B0KM36 0.000207 45 28 4 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain GB-1)
Q8EEG9 0.000223 45 24 1 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q482G8 0.000244 45 28 1 100 3 ubiG Ubiquinone biosynthesis O-methyltransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q88D17 0.000247 45 28 4 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5WA45 0.000247 45 28 4 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A9IQF4 0.000255 45 22 4 184 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q87UZ2 0.000271 44 26 3 118 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A6VTA1 0.000277 44 28 3 108 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Marinomonas sp. (strain MWYL1)
Q4ZZG3 0.000281 44 26 3 118 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas syringae pv. syringae (strain B728a)
Q48PJ4 0.000281 44 26 3 118 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A1SRS4 0.00029 44 28 3 110 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
D2T333 0.000331 44 46 0 43 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Erwinia pyrifoliae (strain DSM 12163 / CIP 106111 / Ep16/96)
B8H209 0.000357 44 22 3 183 3 ubiG Ubiquinone biosynthesis O-methyltransferase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A9X1 0.000357 44 22 3 183 3 ubiG Ubiquinone biosynthesis O-methyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B2VG41 0.000386 44 25 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2K3S8 0.000418 44 26 5 168 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A8GXR2 0.000438 44 28 2 82 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia bellii (strain OSU 85-389)
A1WVM4 0.000449 44 25 4 148 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Halorhodospira halophila (strain DSM 244 / SL1)
D5DIV9 0.000452 44 26 4 127 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Priestia megaterium (strain DSM 319 / IMG 1521)
Q1RJY5 0.000454 44 28 2 82 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia bellii (strain RML369-C)
Q818X2 0.000465 44 28 4 118 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q5LWM6 0.000556 43 27 2 129 3 ubiG Ubiquinone biosynthesis O-methyltransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
C3MHQ9 0.000561 43 24 3 132 3 ubiG Ubiquinone biosynthesis O-methyltransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9PAM5 0.000621 43 21 3 176 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xylella fastidiosa (strain 9a5c)
Q2L2T5 0.000763 43 23 2 130 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bordetella avium (strain 197N)
Q4UMW4 0.000768 43 29 2 82 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
B0U3W1 0.000804 43 22 3 163 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xylella fastidiosa (strain M12)
Q92MK1 0.000842 43 23 2 113 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhizobium meliloti (strain 1021)
B3PP83 0.001 43 26 5 168 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhizobium etli (strain CIAT 652)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS03560
Feature type CDS
Gene cmoM
Product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM
Location 794719 - 795492 (strand: 1)
Length 774 (nucleotides) / 257 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1296
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF08241 Methyltransferase domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2227 Coenzyme transport and metabolism (H) H 2-polyprenyl-3-methyl-5-hydroxy-6-metoxy-1,4-benzoquinol methylase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06219 tRNA 5-carboxymethoxyuridine methyltransferase [EC:2.1.1.-] - -

Protein Sequence

MSDRNFDDIADKFSRNIYGTTKGKIRQAVIWDDLQQLLTQLPDRPLRILDAGGGEGYFSRQLAKLGHQIILCDLSQEMLNRAQEAAIDEGVVNQMTFICCAAQEINQHLDDGVDLILFHAVLEWITDQKNAINVLTDMLLPNGILSLMFYNANGIVMRNAILGNFHLANPEIPRRRKRSLSPQNPLQPEDVYQWLASFSMTILGKTGVRVFHDYLQSRQLQNKDFPALLALEQRYCRQEPYISLGRYIHVMAQKCVN

Flanking regions ( +/- flanking 50bp)

ATCAGAATGCAAAGAGCGCAAGTAACAAGTTGTTATCATGAGGCGTTTTAATGTCAGACCGTAATTTTGACGATATTGCTGATAAATTCTCTCGCAATATCTATGGCACAACAAAAGGAAAAATCCGCCAAGCGGTGATTTGGGATGATTTACAACAATTATTAACTCAACTCCCTGATCGTCCGTTGCGTATTTTAGATGCGGGGGGTGGTGAAGGTTATTTTTCCAGACAACTGGCAAAATTAGGGCACCAGATAATTTTATGTGATCTATCACAAGAGATGCTTAACCGCGCACAAGAAGCGGCTATTGATGAAGGTGTTGTCAATCAAATGACGTTTATTTGTTGTGCAGCACAAGAGATAAACCAGCATCTAGATGATGGTGTTGACTTAATTCTATTCCATGCCGTATTAGAGTGGATCACAGATCAGAAAAACGCCATAAATGTACTTACCGATATGCTACTTCCTAATGGTATCCTATCGTTAATGTTTTACAATGCGAATGGCATTGTCATGAGAAATGCTATTTTGGGAAATTTCCATTTGGCAAATCCGGAAATACCACGCAGAAGAAAACGCTCATTATCCCCACAAAATCCGCTACAACCTGAGGATGTTTATCAATGGTTAGCGTCATTTTCAATGACGATTTTAGGAAAAACGGGAGTGCGTGTTTTTCATGACTATTTGCAAAGTCGTCAGTTGCAAAATAAAGATTTTCCAGCGTTGCTTGCCTTAGAGCAACGCTATTGTCGGCAAGAGCCCTATATCAGTCTGGGGCGTTACATTCATGTCATGGCACAAAAGTGTGTAAATTAAGGATGTACTATGAGTGATTTTACCCAGACCGTTCCTGAGTTAGTGTCTTG