Homologs in group_83

Help

11 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03155 FBDBKF_03155 100.0 Morganella morganii S1 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
FBDBKF_19010 FBDBKF_19010 45.2 Morganella morganii S1 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
EHELCC_18755 EHELCC_18755 45.2 Morganella morganii S2 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
NLDBIP_07705 NLDBIP_07705 100.0 Morganella morganii S4 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
NLDBIP_18550 NLDBIP_18550 45.2 Morganella morganii S4 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
LHKJJB_07240 LHKJJB_07240 100.0 Morganella morganii S3 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
LHKJJB_18625 LHKJJB_18625 45.2 Morganella morganii S3 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
HKOGLL_03690 HKOGLL_03690 100.0 Morganella morganii S5 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
HKOGLL_18360 HKOGLL_18360 45.2 Morganella morganii S5 cysJ Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases
F4V73_RS11765 F4V73_RS11765 72.2 Morganella psychrotolerans cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
PMI_RS11085 PMI_RS11085 57.5 Proteus mirabilis HI4320 cysJ NADPH-dependent assimilatory sulfite reductase flavoprotein subunit

Distribution of the homologs in the orthogroup group_83

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_83

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N8L6 0.0 767 62 3 593 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B1IU77 0.0 754 61 2 600 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZQK7 0.0 754 61 2 600 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O139:H28 (strain E24377A / ETEC)
P38038 0.0 753 60 2 600 1 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli (strain K12)
Q31XM4 0.0 753 61 2 600 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella boydii serotype 4 (strain Sb227)
A8A3P5 0.0 753 60 2 600 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O9:H4 (strain HS)
Q3YY94 0.0 752 60 2 600 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella sonnei (strain Ss046)
Q8X7U1 0.0 752 60 2 600 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O157:H7
Q1R7T4 0.0 750 60 2 600 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli (strain UTI89 / UPEC)
Q8FEI7 0.0 750 60 2 600 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEA2 0.0 750 60 2 600 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AEV0 0.0 750 60 2 600 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Escherichia coli O1:K1 / APEC
A6TD49 0.0 745 60 1 599 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q83QD9 0.0 744 60 4 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella flexneri
Q0T1I8 0.0 744 60 4 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella flexneri serotype 5b (strain 8401)
Q32CG3 0.0 744 60 2 600 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shigella dysenteriae serotype 1 (strain Sd197)
A7MJ63 0.0 744 60 5 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Cronobacter sakazakii (strain ATCC BAA-894)
A8G9X6 0.0 737 60 3 600 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Serratia proteamaculans (strain 568)
A4WDW1 0.0 736 58 2 606 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Enterobacter sp. (strain 638)
Q8Z458 0.0 735 60 4 592 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella typhi
Q5PEH7 0.0 733 60 4 592 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57KH7 0.0 733 60 4 592 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella choleraesuis (strain SC-B67)
P38039 0.0 732 60 4 592 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6D1A1 0.0 731 58 4 609 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A9MF16 0.0 730 60 1 590 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q5NRM1 0.0 727 58 6 600 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A8ANX1 0.0 725 58 1 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A9N2E6 0.0 724 60 3 591 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
A1JJS2 0.0 716 59 2 601 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8ZBN6 0.0 712 59 2 606 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pestis
Q1C3Z0 0.0 712 59 2 606 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pestis bv. Antiqua (strain Antiqua)
Q66ED4 0.0 711 58 2 618 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TPY5 0.0 711 58 2 612 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pestis (strain Pestoides F)
Q1CLS8 0.0 711 58 2 612 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pestis bv. Antiqua (strain Nepal516)
A7FLZ0 0.0 710 58 2 612 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q2NVN4 0.0 703 57 2 603 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Sodalis glossinidius (strain morsitans)
Q1LTP1 0.0 662 52 2 600 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Baumannia cicadellinicola subsp. Homalodisca coagulata
P57503 0.0 597 46 3 604 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q65T53 0.0 581 48 4 596 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9JUD8 0.0 580 51 3 574 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9LZ73 0.0 579 51 3 576 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Neisseria meningitidis serogroup C (strain 053442)
Q9JS45 0.0 578 50 5 578 3 cysJ1 Sulfite reductase [NADPH] flavoprotein alpha-component Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8K9D3 0.0 577 45 1 592 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9KUX4 0.0 576 48 3 591 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3I4 0.0 573 48 3 591 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A1KU06 0.0 572 51 5 578 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q8DCK2 0.0 568 45 4 596 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio vulnificus (strain CMCP6)
Q7MHA5 0.0 567 45 4 596 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio vulnificus (strain YJ016)
Q87L90 0.0 563 46 4 597 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5E841 0.0 558 47 2 593 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q7VQH2 0.0 550 45 6 605 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Blochmanniella floridana
Q6LM58 0.0 549 46 4 599 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Photobacterium profundum (strain SS9)
Q0HFL6 0.0 541 45 6 598 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shewanella sp. (strain MR-4)
Q0HYB4 0.0 541 46 6 598 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shewanella sp. (strain MR-7)
Q8EAZ9 0.0 538 45 7 600 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A0KTH4 0.0 535 45 6 602 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Shewanella sp. (strain ANA-3)
O32214 2.86e-158 469 40 5 599 1 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Bacillus subtilis (strain 168)
Q54B10 9.17e-86 283 31 9 563 2 redA NADPH oxidoreductase A Dictyostelium discoideum
Q0J705 9.04e-74 253 31 18 612 1 CPR2 NADPH--cytochrome P450 reductase 2 Oryza sativa subsp. japonica
A0A2U1LIM9 1.11e-70 244 28 20 677 1 CPR1 NADPH--cytochrome P450 reductase 1 Artemisia annua
Q9SUM3 4.03e-70 243 30 17 609 1 ATR2 NADPH--cytochrome P450 reductase 2 Arabidopsis thaliana
A0A2U1KZS6 1.93e-69 241 30 18 611 3 CPR2 NADPH--cytochrome P450 reductase 2 Artemisia annua
Q7X7K8 7.29e-69 239 30 18 614 1 CPR1 NADPH--cytochrome P450 reductase 1 Oryza sativa subsp. japonica
C5YJG8 3.83e-68 237 31 14 555 1 CPR NADPH--cytochrome P450 reductase Sorghum bicolor
Q9SB48 1.57e-67 235 30 21 613 1 ATR1 NADPH--cytochrome P450 reductase 1 Arabidopsis thaliana
Q05001 4.76e-67 234 30 16 568 2 CPR NADPH--cytochrome P450 reductase Catharanthus roseus
Q653S9 4.91e-67 234 29 19 614 1 CPR3 NADPH--cytochrome P450 reductase 3 Oryza sativa subsp. japonica
P37116 2.13e-64 227 29 17 612 1 None NADPH--cytochrome P450 reductase Vigna radiata var. radiata
P37040 6.01e-64 225 29 21 606 1 Por NADPH--cytochrome P450 reductase Mus musculus
P16435 3.59e-63 223 29 23 606 1 POR NADPH--cytochrome P450 reductase Homo sapiens
P00388 1.65e-62 221 29 22 607 1 Por NADPH--cytochrome P450 reductase Rattus norvegicus
A0A7T9QPQ1 1.6e-61 219 30 16 565 2 CPR NADPH--cytochrome P450 reductase Piper nigrum
Q3SYT8 5.25e-61 217 28 23 607 2 POR NADPH--cytochrome P450 reductase Bos taurus
P52674 2.35e-60 212 36 6 336 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Thiocapsa roseopersicina
P52674 5.93e-43 164 47 2 160 3 cysJ Sulfite reductase [NADPH] flavoprotein alpha-component Thiocapsa roseopersicina
P37039 2.52e-60 216 28 20 604 2 Por NADPH--cytochrome P450 reductase Cavia porcellus
P04175 5.44e-60 214 29 22 606 1 POR NADPH--cytochrome P450 reductase Sus scrofa
P00389 1.72e-59 213 28 23 607 1 POR NADPH--cytochrome P450 reductase Oryctolagus cuniculus
Q55CT1 1.72e-59 213 28 18 612 2 redB NADPH--cytochrome P450 reductase Dictyostelium discoideum
O54705 5.65e-59 216 30 22 595 2 NOS2 Nitric oxide synthase, inducible Cavia porcellus
Q06518 5.84e-59 216 30 21 595 1 Nos2 Nitric oxide synthase, inducible Rattus norvegicus
Q07994 1.12e-58 211 28 22 607 2 None NADPH--cytochrome P450 reductase Musca domestica
Q27597 2.25e-58 210 28 23 627 1 Cpr NADPH--cytochrome P450 reductase Drosophila melanogaster
P35228 2.17e-57 212 30 23 596 1 NOS2 Nitric oxide synthase, inducible Homo sapiens
P29477 1.55e-56 209 29 21 600 1 Nos2 Nitric oxide synthase, inducible Mus musculus
Q6NRG5 1.99e-56 203 26 18 600 2 ndor1 NADPH-dependent diflavin oxidoreductase 1 Xenopus laevis
Q1JPJ0 1.01e-55 201 27 14 597 2 NDOR1 NADPH-dependent diflavin oxidoreductase 1 Bos taurus
A2AI05 1.13e-55 201 28 16 602 2 Ndor1 NADPH-dependent diflavin oxidoreductase 1 Mus musculus
Q26240 2.28e-55 206 27 20 651 2 None Nitric oxide synthase, salivary gland Rhodnius prolixus
P79290 4.42e-55 205 30 23 599 2 NOS2 Nitric oxide synthase, inducible Sus scrofa
P19618 1.18e-54 198 26 18 619 1 por NADPH--cytochrome P450 reductase (Fragments) Salmo trutta
O62699 1.4e-54 204 31 25 600 2 NOS2 Nitric oxide synthase, inducible Canis lupus familiaris
Q6PFP6 1.03e-53 196 27 14 591 2 ndor1 NADPH-dependent diflavin oxidoreductase 1 Danio rerio
Q9UHB4 1.31e-53 196 27 15 599 1 NDOR1 NADPH-dependent diflavin oxidoreductase 1 Homo sapiens
Q28314 2.75e-53 200 30 22 594 2 NOS2 Nitric oxide synthase, inducible Capra hircus
Q90703 9.88e-53 198 29 21 599 2 NOS2 Nitric oxide synthase, inducible Gallus gallus
O08394 6.97e-52 195 30 19 539 1 cypD Bifunctional cytochrome P450/NADPH--P450 reductase 1 Bacillus subtilis (strain 168)
Q27995 7.34e-52 196 30 23 594 2 NOS2 Nitric oxide synthase, inducible Bos taurus
A2QS05 1.99e-51 191 28 23 641 2 cprA NADPH--cytochrome P450 reductase Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q00141 7.18e-51 189 28 23 640 1 cprA NADPH--cytochrome P450 reductase Aspergillus niger
Q81BF4 2e-50 191 27 20 588 1 CYP102A5 Bifunctional cytochrome P450/NADPH--P450 reductase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P16603 3.96e-50 187 28 21 638 1 NCP1 NADPH--cytochrome P450 reductase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9Z0J4 1.66e-49 189 28 23 653 1 Nos1 Nitric oxide synthase 1 Mus musculus
Q54JL0 2.88e-49 184 27 19 577 2 redC NADPH-dependent diflavin oxidoreductase 1 Dictyostelium discoideum
P29476 3.93e-49 187 28 23 653 1 Nos1 Nitric oxide synthase 1 Rattus norvegicus
P29475 5.44e-49 187 28 23 653 1 NOS1 Nitric oxide synthase 1 Homo sapiens
Q0CMM0 7.03e-49 184 28 23 640 3 cprA NADPH--cytochrome P450 reductase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q2UHA7 1.17e-48 183 28 25 654 3 cprA NADPH--cytochrome P450 reductase Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q4WM67 4.69e-48 182 27 22 637 1 cprA NADPH--cytochrome P450 reductase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
O19132 5.47e-48 184 28 22 653 2 NOS1 Nitric oxide synthase 1 Oryctolagus cuniculus
O08336 1.27e-46 180 28 23 586 1 cypB Bifunctional cytochrome P450/NADPH--P450 reductase 2 Bacillus subtilis (strain 168)
P14779 2.81e-46 179 27 19 580 1 cyp102A1 Bifunctional cytochrome P450/NADPH--P450 reductase Priestia megaterium (strain ATCC 14581 / DSM 32 / CCUG 1817 / JCM 2506 / NBRC 15308 / NCIMB 9376 / NCTC 10342 / NRRL B-14308 / VKM B-512 / Ford 19)
O61608 5.28e-46 178 28 17 523 2 None Nitric oxide synthase Anopheles stephensi
P37201 1.16e-45 174 28 25 646 3 NCP1 NADPH--cytochrome P450 reductase Candida tropicalis
P50126 1.84e-45 174 26 22 626 2 NCP1 NADPH--cytochrome P450 reductase Candida maltosa
P29473 1.88e-45 176 28 22 646 1 NOS3 Nitric oxide synthase 3 Bos taurus
Q8T8C0 2.03e-45 176 30 21 530 2 NOS Nitric oxide synthase Bombyx mori
P29474 4.31e-45 175 27 21 646 1 NOS3 Nitric oxide synthase 3 Homo sapiens
Q5BFT5 1.41e-44 172 27 23 639 3 cprA NADPH--cytochrome P450 reductase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P70313 2.75e-44 173 27 20 645 1 Nos3 Nitric oxide synthase 3 Mus musculus
Q62600 1.03e-43 171 27 20 645 1 Nos3 Nitric oxide synthase 3 Rattus norvegicus
B1B557 1.1e-43 171 29 17 523 2 NSL Nitric oxide synthase-like protein Bombyx mori
B1B557 0.001 46 32 1 71 2 NSL Nitric oxide synthase-like protein Bombyx mori
Q6BR77 2.85e-43 167 25 19 605 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q9HDG2 7.05e-42 164 27 29 679 2 CPR NADPH--cytochrome P450 reductase Phanerodontia chrysosporium
Q29498 8.5e-42 166 30 20 530 2 NOS1 Nitric oxide synthase 1 Ovis aries
O19114 2.68e-41 159 33 14 371 2 NOS2 Nitric oxide synthase, inducible (Fragment) Oryctolagus cuniculus
Q6NPS8 3.01e-41 161 26 18 618 1 ATR3 NADPH-dependent diflavin oxidoreductase 1 Arabidopsis thaliana
Q94IN5 5.61e-41 163 26 23 574 1 PNO Pyruvate dehydrogenase [NADP(+)], mitochondrial Euglena gracilis
O94613 1.26e-40 159 25 21 598 3 tah18 NADPH-dependent diflavin oxidoreductase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9TUX8 4.66e-40 160 27 21 646 2 NOS3 Nitric oxide synthase 3 Canis lupus familiaris
Q27571 8.56e-40 159 29 22 525 1 Nos Nitric oxide synthase Drosophila melanogaster
Q9UBK8 8.08e-39 155 28 15 443 1 MTRR Methionine synthase reductase Homo sapiens
Q9UBK8 8.76e-08 58 27 3 148 1 MTRR Methionine synthase reductase Homo sapiens
P36587 9.95e-39 154 26 22 609 2 ccr1 NADPH--cytochrome P450 reductase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q28969 1.31e-38 156 26 21 646 1 NOS3 Nitric oxide synthase 3 Sus scrofa
Q8C1A3 3.12e-38 153 29 17 431 1 Mtrr Methionine synthase reductase Mus musculus
Q8C1A3 1.44e-10 67 28 5 180 1 Mtrr Methionine synthase reductase Mus musculus
Q4P3D8 4.87e-38 152 26 24 660 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Ustilago maydis (strain 521 / FGSC 9021)
P39692 8.6e-38 153 28 13 401 1 MET10 Sulfite reductase [NADPH] flavoprotein component Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5AD27 1.19e-37 150 25 22 605 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q4JIJ2 1.49e-37 151 28 15 421 2 MTRR Methionine synthase reductase Bos taurus
Q4JIJ2 3.32e-09 63 27 3 151 2 MTRR Methionine synthase reductase Bos taurus
Q498R1 4.55e-37 150 27 13 430 2 Mtrr Methionine synthase reductase Rattus norvegicus
Q498R1 5.43e-11 69 31 4 153 2 Mtrr Methionine synthase reductase Rattus norvegicus
I7ZK32 7.63e-35 144 29 22 547 1 CYP505C3 Self-sufficient cytochrome P450 monooxygenase CYP505C3 Aspergillus oryzae (strain 3.042)
Q09878 4.82e-34 142 28 16 453 3 SPCC584.01c Probable sulfite reductase [NADPH] flavoprotein component Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P97270 7.55e-34 141 26 15 563 2 NOS3 Nitric oxide synthase 3 Cavia porcellus
Q4HZQ1 1.54e-33 139 25 17 603 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A100IM63 3.62e-33 139 27 25 553 1 CYP505E5 Self-sufficient cytochrome P450 monooxygenase CYP505E5 Aspergillus niger
Q4WU59 4.26e-33 138 24 24 642 3 tah18 NADPH-dependent diflavin oxidoreductase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q5BB41 1.74e-32 136 23 22 639 3 tah18 NADPH-dependent diflavin oxidoreductase 1 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P79209 2.82e-32 136 26 22 649 2 NOS3 Nitric oxide synthase 3 Ovis aries
Q75B78 5.36e-32 134 24 26 627 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A2QLV1 1.64e-31 134 28 25 548 1 CYP505E1 Self-sufficient cytochrome P450 monooxygenase CYP505E1 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q6CCH0 2.76e-31 132 24 21 658 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
G7XMT1 3.98e-31 133 27 24 553 1 CYP505E5 Self-sufficient cytochrome P450 monooxygenase CYP505E5 Aspergillus kawachii (strain NBRC 4308)
Q9Y8G7 8.8e-31 132 27 22 563 1 CYP505 Bifunctional cytochrome P450/NADPH--P450 reductase Fusarium oxysporum
Q6CVG8 4.83e-30 128 24 26 633 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q968X7 7.08e-30 129 24 21 651 2 PFOR Pyruvate dehydrogenase [NADP(+)] Cryptosporidium parvum
A0A0A2J1Z6 1.44e-29 128 26 26 578 1 CYP505E4 Self-sufficient cytochrome P450 monooxygenase CYP505E4 Penicillium expansum
P0CP12 1.29e-28 124 27 11 376 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP12 1.44e-12 74 33 1 120 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP13 1.29e-28 124 27 11 376 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0CP13 1.44e-12 74 33 1 120 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q12181 3.23e-28 123 23 25 639 1 TAH18 NADPH-dependent diflavin oxidoreductase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O61309 1.6e-27 122 26 17 525 2 NOS Nitric oxide synthase Lymnaea stagnalis
A0A0C3HJL3 3.32e-27 120 27 26 596 1 CYP505AG1 Self-sufficient cytochrome P450 monooxygenase CYP505AG1 Oidiodendron maius (strain Zn)
A0A101MN42 7.89e-27 119 27 28 569 1 CYP505E4 Self-sufficient cytochrome P450 monooxygenase CYP505E4 Penicillium freii
Q0D1W9 1.24e-26 119 27 26 564 1 CYP505E3 Self-sufficient cytochrome P450 monooxygenase CYP505E3 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
R0IGL9 1.96e-26 118 27 29 590 1 CYP505U2 Self-sufficient cytochrome P450 monooxygenase CYP505U2 Exserohilum turcicum (strain 28A)
A0A455R5H4 1.98e-25 115 25 27 584 1 ascE Bifunctional cytochrome P450/NADPH--P450 reductase ascE Acremonium egyptiacum
A0A0G4P2K0 3.22e-25 114 26 23 548 1 CYP505E4 Self-sufficient cytochrome P450 monooxygenase CYP505E4 Penicillium camemberti (strain FM 013)
G5EJN7 1.26e-24 112 25 21 558 1 CYP505D6 Self-sufficient cytochrome P450 monooxygenase CYP505E3 Phanerodontia chrysosporium
G9MLG2 3.65e-24 111 25 25 588 1 CYP505P1 Self-sufficient cytochrome P450 monooxygenase CYP505P1 Hypocrea virens (strain Gv29-8 / FGSC 10586)
A0A3G9HRC2 1.29e-22 106 23 24 626 3 ALT2 Bifunctional cytochrome P450/NADPH--P450 reductase ALT2 Alternaria alternata
Q9HGE0 6.36e-22 104 26 25 611 2 FUM6 Bifunctional cytochrome P450/NADPH--P450 reductase Gibberella moniliformis (strain M3125 / FGSC 7600)
Q6FRH1 1.14e-21 102 25 19 405 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q6FRH1 2.29e-05 51 29 3 139 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q9S9P8 1.41e-21 100 31 12 253 1 RFNR2 Ferredoxin--NADP reductase, root isozyme 2, chloroplastic Arabidopsis thaliana
Q9US28 5.67e-20 97 28 9 252 3 SPAC1783.01 Uncharacterized FAD-binding protein C1783.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q2UNA2 1.07e-19 97 24 26 570 2 CYP505A3 Bifunctional cytochrome P450/NADPH--P450 reductase Aspergillus oryzae (strain ATCC 42149 / RIB 40)
O04397 1.09e-19 94 30 11 236 2 None Ferredoxin--NADP reductase, root-type isozyme, chloroplastic Nicotiana tabacum
Q41014 1.19e-18 91 29 9 237 2 None Ferredoxin--NADP reductase, root isozyme, chloroplastic Pisum sativum
Q8W493 3.95e-18 90 29 9 235 1 LFNR2 Ferredoxin--NADP reductase, leaf isozyme 2, chloroplastic Arabidopsis thaliana
Q9M0V6 8.56e-18 89 30 12 253 2 RFNR1 Ferredoxin--NADP reductase, root isozyme 1, chloroplastic Arabidopsis thaliana
P41345 1.5e-17 88 31 13 253 1 Os03g0784700 Ferredoxin--NADP reductase, root isozyme, chloroplastic Oryza sativa subsp. japonica
Q17574 3.15e-17 89 25 15 400 3 mtrr-1 Methionine synthase reductase Caenorhabditis elegans
Q17574 6.98e-07 56 25 4 170 3 mtrr-1 Methionine synthase reductase Caenorhabditis elegans
Q09744 4.29e-17 88 24 12 399 3 SPBC12C2.03c Uncharacterized FAD-binding protein C12C2.03c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O23877 4.57e-17 87 30 11 237 1 Os07g0147900 Ferredoxin--NADP reductase, embryo isozyme, chloroplastic Oryza sativa subsp. japonica
Q6ZFJ3 1.15e-16 85 28 11 234 1 LFNR2 Ferredoxin--NADP reductase, leaf isozyme 2, chloroplastic Oryza sativa subsp. japonica
A2WZT1 1.59e-16 85 28 11 234 3 OsI_05475 Ferredoxin--NADP reductase, leaf isozyme 2, chloroplastic Oryza sativa subsp. indica
P10933 6.41e-16 83 29 10 235 1 PETH Ferredoxin--NADP reductase, leaf isozyme, chloroplastic Pisum sativum
P41346 6.91e-16 83 29 12 237 2 PETH Ferredoxin--NADP reductase, chloroplastic Vicia faba
O04977 1.16e-15 82 29 10 235 2 PETH Ferredoxin--NADP reductase, leaf-type isozyme, chloroplastic Nicotiana tabacum
P53991 2.5e-15 81 28 9 235 1 PETH Ferredoxin--NADP reductase, chloroplastic Chlamydomonas reinhardtii
A2Y8E0 3.48e-15 80 27 10 235 3 OsI_21320 Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic Oryza sativa subsp. indica
P41344 5.79e-15 80 27 10 235 1 LFNR1 Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic Oryza sativa subsp. japonica
Q55318 8.32e-15 80 26 10 234 1 petH Ferredoxin--NADP reductase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9FKW6 8.81e-15 79 26 8 234 1 LFNR1 Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic Arabidopsis thaliana
P00454 9.61e-15 78 27 10 250 1 petH Ferredoxin--NADP reductase Spirulina sp.
P31973 1.87e-14 79 27 8 235 1 petH Ferredoxin--NADP reductase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P21890 2.55e-14 79 28 10 239 1 petH Ferredoxin--NADP reductase Nostoc sp. (strain ATCC 29151 / PCC 7119)
Q44549 3.21e-14 78 28 10 239 3 petH Ferredoxin--NADP reductase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P58558 3.3e-14 78 28 10 239 3 petH Ferredoxin--NADP reductase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q00598 3.51e-14 77 26 10 234 1 PETH Ferredoxin--NADP reductase, cyanelle Cyanophora paradoxa
P00455 4.04e-14 77 28 12 237 1 PETH Ferredoxin--NADP reductase, chloroplastic Spinacia oleracea
Q93RE3 4.32e-14 77 27 11 236 3 petH Ferredoxin--NADP reductase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P41343 9.38e-12 70 25 9 234 2 PETH Ferredoxin--NADP reductase, chloroplastic Mesembryanthemum crystallinum
Q92091 1.12e-11 70 23 6 256 2 nos2 Nitric oxide synthase, inducible (Fragment) Oncorhynchus mykiss
O34737 5.15e-10 62 32 3 150 3 ykuN Probable flavodoxin 1 Bacillus subtilis (strain 168)
Q9KVY6 6.08e-10 61 32 3 139 3 mioC Protein MioC homolog Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P58208 6.89e-10 61 28 4 148 3 mioC Protein MioC Escherichia coli O157:H7
Q47418 9.47e-10 60 32 3 146 3 None Flavodoxin YqcA Pectobacterium carotovorum subsp. carotovorum
P03817 9.65e-10 60 28 4 148 1 mioC Protein MioC Escherichia coli (strain K12)
P44813 1.24e-09 60 29 3 147 3 mioC Protein MioC homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9AIX6 1.54e-09 63 27 8 227 1 boxA Benzoyl-CoA oxygenase component A Aromatoleum evansii
P47169 1.48e-08 61 26 7 221 1 MET5 Sulfite reductase [NADPH] subunit beta Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8RXN5 5.33e-08 59 26 3 164 2 TYW1 S-adenosyl-L-methionine-dependent tRNA 4-demethylwyosine synthase Arabidopsis thaliana
P65369 6.37e-08 55 31 2 116 3 yqcA Uncharacterized protein YqcA Shigella flexneri
P65367 6.37e-08 55 31 2 116 1 yqcA Flavodoxin YqcA Escherichia coli (strain K12)
P65368 6.37e-08 55 31 2 116 3 yqcA Uncharacterized protein YqcA Escherichia coli O157:H7
Q9KMY3 2.18e-07 57 27 5 151 1 hmp Flavohemoprotein Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A9FRJ0 2.82e-07 55 26 8 174 1 sce5135 Ferredoxin--NADP reductase B Sorangium cellulosum (strain So ce56)
Q9NV66 3.2e-07 57 28 3 138 1 TYW1 S-adenosyl-L-methionine-dependent tRNA 4-demethylwyosine synthase TYW1 Homo sapiens
Q92037 3.73e-07 53 30 2 98 2 nos2 Nitric oxide synthase, inducible (Fragment) Carassius auratus
Q5REF9 4.08e-07 57 28 3 138 2 TYW1 S-adenosyl-L-methionine-dependent tRNA 4-demethylwyosine synthase TYW1 Pongo abelii
Q2KHP8 1.21e-06 55 28 3 138 2 tyw1 S-adenosyl-L-methionine-dependent tRNA 4-demethylwyosine synthase TYW1 Xenopus laevis
Q8BJM7 1.24e-06 55 27 3 152 1 Tyw1 S-adenosyl-L-methionine-dependent tRNA 4-demethylwyosine synthase TYW1 Mus musculus
Q9L6A2 3.84e-06 50 32 4 111 3 mioC Protein MioC homolog Pasteurella multocida (strain Pm70)
Q01095 0.000106 46 30 4 143 1 None Flavodoxin Megalodesulfovibrio gigas (strain ATCC 19364 / DSM 1382 / NCIMB 9332 / VKM B-1759)
P26492 0.000165 45 25 1 145 1 None Flavodoxin Desulfovibrio desulfuricans
O34589 0.000176 45 27 2 120 3 ykuP Probable flavodoxin 2 Bacillus subtilis (strain 168)
Q9I9M2 0.000499 45 24 3 157 2 None Nitric oxide synthase (Fragment) Squalus acanthias
Q7MH09 0.000724 45 26 6 152 3 hmp Flavohemoprotein Vibrio vulnificus (strain YJ016)
P18086 0.000865 43 31 2 113 3 Desal_0805 Flavodoxin Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q8DCU2 0.000878 45 26 6 152 3 hmp Flavohemoprotein Vibrio vulnificus (strain CMCP6)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_07380
Feature type CDS
Gene cysJ
Product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit
Location 211304 - 213100 (strand: 1)
Length 1797 (nucleotides) / 598 (amino acids)

Contig

Accession ZDB_216
Length 269970 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_83
Orthogroup size 12
N. genomes 7

Actions

Genomic region

Domains

PF00175 Oxidoreductase NAD-binding domain
PF00258 Flavodoxin
PF00667 FAD binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0369 Nucleotide transport and metabolism (F)
Inorganic ion transport and metabolism (P)		 FP Flavoprotein (flavin reductase) subunit CysJ of sulfite and N-hydroxylaminopurine reductases

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00380 sulfite reductase (NADPH) flavoprotein alpha-component [EC:1.8.1.2] Sulfur metabolism
Metabolic pathways
Microbial metabolism in diverse environments		 Assimilatory sulfate reduction, sulfate => H2S

Protein Sequence

MAAQILPEQVFPVSAEQLAALQTVTADFTSQQLAWLSGYLWGRGNTSVQTAILPASNTTDSDIITIISASQTGNARRVCEELKTRFLSEKFVVNLVNAGEYKYKQLAREKIVIIVTSTQGDGEPPEEAVAFYKYLHSSKRPDLSGTAYAVFSLGDSSYEKFCQAGIDFDTQLRKAGATELVPRADADVDYQPAAAAWTDALTQVLKERGIAAGDPSQTTAQAVSVTENRYSKDTPLTASLSVNQKITGRNSLKDVRHIEISAGDSGLHYQPGDSLGVWFENDPALADEIISLLHADAATEITVSGNTCTLREALIRHLELTQNNGVTVSKYAQLSQHDALSALISDKQAALHYAQKTPVAEMLRQAPSRPSAQAFAGILRPLTPRLYSISSSQAEADDEIHLTVGVVRYDADGRARTGGASGFLADHIQEGGDVRVFIEPNDNFRLPADPDVPVIMIGAGTGIAPFRAFMQQRENDGASGKNWLFYGNQHFTEDFLYQTEWQRYVRDGVLTQISLAWSRDKPAKTYVQDKLREQGADVWRWIEDGAHIYVCGNAGLMARDTEDALLEIISRYGNRDHESADEFLSELRTARRYQRDVY

Flanking regions ( +/- flanking 50bp)

GGAAATAACGGAATAATAACCACAATGAGCAATGCGGGAGTAACAGGACTATGGCAGCACAGATATTACCGGAACAGGTATTTCCGGTTTCTGCGGAGCAGCTTGCGGCTTTGCAGACGGTAACAGCAGATTTTACCTCTCAGCAACTGGCCTGGTTATCCGGTTATTTGTGGGGACGGGGAAATACGTCTGTGCAGACAGCTATTCTACCGGCATCAAATACAACAGACAGTGACATTATTACCATTATTTCCGCGTCACAAACCGGTAATGCACGTCGCGTATGTGAAGAATTAAAAACGCGTTTCCTCAGTGAGAAATTCGTGGTTAATTTGGTAAACGCCGGAGAATATAAATATAAACAGCTCGCCCGGGAGAAGATTGTCATTATTGTGACATCCACTCAGGGGGACGGTGAACCACCGGAAGAAGCGGTGGCGTTTTATAAATATCTGCATTCATCAAAACGCCCGGATCTCAGCGGAACAGCGTATGCCGTTTTCTCGCTGGGCGATTCGTCATACGAAAAATTCTGTCAGGCGGGTATTGATTTTGATACTCAGCTGAGAAAAGCCGGCGCAACCGAACTTGTGCCGAGAGCGGATGCGGATGTGGATTATCAGCCTGCGGCAGCGGCGTGGACAGACGCACTGACACAGGTGCTGAAAGAGAGGGGGATTGCGGCGGGAGATCCATCGCAGACTACCGCTCAGGCAGTCAGTGTCACTGAAAACCGTTACAGCAAAGACACACCGCTGACAGCATCTCTCTCTGTTAATCAGAAAATTACCGGCCGCAATTCCCTGAAAGATGTGCGGCATATTGAAATTTCCGCAGGGGATTCCGGTCTGCATTATCAGCCCGGGGATTCCCTCGGGGTCTGGTTTGAGAATGATCCGGCACTGGCGGATGAAATTATCAGCCTGCTGCATGCCGATGCGGCAACGGAGATCACAGTGTCCGGCAATACCTGCACATTGCGGGAGGCGCTGATCCGGCATCTGGAGCTCACACAGAATAACGGAGTGACGGTCAGCAAATACGCGCAGTTATCGCAGCATGACGCGTTATCCGCCCTGATCAGTGATAAGCAGGCCGCGCTGCATTATGCGCAGAAAACACCTGTCGCGGAAATGCTGCGTCAGGCGCCTTCCCGGCCTTCAGCGCAGGCTTTTGCCGGTATTCTCCGGCCATTGACCCCGAGGCTCTATTCCATCTCATCATCACAGGCGGAAGCGGACGATGAAATTCATCTGACCGTCGGCGTGGTGCGTTATGACGCGGATGGCCGGGCGCGGACCGGCGGGGCTTCCGGGTTTCTCGCCGATCATATACAGGAGGGCGGGGATGTGCGGGTCTTCATTGAACCTAATGATAACTTCCGCCTGCCAGCCGACCCGGATGTGCCGGTCATTATGATCGGTGCAGGCACCGGTATTGCGCCGTTCCGTGCCTTTATGCAGCAGCGGGAAAATGACGGTGCCTCCGGTAAAAACTGGCTTTTCTACGGTAATCAGCATTTTACCGAGGATTTTCTGTATCAGACCGAATGGCAGCGCTATGTGCGTGATGGTGTGCTGACCCAGATCTCGCTGGCCTGGTCGCGGGATAAACCGGCGAAAACCTATGTTCAGGACAAGCTGCGCGAGCAGGGAGCGGACGTATGGCGCTGGATTGAGGACGGCGCACATATTTATGTCTGCGGTAATGCGGGCCTGATGGCCCGTGATACCGAAGATGCATTACTGGAGATCATCAGCCGGTACGGTAACCGGGATCATGAATCAGCCGATGAGTTTTTAAGTGAGCTGCGCACAGCGCGCCGGTACCAGAGGGATGTCTATTAATGAGCGATAAACACAACGGGCCTTTAATCGTGGAAGGCAAACTGAGCGAC