Homologs in group_30

Help

14 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02780 FBDBKF_02780 100.0 Morganella morganii S1 lysR DNA-binding transcriptional regulator, LysR family
NLDBIP_00210 NLDBIP_00210 100.0 Morganella morganii S4 lysR DNA-binding transcriptional regulator, LysR family
LHKJJB_01825 LHKJJB_01825 100.0 Morganella morganii S3 lysR DNA-binding transcriptional regulator, LysR family
HKOGLL_01865 HKOGLL_01865 100.0 Morganella morganii S5 lysR DNA-binding transcriptional regulator, LysR family
F4V73_RS01700 F4V73_RS01700 18.6 Morganella psychrotolerans - LysR family transcriptional regulator
F4V73_RS03270 F4V73_RS03270 26.0 Morganella psychrotolerans - LysR family transcriptional regulator
F4V73_RS04355 F4V73_RS04355 27.6 Morganella psychrotolerans - LysR family transcriptional regulator
F4V73_RS05245 F4V73_RS05245 79.7 Morganella psychrotolerans - LysR substrate-binding domain-containing protein
F4V73_RS05520 F4V73_RS05520 25.4 Morganella psychrotolerans - LysR family transcriptional regulator
F4V73_RS06440 F4V73_RS06440 17.5 Morganella psychrotolerans - LysR substrate-binding domain-containing protein
F4V73_RS10230 F4V73_RS10230 40.8 Morganella psychrotolerans - LysR family transcriptional regulator
F4V73_RS13185 F4V73_RS13185 25.5 Morganella psychrotolerans - LysR family transcriptional regulator
F4V73_RS13375 F4V73_RS13375 17.6 Morganella psychrotolerans - LysR family transcriptional regulator
PMI_RS03935 PMI_RS03935 43.6 Proteus mirabilis HI4320 yafC DNA-binding transcriptional regulator YafC

Distribution of the homologs in the orthogroup group_30

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_30

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q9JPU9 2.16e-87 266 46 0 291 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup C (strain 8013)
Q9JXW7 4.56e-85 260 45 0 291 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P30864 3.88e-81 250 42 0 292 3 yafC Uncharacterized HTH-type transcriptional regulator YafC Escherichia coli (strain K12)
A0A0H2ZDG9 4.96e-38 139 30 3 290 3 PA14_22550 HTH-type transcriptional repressor PA14_22550 Pseudomonas aeruginosa (strain UCBPP-PA14)
P52689 1.32e-37 138 29 3 290 3 ltrA Probable HTH-type transcriptional regulator LtrA Klebsiella pneumoniae
P43011 5.06e-33 125 29 4 271 3 HI_1364 Uncharacterized HTH-type transcriptional regulator HI_1364 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45463 5.11e-30 118 28 5 299 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain K12)
Q8XBK9 9.63e-30 117 28 5 299 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O157:H7
P67662 1.03e-29 117 27 6 308 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli (strain K12)
P67663 1.03e-29 117 27 6 308 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P67664 1.03e-29 117 27 6 308 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O157:H7
Q1R6S1 1.36e-29 117 28 5 299 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain UTI89 / UPEC)
Q8FDH0 1.36e-29 117 28 5 299 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TD46 2.77e-29 116 28 5 299 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P76250 5.67e-28 112 29 6 294 1 dmlR HTH-type transcriptional regulator DmlR Escherichia coli (strain K12)
P37641 9.06e-27 109 27 2 288 3 yhjC Uncharacterized HTH-type transcriptional regulator YhjC Escherichia coli (strain K12)
P75836 1.54e-25 106 26 6 304 3 ycaN Uncharacterized HTH-type transcriptional regulator YcaN Escherichia coli (strain K12)
Q01610 1.87e-21 95 27 6 279 3 PA2220 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P77333 2.81e-19 89 27 6 274 1 pgrR HTH-type transcriptional regulator PgrR Escherichia coli (strain K12)
P72131 1.06e-17 85 27 5 297 1 ptxR HTH-type transcriptional regulator PtxR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0ACR4 5.48e-16 79 23 7 309 1 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli (strain K12)
P0ACR5 5.48e-16 79 23 7 309 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACR6 5.48e-16 79 23 7 309 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O157:H7
P70785 7.96e-13 70 24 6 283 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
P96725 9.17e-13 70 22 7 292 3 ywqM Uncharacterized HTH-type transcriptional regulator YwqM Bacillus subtilis (strain 168)
P25544 1.17e-12 70 25 9 316 3 rbcR RuBisCO operon transcriptional regulator Allochromatium vinosum
P44821 1.28e-12 70 25 8 251 3 ilvY HTH-type transcriptional activator IlvY Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4G384 2.44e-12 69 30 0 126 3 rbcR Probable RuBisCO transcriptional regulator Emiliania huxleyi
P55576 6.67e-12 68 24 7 295 3 NGR_a02420 Uncharacterized HTH-type transcriptional regulator y4mQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q57748 8.56e-12 67 26 3 191 3 MJ0300 Uncharacterized HTH-type transcriptional regulator MJ0300 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P0C6D1 9.94e-12 67 25 3 199 3 irgB Iron-regulated virulence regulatory protein IrgB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F9F9 1e-11 67 25 3 199 3 irgB Iron-regulated virulence regulatory protein IrgB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q85G62 1.23e-11 67 30 0 126 3 rbcR Probable RuBisCO transcriptional regulator Cyanidioschyzon merolae (strain NIES-3377 / 10D)
P37459 1.51e-11 67 23 2 192 3 sinR Probable HTH-type transcriptional regulator SinR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P27111 1.67e-11 67 28 2 149 1 cynR HTH-type transcriptional regulator CynR Escherichia coli (strain K12)
P0A9G1 1.83e-11 67 24 6 255 3 metR HTH-type transcriptional regulator MetR Shigella flexneri
P0A9F9 1.83e-11 67 24 6 255 1 metR HTH-type transcriptional regulator MetR Escherichia coli (strain K12)
P0A9G0 1.83e-11 67 24 6 255 3 metR HTH-type transcriptional regulator MetR Escherichia coli O157:H7
O34685 1.87e-11 66 24 6 286 1 yofA HTH-type transcriptional regulator YofA Bacillus subtilis (strain 168)
P45099 2.39e-11 66 24 4 257 3 gcvA Glycine cleavage system transcriptional activator homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6HPH4 6.92e-11 65 29 3 148 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63H01 7.05e-11 65 29 3 148 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ZK / E33L)
Q73EY2 7.05e-11 65 29 3 148 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81VJ1 7.05e-11 65 29 3 148 3 czcR HTH-type transcriptional regulator CzcR Bacillus anthracis
Q81IX0 7.4e-11 65 29 3 148 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8X4M5 8.12e-11 65 29 2 142 3 cynR HTH-type transcriptional regulator CynR Escherichia coli O157:H7
A0R8S0 8.7e-11 65 29 3 148 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis (strain Al Hakam)
P77309 1.13e-10 64 25 7 244 3 yneJ Uncharacterized HTH-type transcriptional regulator YneJ Escherichia coli (strain K12)
A7Z5E4 1.82e-10 63 28 4 147 3 yofA HTH-type transcriptional regulator YofA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P48271 1.84e-10 64 32 0 123 3 rbcR Probable RuBisCO transcriptional regulator Cyanophora paradoxa
P52669 2.67e-10 63 29 1 143 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
P0A2Q4 2.87e-10 63 24 5 254 3 metR HTH-type transcriptional regulator MetR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q5 2.87e-10 63 24 5 254 3 metR HTH-type transcriptional regulator MetR Salmonella typhi
P52696 5.62e-10 62 26 6 165 3 ybhD Uncharacterized HTH-type transcriptional regulator YbhD Escherichia coli (strain K12)
P0A9F6 8.51e-10 62 24 5 291 1 gcvA Glycine cleavage system transcriptional activator Escherichia coli (strain K12)
P0A9F7 8.51e-10 62 24 5 291 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F8 8.51e-10 62 24 5 291 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O157:H7
Q1XDT2 1.22e-09 61 32 2 125 3 rbcR Probable RuBisCO transcriptional regulator Neopyropia yezoensis
O32255 1.41e-09 61 27 2 133 3 yvbU Uncharacterized HTH-type transcriptional regulator YvbU Bacillus subtilis (strain 168)
P51205 1.68e-09 61 32 2 128 3 rbcR Probable RuBisCO transcriptional regulator Porphyra purpurea
P39647 1.83e-09 61 26 0 119 1 cysL HTH-type transcriptional regulator CysL Bacillus subtilis (strain 168)
A0T0G2 1.89e-09 61 28 2 149 3 rbcR Probable RuBisCO transcriptional regulator Phaeodactylum tricornutum (strain CCAP 1055/1)
P14145 2.03e-09 60 25 7 245 3 ampR HTH-type transcriptional activator AmpR Rhodobacter capsulatus
P77744 2.27e-09 60 20 1 145 3 abgR HTH-type transcriptional regulator AbgR Escherichia coli (strain K12)
A2CI69 2.28e-09 60 28 1 150 3 rbcR Probable RuBisCO transcriptional regulator Chlorokybus atmophyticus
Q6B936 3.52e-09 60 30 0 123 3 rbcR Probable RuBisCO transcriptional regulator Gracilaria tenuistipitata var. liui
P73123 7.07e-09 59 25 10 307 3 rbcR Probable RuBisCO transcriptional regulator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P52691 1.26e-08 58 27 4 194 3 lrrA Probable HTH-type transcriptional regulator LrrA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P24734 1.27e-08 58 27 6 240 1 ampR HTH-type transcriptional activator AmpR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q44311 1.33e-08 58 26 4 148 3 soxR HTH-type transcriptional regulator SoxR Arthrobacter sp. (strain TE1826)
O19892 1.61e-08 58 28 0 123 3 rbcR Probable RuBisCO transcriptional regulator Cyanidium caldarium
O78432 2.3e-08 57 28 0 126 3 rbcR Probable RuBisCO transcriptional regulator Guillardia theta
A4QH19 2.63e-08 57 27 1 156 1 shiR HTH-type transcriptional regulator ShiR Corynebacterium glutamicum (strain R)
P46068 2.89e-08 57 29 6 191 2 dsdC HTH-type transcriptional regulator DsdC Escherichia coli (strain K12)
P94403 3.14e-08 57 29 4 145 3 bsdA HTH-type transcriptional regulator BsdA Bacillus subtilis (strain 168)
P42507 3.17e-08 57 24 1 169 3 hvrB AhcY transcriptional activator HvrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P76369 3.73e-08 57 29 0 128 3 yeeY Uncharacterized HTH-type transcriptional regulator YeeY Escherichia coli (strain K12)
Q8KA72 4.15e-08 57 22 4 208 3 metR HTH-type transcriptional regulator MetR Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9X5P2 4.47e-08 57 32 4 142 2 oxyR Probable hydrogen peroxide-inducible genes activator Streptomyces viridosporus
P20668 4.5e-08 57 28 0 124 1 gltC Transcriptional dual regulator GltC Bacillus subtilis (strain 168)
Q3MCB5 6.69e-08 56 26 0 126 3 rbcR Probable RuBisCO transcriptional regulator Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YQ82 6.75e-08 56 26 0 126 3 rbcR Probable RuBisCO transcriptional regulator Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P52658 7.42e-08 56 21 7 297 3 ampR HTH-type transcriptional activator AmpR Citrobacter koseri
Q04778 1.28e-07 55 20 7 296 3 alsR HTH-type transcriptional regulator AlsR Bacillus subtilis (strain 168)
P0ACR8 1.56e-07 55 26 5 179 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Shigella flexneri
P0ACR7 1.56e-07 55 26 5 179 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Escherichia coli (strain K12)
P05051 1.62e-07 55 24 3 244 3 ampR HTH-type transcriptional activator AmpR Enterobacter cloacae
P77700 1.97e-07 55 24 9 259 1 yahB Uncharacterized HTH-type transcriptional regulator YahB Escherichia coli (strain K12)
P77559 2.21e-07 54 24 6 247 3 ynfL Uncharacterized HTH-type transcriptional regulator YnfL Escherichia coli (strain K12)
P52678 2.35e-07 54 27 1 144 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium leprae (strain TN)
P52666 3.11e-07 54 29 3 148 3 budR HTH-type transcriptional regulator BudR Raoultella terrigena
P52662 3.59e-07 54 25 6 255 3 pecT HTH-type transcriptional regulator PecT Dickeya dadantii (strain 3937)
P12529 3.72e-07 54 24 2 235 1 ampR HTH-type transcriptional activator AmpR Citrobacter freundii
P52676 4.69e-07 53 23 2 201 3 nmcR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Enterobacter cloacae
O68014 5.35e-07 53 27 5 174 1 benM HTH-type transcriptional regulator BenM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q9HWH8 5.38e-07 53 28 1 126 3 nmoR HTH-type transcriptional regulator NmoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P55181 6.34e-07 53 24 0 122 3 yxjO Uncharacterized HTH-type transcriptional regulator YxjO Bacillus subtilis (strain 168)
P74422 7.13e-07 53 31 1 123 3 ntcB Probable nitrogen assimilation transcriptional activator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O87883 2.25e-06 50 26 2 182 3 oxyR Probable hydrogen peroxide-inducible genes activator (Fragment) Mycobacterium xenopi
Q5N5I5 2.27e-06 52 24 12 321 3 cmpR HTH-type transcriptional activator CmpR Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q9F1R2 2.27e-06 52 24 12 321 1 cmpR HTH-type transcriptional activator CmpR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q47005 2.89e-06 51 25 3 162 3 nac Nitrogen assimilation regulatory protein nac Escherichia coli (strain K12)
O34701 3.64e-06 51 20 8 285 3 yoaU Uncharacterized HTH-type transcriptional regulator YoaU Bacillus subtilis (strain 168)
P0ACR0 3.85e-06 51 27 3 144 1 allS HTH-type transcriptional activator AllS Escherichia coli (strain K12)
P0ACR1 3.85e-06 51 27 3 144 3 allS HTH-type transcriptional activator AllS Escherichia coli O157:H7
P07774 4.97e-06 50 25 2 143 1 catM HTH-type transcriptional regulator CatM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P0A9F3 5.39e-06 50 25 13 257 3 cysB HTH-type transcriptional regulator CysB Escherichia coli (strain K12)
P0A9F4 5.39e-06 50 25 13 257 3 cysB HTH-type transcriptional regulator CysB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F5 5.39e-06 50 25 13 257 3 cysB HTH-type transcriptional regulator CysB Escherichia coli O157:H7
P94387 5.64e-06 50 26 6 188 3 ycgK Uncharacterized HTH-type transcriptional regulator YcgK Bacillus subtilis (strain 168)
Q57S50 7.12e-06 50 27 6 181 3 allS HTH-type transcriptional activator AllS Salmonella choleraesuis (strain SC-B67)
P71318 7.46e-06 50 21 5 316 3 oxyR Hydrogen peroxide-inducible genes activator Pectobacterium carotovorum subsp. carotovorum
P94501 8.27e-06 50 22 2 155 1 gltR HTH-type transcriptional regulator GltR Bacillus subtilis (strain 168)
Q8FK66 8.98e-06 50 27 3 144 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKD7 8.98e-06 50 27 3 144 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P52677 9.85e-06 50 28 0 125 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium avium
Q9S4Y7 1.01e-05 50 27 3 137 3 allS HTH-type transcriptional activator AllS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PCH2 1.01e-05 50 27 3 137 3 allS HTH-type transcriptional activator AllS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P16931 1.08e-05 49 27 1 125 3 dgdR HTH-type transcriptional regulator DgdR Burkholderia cepacia
P96194 1.1e-05 47 29 0 104 3 None Uncharacterized HTH-type transcriptional regulator in ibpB-leuC intergenic region Azotobacter vinelandii
Q1RF30 1.32e-05 49 27 3 144 3 allS HTH-type transcriptional activator AllS Escherichia coli (strain UTI89 / UPEC)
A1A8H0 1.32e-05 49 27 3 144 3 allS HTH-type transcriptional activator AllS Escherichia coli O1:K1 / APEC
P9WMF7 1.66e-05 49 28 5 159 1 Rv0377 Uncharacterized HTH-type transcriptional regulator Rv0377 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF6 1.66e-05 49 28 5 159 3 MT0391 Uncharacterized HTH-type transcriptional regulator MT0391 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P52683 2.05e-05 48 23 2 201 3 smeR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Serratia marcescens
Q57083 2.5e-05 48 25 4 200 1 perR HTH-type transcriptional regulator PerR Escherichia coli (strain K12)
P52686 2.86e-05 48 26 0 123 3 sdsB SDS degradation transcriptional activation protein Pseudomonas sp. (strain ATCC 19151)
Q08597 3.09e-05 48 25 2 148 3 nac Nitrogen assimilation regulatory protein nac Klebsiella aerogenes
P45600 3.34e-05 48 24 12 253 1 cysB HTH-type transcriptional regulator CysB Klebsiella pneumoniae
P52660 3.47e-05 48 26 2 149 3 blaA HTH-type transcriptional regulator BlaA Proteus vulgaris
P06614 4.58e-05 48 25 12 251 1 cysB HTH-type transcriptional regulator CysB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z8R3 4.82e-05 47 27 3 137 3 allS HTH-type transcriptional activator AllS Salmonella typhi
P67668 5.25e-05 47 26 5 190 3 BQ2027_MB2303C Uncharacterized HTH-type transcriptional regulator Mb2303c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMF3 5.25e-05 47 26 5 190 1 Rv2282c Uncharacterized HTH-type transcriptional regulator Rv2282c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF2 5.25e-05 47 26 5 190 3 MT2340 Uncharacterized HTH-type transcriptional regulator MT2340 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q05840 7.04e-05 47 22 10 301 3 clcR HTH-type transcriptional regulator ClcR Pseudomonas putida
Q9X725 0.000101 47 21 6 312 3 oxyR Hydrogen peroxide-inducible genes activator Dickeya chrysanthemi
P45349 0.000105 46 26 1 131 3 metR HTH-type transcriptional regulator MetR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q00678 0.00013 46 27 0 120 3 nocR Regulatory protein NocR Agrobacterium fabrum (strain C58 / ATCC 33970)
P11720 0.000132 46 24 5 215 1 trpI HTH-type transcriptional regulator TrpI Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P33634 0.000152 46 20 8 293 3 yfiE Uncharacterized HTH-type transcriptional regulator YfiE Escherichia coli (strain K12)
P94678 0.000182 45 32 0 80 1 tsaR HTH-type transcriptional regulator TsaR Comamonas testosteroni
B4E8V9 0.00019 45 20 5 248 1 cysB HTH-type transcriptional regulator CysB Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
P52661 0.000283 45 25 2 127 1 gbpR HTH-type transcriptional regulator GbpR Azospirillum brasilense
P0ACQ4 0.000298 45 22 1 139 1 oxyR DNA-binding transcriptional dual regulator OxyR Escherichia coli (strain K12)
P0ACQ5 0.000298 45 22 1 139 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACQ6 0.000298 45 22 1 139 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O157:H7
P39592 0.000365 45 22 0 125 3 ywbI Uncharacterized HTH-type transcriptional regulator YwbI Bacillus subtilis (strain 168)
P34818 0.00043 45 27 6 180 3 trpI HTH-type transcriptional regulator TrpI Pseudomonas syringae pv. syringae
O69772 0.000449 44 28 7 188 3 ampR HTH-type transcriptional activator AmpR Providencia stuartii
P36771 0.000477 44 27 3 181 1 lrhA Probable HTH-type transcriptional regulator LrhA Escherichia coli (strain K12)
P35112 0.000477 44 26 0 129 3 nocR Regulatory protein NocR Agrobacterium tumefaciens (strain T37)
Q46M54 0.000483 44 28 0 80 1 tfdS HTH-type transcriptional regulator TfdS Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46M57 0.000501 44 28 0 80 1 tfdR HTH-type transcriptional regulator TdfR Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q8VWE6 0.000508 44 30 1 126 3 lrhA Probable HTH-type transcriptional regulator LrhA Escherichia coli O157:H7
P45105 0.000523 44 22 11 253 3 cysB HTH-type transcriptional regulator CysB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P67660 0.000534 44 32 0 77 1 yhaJ Probable HTH-type transcriptional regulator YhaJ Escherichia coli (strain K12)
P67661 0.000534 44 32 0 77 1 yhaJ HTH-type transcriptional regulator YhaJ Escherichia coli O157:H7
P77171 0.000548 44 24 2 160 3 ydcI Uncharacterized HTH-type transcriptional regulator YdcI Escherichia coli (strain K12)
P42722 0.000563 44 22 6 302 3 cfxR HTH-type transcriptional regulator CfxR Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P45461 0.000667 44 25 3 153 3 ampR HTH-type transcriptional activator AmpR Yersinia enterocolitica
P52665 0.000667 42 28 1 115 3 budR HTH-type transcriptional regulator BudR (Fragment) Klebsiella aerogenes
P37499 0.000706 44 23 0 121 3 yybE Uncharacterized HTH-type transcriptional regulator YybE Bacillus subtilis (strain 168)
O33945 0.000867 43 27 5 150 3 None Probable cat1 operon transcriptional activator Acinetobacter lwoffii
Q765S2 0.001 43 25 7 198 3 allS HTH-type transcriptional activator AllS Klebsiella pneumoniae

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_03250
Feature type CDS
Gene lysR
Product DNA-binding transcriptional regulator, LysR family
Location 640505 - 641407 (strand: 1)
Length 903 (nucleotides) / 300 (amino acids)

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_30
Orthogroup size 15
N. genomes 7

Actions

Genomic region

Domains

PF00126 Bacterial regulatory helix-turn-helix protein, lysR family
PF03466 LysR substrate binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0583 Transcription (K) K DNA-binding transcriptional regulator, LysR family

Protein Sequence

MKITLEEMRAFIAVVDSGSVTAAAAQNGLTVSAISRALLRLEEKMNSTLLYRTTRRLKLSEEGALFLQKARDVVQLAQEAEDVLMNHKEIPSGTLRIDASTPVQLHVIAPLVTQFHERYPQIRLELTNYEGITNLLEKQTDIAFRFGPLADSSLHATLMGYTRQRILVSPRYLQQHGEPKTPEELAQHTLLGFIAPESLNTWPLYNGNKKGLKITPSLAASSGEIICNLARSGAGIACISDFVTHEMRENGEFRQVLTSYTYENKLPINAVYYRSQALSPRLRCFIDFVLQHSQCFKRTG

Flanking regions ( +/- flanking 50bp)

TTGCGGAAACAGCCGCTAATCTGCAAAAAACAATTGAATAAAACGCAATAATGAAAATCACTCTGGAAGAAATGCGGGCATTTATTGCCGTCGTTGACAGCGGCTCCGTTACGGCCGCTGCCGCACAAAACGGGCTGACGGTTTCCGCTATCAGCCGCGCCCTGCTGCGTCTTGAAGAAAAGATGAACAGTACGCTGCTGTACCGCACCACGCGGCGGCTTAAACTGAGTGAAGAAGGCGCATTGTTCTTACAAAAAGCCCGTGATGTGGTGCAACTGGCACAGGAAGCGGAAGATGTGCTGATGAACCACAAAGAGATCCCCTCCGGCACACTGCGTATTGATGCCTCAACGCCAGTTCAGCTCCATGTGATAGCACCGCTGGTGACACAATTCCATGAACGTTATCCGCAAATCCGCCTTGAACTGACTAACTATGAAGGCATCACCAATTTACTGGAAAAACAGACCGATATTGCATTCCGCTTCGGTCCGCTGGCGGATTCTTCCCTGCATGCCACGCTGATGGGCTACACCCGGCAGCGGATTCTGGTCAGTCCGCGTTATCTTCAGCAACATGGCGAACCGAAAACGCCGGAAGAGTTGGCGCAGCATACTCTGCTGGGATTTATCGCGCCGGAAAGCCTGAATACCTGGCCGCTGTATAACGGCAATAAAAAGGGACTGAAAATTACCCCGTCACTGGCCGCGAGCAGCGGGGAAATTATCTGCAATCTGGCACGTTCCGGCGCGGGAATTGCCTGTATCTCTGATTTTGTGACACACGAAATGCGCGAAAACGGGGAATTTCGTCAGGTTCTGACATCATATACTTATGAAAACAAACTACCGATTAATGCGGTGTATTACCGCAGTCAGGCACTTTCTCCCCGGCTGCGCTGTTTTATCGATTTTGTCCTGCAACATAGTCAGTGTTTTAAACGCACCGGTTAATCTGAACACTACCTTAAGCCGCTGACGGCGCATCTCAGTATCTTCTCGAC