Homologs in group_1109

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05890 FBDBKF_05890 100.0 Morganella morganii S1 metP ABC-type methionine transport system, permease component
NLDBIP_09315 NLDBIP_09315 100.0 Morganella morganii S4 metP ABC-type methionine transport system, permease component
LHKJJB_08440 LHKJJB_08440 100.0 Morganella morganii S3 metP ABC-type methionine transport system, permease component
HKOGLL_07990 HKOGLL_07990 100.0 Morganella morganii S5 metP ABC-type methionine transport system, permease component
F4V73_RS16005 F4V73_RS16005 96.3 Morganella psychrotolerans - methionine ABC transporter permease MetI
PMI_RS11160 PMI_RS11160 83.9 Proteus mirabilis HI4320 - methionine ABC transporter permease MetI

Distribution of the homologs in the orthogroup group_1109

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1109

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZRN0 1.07e-114 329 84 0 217 3 metI D-methionine transport system permease protein MetI Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z991 6.41e-114 327 84 0 217 3 metI D-methionine transport system permease protein MetI Salmonella typhi
Q8ZH39 1.38e-111 321 81 0 217 3 metI D-methionine transport system permease protein MetI Yersinia pestis
P31547 4.74e-111 320 82 0 217 1 metI D-methionine transport system permease protein MetI Escherichia coli (strain K12)
Q8X800 8.02e-111 319 82 0 217 3 metI D-methionine transport system permease protein MetI Escherichia coli O157:H7
Q9KTJ6 1.48e-68 212 52 0 210 3 metI Probable D-methionine transport system permease protein MetI Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P46492 5.02e-51 167 48 0 204 3 metI Probable D-methionine transport system permease protein MetI Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CK96 1.38e-48 161 50 2 204 3 metI Probable D-methionine transport system permease protein MetI Pasteurella multocida (strain Pm70)
O32168 2.25e-44 150 45 0 180 1 metP Methionine import system permease protein MetP Bacillus subtilis (strain 168)
Q8RQL4 3.15e-10 61 26 4 208 3 gluD Glutamate transport system permease protein GluD Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P48245 1.41e-09 59 25 3 215 1 gluD Glutamate transport system permease protein GluD Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q9KHT8 1.26e-07 53 24 3 161 1 opuCB Carnitine transport permease protein OpuCB Listeria monocytogenes
G2JZ43 1.26e-07 53 24 3 161 1 opuCB Carnitine transport permease protein OpuCB Listeria monocytogenes serotype 1/2a (strain 10403S)
P17327 6.52e-07 52 29 4 147 2 proW Glycine betaine/proline betaine transport system permease protein ProW Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q45461 6.82e-07 51 27 6 206 2 opuBB Choline transport system permease protein OpuBB Bacillus subtilis (strain 168)
A0QQ68 6.91e-07 52 25 2 164 1 phnE Phosphate-import permease protein PhnE Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P33361 7.72e-07 52 27 4 174 1 yehY Glycine betaine uptake system permease protein YehY Escherichia coli (strain K12)
P14176 8.01e-07 52 29 4 147 1 proW Glycine betaine/proline betaine transport system permease protein ProW Escherichia coli (strain K12)
P0A2I7 1.18e-06 51 24 6 232 1 hisM Histidine/lysine/arginine/ornithine transport system permease protein HisM Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2I8 1.18e-06 51 24 6 232 3 hisM Histidine/lysine/arginine/ornithine transport system permease protein HisM Salmonella typhi
E0SCY2 1.43e-06 51 27 4 168 1 ousW Glycine betaine/choline transport system permease protein OusW Dickeya dadantii (strain 3937)
P54536 4.29e-06 49 27 4 176 1 artQ Arginine transport system permease protein ArtQ Bacillus subtilis (strain 168)
O69062 9.66e-06 48 25 5 205 3 htxC Putative phosphite transport system permease protein HtxC Stutzerimonas stutzeri
O34742 1.08e-05 48 28 4 151 1 opuCD Glycine betaine/carnitine/choline transport system permease protein OpuCD Bacillus subtilis (strain 168)
O34606 1.76e-05 47 26 3 164 2 glnP Probable glutamine ABC transporter permease protein GlnP Bacillus subtilis (strain 168)
Q8Y775 1.96e-05 48 30 4 155 1 egtUBC Probable ergothioneine transporter EgtUBC Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P46921 2.33e-05 47 25 5 182 1 opuAB Glycine betaine transport system permease protein OpuAB Bacillus subtilis (strain 168)
P54953 2.9e-05 47 25 4 179 1 yxeN Probable amino-acid permease protein YxeN Bacillus subtilis (strain 168)
P46339 4.95e-05 46 31 2 134 3 yqgH Probable ABC transporter permease protein YqgH Bacillus subtilis (strain 168)
P46340 5.23e-05 46 27 3 140 3 yqgI Probable ABC transporter permease protein YqgI Bacillus subtilis (strain 168)
P39775 5.7e-05 46 27 3 147 2 opuBD Choline transport system permease protein OpuBD Bacillus subtilis (strain 168)
Q9RR45 7.01e-05 46 23 6 174 1 gbuB Glycine betaine/carnitine transport permease protein GbuB Listeria monocytogenes serotype 1/2a (strain 10403S)
Q8ZPK1 7.23e-05 45 26 4 161 1 osmY Osmoprotectant import permease protein OsmY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AEU6 0.000123 45 27 4 148 3 hisM Histidine/lysine/arginine/ornithine transport system permease protein HisM Shigella flexneri
P0AEU3 0.000123 45 27 4 148 1 hisM Histidine/lysine/arginine/ornithine transport system permease protein HisM Escherichia coli (strain K12)
P0AEU4 0.000123 45 27 4 148 3 hisM Histidine/lysine/arginine/ornithine transport system permease protein HisM Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEU5 0.000123 45 27 4 148 3 hisM Histidine/lysine/arginine/ornithine transport system permease protein HisM Escherichia coli O157:H7
O69053 0.000146 45 23 1 157 3 ptxC Phosphite transport system permease protein PtxC Stutzerimonas stutzeri
Q9KHT6 0.000148 45 27 4 162 1 opuCD Carnitine transport permease protein OpuCD Listeria monocytogenes
G2JZ41 0.000148 45 27 4 162 1 opuCD Carnitine transport permease protein OpuCD Listeria monocytogenes serotype 1/2a (strain 10403S)
A0A0H2XK79 0.000162 45 26 2 155 3 egtUBC Probable ergothioneine transporter EgtUBC Staphylococcus aureus (strain USA300)
P9WG09 0.000485 43 32 0 74 1 pstA2 Phosphate transport system permease protein PstA 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG08 0.000485 43 32 0 74 3 pstA2 Phosphate transport system permease protein PstA 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A627 0.000485 43 32 0 74 3 pstA2 Phosphate transport system permease protein PstA 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q4FL38 0.000543 43 28 4 173 1 tmoV Trimethylamine N-oxide transport system permease protein TmoV Pelagibacter ubique (strain HTCC1062)
P0AER5 0.000564 43 30 3 96 1 gltK Glutamate/aspartate import permease protein GltK Escherichia coli (strain K12)
P0AER6 0.000564 43 30 3 96 3 gltK Glutamate/aspartate import permease protein GltK Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AER7 0.000564 43 30 3 96 3 gltK Glutamate/aspartate import permease protein GltK Escherichia coli O157:H7
Q52814 0.000702 43 25 6 160 3 aapM General L-amino acid transport system permease protein AapM Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_08935
Feature type CDS
Gene metP
Product ABC-type methionine transport system, permease component
Location 2625 - 3278 (strand: 1)
Length 654 (nucleotides) / 217 (amino acids)
In genomic island -

Contig

Accession ZDB_218
Length 215957 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1109
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2011 Amino acid transport and metabolism (E) E ABC-type methionine transport system, permease component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02072 D-methionine transport system permease protein ABC transporters -

Protein Sequence

MSEGMILLLVKGIWETLVMTFASGFLGFLIGLPVGVLLYITRSGQIADNKSLYRTLSVLVNIFRAIPFIILLVWMIPFTRLVVGTSIGLQAAIVPLTVGAAPFIARMVENALLEIPSGLIEASRAMGATPLQIVSKILLPEALPGLINAATITLITLVGYSAMGGAVGAGGLGQIGYQYGYVGYNAVVMNTVLALLVVLVFIIQVCGDRLVKAVTHK

Flanking regions ( +/- flanking 50bp)

GGCGATTAGTTTTCTGAAAGAACACCACGTAAAAACAGAGGTTCTCGGTTATGTCTGAAGGAATGATTTTACTGTTAGTTAAAGGCATCTGGGAAACCCTGGTTATGACATTTGCATCCGGTTTCCTGGGATTTTTAATCGGTCTGCCGGTGGGGGTACTGCTGTATATCACCCGTTCTGGGCAAATTGCGGATAATAAAAGCCTGTACCGGACCTTGTCCGTGCTGGTCAATATCTTCCGCGCGATTCCGTTCATTATCTTACTGGTGTGGATGATTCCGTTTACCCGGTTAGTCGTCGGTACATCTATCGGGTTACAGGCTGCCATTGTGCCGCTGACTGTCGGCGCTGCACCGTTTATTGCCCGTATGGTGGAAAACGCCCTGCTGGAGATCCCGTCAGGACTGATTGAAGCATCGCGGGCGATGGGAGCCACACCATTACAGATTGTCAGCAAGATCCTGCTGCCGGAAGCATTACCGGGACTGATCAACGCCGCTACCATTACGCTGATCACCCTCGTGGGTTACTCCGCAATGGGTGGTGCTGTCGGTGCAGGCGGGTTAGGTCAGATTGGTTATCAGTATGGTTATGTCGGATATAACGCAGTAGTTATGAATACGGTATTGGCATTGCTGGTTGTTTTGGTCTTTATTATTCAGGTATGTGGTGATCGTCTGGTTAAGGCCGTTACCCACAAATAAGACTCTCTCCGCGCCGCACTGACTGCGAACGCGTATTAAACAGAACGAGG