Homologs in group_30

Help

14 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02780 FBDBKF_02780 79.7 Morganella morganii S1 lysR DNA-binding transcriptional regulator, LysR family
EHELCC_03250 EHELCC_03250 79.7 Morganella morganii S2 lysR DNA-binding transcriptional regulator, LysR family
NLDBIP_00210 NLDBIP_00210 79.7 Morganella morganii S4 lysR DNA-binding transcriptional regulator, LysR family
LHKJJB_01825 LHKJJB_01825 79.7 Morganella morganii S3 lysR DNA-binding transcriptional regulator, LysR family
HKOGLL_01865 HKOGLL_01865 79.7 Morganella morganii S5 lysR DNA-binding transcriptional regulator, LysR family
F4V73_RS01700 F4V73_RS01700 18.9 Morganella psychrotolerans - LysR family transcriptional regulator
F4V73_RS03270 F4V73_RS03270 22.6 Morganella psychrotolerans - LysR family transcriptional regulator
F4V73_RS04355 F4V73_RS04355 25.9 Morganella psychrotolerans - LysR family transcriptional regulator
F4V73_RS05520 F4V73_RS05520 23.1 Morganella psychrotolerans - LysR family transcriptional regulator
F4V73_RS06440 F4V73_RS06440 16.0 Morganella psychrotolerans - LysR substrate-binding domain-containing protein
F4V73_RS10230 F4V73_RS10230 40.5 Morganella psychrotolerans - LysR family transcriptional regulator
F4V73_RS13185 F4V73_RS13185 24.1 Morganella psychrotolerans - LysR family transcriptional regulator
F4V73_RS13375 F4V73_RS13375 20.1 Morganella psychrotolerans - LysR family transcriptional regulator
PMI_RS03935 PMI_RS03935 42.6 Proteus mirabilis HI4320 yafC DNA-binding transcriptional regulator YafC

Distribution of the homologs in the orthogroup group_30

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_30

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q9JXW7 3.93e-84 258 44 0 291 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JPU9 7.29e-84 257 43 0 291 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup C (strain 8013)
P30864 1.12e-80 249 41 0 295 3 yafC Uncharacterized HTH-type transcriptional regulator YafC Escherichia coli (strain K12)
A0A0H2ZDG9 6.32e-38 139 31 5 297 3 PA14_22550 HTH-type transcriptional repressor PA14_22550 Pseudomonas aeruginosa (strain UCBPP-PA14)
P52689 8.95e-34 128 28 3 293 3 ltrA Probable HTH-type transcriptional regulator LtrA Klebsiella pneumoniae
P43011 9.63e-32 122 28 2 269 3 HI_1364 Uncharacterized HTH-type transcriptional regulator HI_1364 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45463 3.14e-29 116 27 4 292 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain K12)
Q8XBK9 5.06e-29 115 27 4 292 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O157:H7
P67662 5.17e-29 115 26 4 298 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli (strain K12)
P67663 5.17e-29 115 26 4 298 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P67664 5.17e-29 115 26 4 298 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O157:H7
Q1R6S1 7.74e-29 115 27 4 292 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain UTI89 / UPEC)
Q8FDH0 7.74e-29 115 27 4 292 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TD46 1.34e-28 114 27 4 292 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P37641 3.56e-28 113 27 3 290 3 yhjC Uncharacterized HTH-type transcriptional regulator YhjC Escherichia coli (strain K12)
P76250 5.11e-27 110 27 4 292 1 dmlR HTH-type transcriptional regulator DmlR Escherichia coli (strain K12)
P75836 1.43e-26 108 25 6 298 3 ycaN Uncharacterized HTH-type transcriptional regulator YcaN Escherichia coli (strain K12)
P72131 3.53e-18 86 26 2 292 1 ptxR HTH-type transcriptional regulator PtxR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q01610 3e-16 80 23 4 274 3 PA2220 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0ACR4 5.18e-14 74 24 5 291 1 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli (strain K12)
P0ACR5 5.18e-14 74 24 5 291 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACR6 5.18e-14 74 24 5 291 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O157:H7
P77333 1.04e-13 73 23 6 274 1 pgrR HTH-type transcriptional regulator PgrR Escherichia coli (strain K12)
P37459 2.47e-13 72 22 5 295 3 sinR Probable HTH-type transcriptional regulator SinR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57748 4.72e-13 71 27 4 184 3 MJ0300 Uncharacterized HTH-type transcriptional regulator MJ0300 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P55576 1.43e-12 70 26 9 297 3 NGR_a02420 Uncharacterized HTH-type transcriptional regulator y4mQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P14145 2.39e-12 69 25 6 257 3 ampR HTH-type transcriptional activator AmpR Rhodobacter capsulatus
P45099 3.31e-12 69 25 4 257 3 gcvA Glycine cleavage system transcriptional activator homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P96725 6.97e-12 68 21 7 292 3 ywqM Uncharacterized HTH-type transcriptional regulator YwqM Bacillus subtilis (strain 168)
P52658 1.32e-11 67 22 7 298 3 ampR HTH-type transcriptional activator AmpR Citrobacter koseri
Q85G62 6.86e-11 65 31 0 123 3 rbcR Probable RuBisCO transcriptional regulator Cyanidioschyzon merolae (strain NIES-3377 / 10D)
P52696 2.07e-10 63 24 4 200 3 ybhD Uncharacterized HTH-type transcriptional regulator YbhD Escherichia coli (strain K12)
A5F9F9 2.36e-10 63 29 5 195 3 irgB Iron-regulated virulence regulatory protein IrgB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P0C6D1 2.77e-10 63 29 5 195 3 irgB Iron-regulated virulence regulatory protein IrgB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0A9F6 2.79e-10 63 25 6 293 1 gcvA Glycine cleavage system transcriptional activator Escherichia coli (strain K12)
P0A9F7 2.79e-10 63 25 6 293 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F8 2.79e-10 63 25 6 293 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O157:H7
P24734 4.62e-10 62 26 6 241 1 ampR HTH-type transcriptional activator AmpR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P44821 9.53e-10 62 28 3 145 3 ilvY HTH-type transcriptional activator IlvY Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P25544 1.07e-09 62 22 6 299 3 rbcR RuBisCO operon transcriptional regulator Allochromatium vinosum
Q4G384 1.25e-09 61 29 0 123 3 rbcR Probable RuBisCO transcriptional regulator Emiliania huxleyi
P27111 1.36e-09 61 25 2 225 1 cynR HTH-type transcriptional regulator CynR Escherichia coli (strain K12)
P77559 2.46e-09 60 26 7 246 3 ynfL Uncharacterized HTH-type transcriptional regulator YnfL Escherichia coli (strain K12)
O32186 3.56e-09 60 32 1 122 3 yusT Uncharacterized HTH-type transcriptional regulator YusT Bacillus subtilis (strain 168)
A0T0G2 4.92e-09 59 29 2 143 3 rbcR Probable RuBisCO transcriptional regulator Phaeodactylum tricornutum (strain CCAP 1055/1)
P39647 6.33e-09 59 26 0 119 1 cysL HTH-type transcriptional regulator CysL Bacillus subtilis (strain 168)
P77309 6.82e-09 59 27 3 173 3 yneJ Uncharacterized HTH-type transcriptional regulator YneJ Escherichia coli (strain K12)
Q8X4M5 7.91e-09 59 25 2 225 3 cynR HTH-type transcriptional regulator CynR Escherichia coli O157:H7
P0ACR0 9.82e-09 58 29 7 191 1 allS HTH-type transcriptional activator AllS Escherichia coli (strain K12)
P0ACR1 9.82e-09 58 29 7 191 3 allS HTH-type transcriptional activator AllS Escherichia coli O157:H7
Q8FK66 1.45e-08 58 29 7 191 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKD7 1.45e-08 58 29 7 191 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8KA72 1.49e-08 58 21 6 256 3 metR HTH-type transcriptional regulator MetR Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P12529 1.56e-08 58 26 3 203 1 ampR HTH-type transcriptional activator AmpR Citrobacter freundii
P70785 1.82e-08 58 27 2 161 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
P0A2Q4 1.85e-08 58 25 3 204 3 metR HTH-type transcriptional regulator MetR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q5 1.85e-08 58 25 3 204 3 metR HTH-type transcriptional regulator MetR Salmonella typhi
Q1RF30 1.93e-08 58 29 7 191 3 allS HTH-type transcriptional activator AllS Escherichia coli (strain UTI89 / UPEC)
A1A8H0 1.93e-08 58 29 7 191 3 allS HTH-type transcriptional activator AllS Escherichia coli O1:K1 / APEC
P52662 4.08e-08 57 25 5 254 3 pecT HTH-type transcriptional regulator PecT Dickeya dadantii (strain 3937)
P48271 4.71e-08 57 29 0 123 3 rbcR Probable RuBisCO transcriptional regulator Cyanophora paradoxa
P0A9G1 5.45e-08 57 21 8 289 3 metR HTH-type transcriptional regulator MetR Shigella flexneri
P0A9F9 5.45e-08 57 21 8 289 1 metR HTH-type transcriptional regulator MetR Escherichia coli (strain K12)
P0A9G0 5.45e-08 57 21 8 289 3 metR HTH-type transcriptional regulator MetR Escherichia coli O157:H7
O34685 6.51e-08 56 26 2 166 1 yofA HTH-type transcriptional regulator YofA Bacillus subtilis (strain 168)
Q6B936 9.56e-08 55 28 0 123 3 rbcR Probable RuBisCO transcriptional regulator Gracilaria tenuistipitata var. liui
A0T0V5 1.05e-07 55 29 0 123 3 rbcR-A Probable RuBisCO transcriptional regulator Thalassiosira pseudonana
O32255 1.12e-07 55 24 2 133 3 yvbU Uncharacterized HTH-type transcriptional regulator YvbU Bacillus subtilis (strain 168)
P52669 1.25e-07 55 26 1 143 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
P05051 1.83e-07 55 27 1 168 3 ampR HTH-type transcriptional activator AmpR Enterobacter cloacae
P36771 4.4e-07 53 29 4 183 1 lrhA Probable HTH-type transcriptional regulator LrhA Escherichia coli (strain K12)
Q8VWE6 5e-07 53 29 4 183 3 lrhA Probable HTH-type transcriptional regulator LrhA Escherichia coli O157:H7
P52676 5.28e-07 53 24 2 200 3 nmcR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Enterobacter cloacae
P52683 8.09e-07 53 23 3 204 3 smeR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Serratia marcescens
P94501 8.87e-07 53 28 2 126 1 gltR HTH-type transcriptional regulator GltR Bacillus subtilis (strain 168)
P55181 9.24e-07 52 25 6 198 3 yxjO Uncharacterized HTH-type transcriptional regulator YxjO Bacillus subtilis (strain 168)
Q9HWH8 9.43e-07 52 28 1 126 3 nmoR HTH-type transcriptional regulator NmoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P42507 9.72e-07 52 26 1 169 3 hvrB AhcY transcriptional activator HvrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q8Z8R3 1.01e-06 52 27 7 191 3 allS HTH-type transcriptional activator AllS Salmonella typhi
P52660 1.04e-06 52 22 8 306 3 blaA HTH-type transcriptional regulator BlaA Proteus vulgaris
P94403 2.3e-06 51 29 6 148 3 bsdA HTH-type transcriptional regulator BsdA Bacillus subtilis (strain 168)
P77744 2.86e-06 51 20 2 150 3 abgR HTH-type transcriptional regulator AbgR Escherichia coli (strain K12)
P52691 3.17e-06 51 29 3 147 3 lrrA Probable HTH-type transcriptional regulator LrrA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q57S50 4.6e-06 50 27 7 191 3 allS HTH-type transcriptional activator AllS Salmonella choleraesuis (strain SC-B67)
P0ACR8 4.7e-06 50 28 5 165 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Shigella flexneri
P0ACR7 4.7e-06 50 28 5 165 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Escherichia coli (strain K12)
Q5N5I5 5.23e-06 50 28 2 142 3 cmpR HTH-type transcriptional activator CmpR Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q9F1R2 5.23e-06 50 28 2 142 1 cmpR HTH-type transcriptional activator CmpR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P46068 5.81e-06 50 24 4 203 2 dsdC HTH-type transcriptional regulator DsdC Escherichia coli (strain K12)
Q9S4Y7 5.96e-06 50 26 7 191 3 allS HTH-type transcriptional activator AllS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PCH2 5.96e-06 50 26 7 191 3 allS HTH-type transcriptional activator AllS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P33634 7.06e-06 50 25 5 173 3 yfiE Uncharacterized HTH-type transcriptional regulator YfiE Escherichia coli (strain K12)
P77700 9.21e-06 50 25 13 262 1 yahB Uncharacterized HTH-type transcriptional regulator YahB Escherichia coli (strain K12)
P76369 1.01e-05 50 29 4 136 3 yeeY Uncharacterized HTH-type transcriptional regulator YeeY Escherichia coli (strain K12)
P20668 1.05e-05 49 23 1 156 1 gltC Transcriptional dual regulator GltC Bacillus subtilis (strain 168)
Q47005 1.11e-05 49 26 2 145 3 nac Nitrogen assimilation regulatory protein nac Escherichia coli (strain K12)
O68014 1.51e-05 49 26 4 169 1 benM HTH-type transcriptional regulator BenM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P52666 1.82e-05 48 28 5 153 3 budR HTH-type transcriptional regulator BudR Raoultella terrigena
A7Z5E4 2.62e-05 48 26 5 167 3 yofA HTH-type transcriptional regulator YofA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q44311 3.31e-05 48 23 3 146 3 soxR HTH-type transcriptional regulator SoxR Arthrobacter sp. (strain TE1826)
A4QH19 3.32e-05 48 28 0 118 1 shiR HTH-type transcriptional regulator ShiR Corynebacterium glutamicum (strain R)
Q08597 3.51e-05 48 26 2 146 3 nac Nitrogen assimilation regulatory protein nac Klebsiella aerogenes
P67668 3.65e-05 48 25 4 191 3 BQ2027_MB2303C Uncharacterized HTH-type transcriptional regulator Mb2303c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMF3 3.65e-05 48 25 4 191 1 Rv2282c Uncharacterized HTH-type transcriptional regulator Rv2282c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF2 3.65e-05 48 25 4 191 3 MT2340 Uncharacterized HTH-type transcriptional regulator MT2340 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P74422 4.88e-05 47 30 1 123 3 ntcB Probable nitrogen assimilation transcriptional activator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q04778 7.79e-05 47 25 3 155 3 alsR HTH-type transcriptional regulator AlsR Bacillus subtilis (strain 168)
Q57083 7.86e-05 47 24 7 264 1 perR HTH-type transcriptional regulator PerR Escherichia coli (strain K12)
Q765S2 8.85e-05 47 27 7 194 3 allS HTH-type transcriptional activator AllS Klebsiella pneumoniae
P11720 0.000106 46 25 6 213 1 trpI HTH-type transcriptional regulator TrpI Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P45461 0.000114 46 23 5 218 3 ampR HTH-type transcriptional activator AmpR Yersinia enterocolitica
Q9X5P2 0.000121 46 31 5 142 2 oxyR Probable hydrogen peroxide-inducible genes activator Streptomyces viridosporus
O69772 0.00013 46 28 3 149 3 ampR HTH-type transcriptional activator AmpR Providencia stuartii
P42722 0.000209 45 27 4 148 3 cfxR HTH-type transcriptional regulator CfxR Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
O33945 0.000249 45 24 3 170 3 None Probable cat1 operon transcriptional activator Acinetobacter lwoffii
P16931 0.000253 45 26 1 126 3 dgdR HTH-type transcriptional regulator DgdR Burkholderia cepacia
P34818 0.00031 45 28 3 138 3 trpI HTH-type transcriptional regulator TrpI Pseudomonas syringae pv. syringae
P52678 0.000427 45 34 0 72 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium leprae (strain TN)
P67660 0.000474 44 24 6 274 1 yhaJ Probable HTH-type transcriptional regulator YhaJ Escherichia coli (strain K12)
P67661 0.000474 44 24 6 274 1 yhaJ HTH-type transcriptional regulator YhaJ Escherichia coli O157:H7
O87883 0.000521 43 29 3 156 3 oxyR Probable hydrogen peroxide-inducible genes activator (Fragment) Mycobacterium xenopi
P52677 0.00053 44 36 0 72 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium avium
P0ACQ9 0.000592 44 25 6 169 3 tdcA HTH-type transcriptional regulator TdcA Shigella flexneri
P0ACQ7 0.000592 44 25 6 169 3 tdcA HTH-type transcriptional regulator TdcA Escherichia coli (strain K12)
P0ACQ8 0.000592 44 25 6 169 3 tdcA HTH-type transcriptional regulator TdcA Escherichia coli O157:H7
P96194 0.000684 42 28 0 104 3 None Uncharacterized HTH-type transcriptional regulator in ibpB-leuC intergenic region Azotobacter vinelandii
P77171 0.000801 43 22 4 210 3 ydcI Uncharacterized HTH-type transcriptional regulator YdcI Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS05245
Feature type CDS
Gene -
Product LysR substrate-binding domain-containing protein
Location 1117049 - 1117951 (strand: 1)
Length 903 (nucleotides) / 300 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_30
Orthogroup size 15
N. genomes 7

Actions

Genomic region

Domains

PF00126 Bacterial regulatory helix-turn-helix protein, lysR family
PF03466 LysR substrate binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0583 Transcription (K) K DNA-binding transcriptional regulator, LysR family

Protein Sequence

MNITLEEMRVFIAVVDSGSITAAAAQSGLTVSATSRALLRLEEKMNSTLVLRTTRRLKLSEEGAVFLHKARDVVQLAQEAEDALMNHQQIPSGILRVDASTPFLIHVITPLVAQFNELYPQIRLELTNYEGVINLLEKQTDIAFRIGTLADSSLHATLLGHSRLRILASPHYLQQYGEPKTPQELTQHRLLGFTSPESLNEWPLYYNDKKGLKITPDIAASSGEILCNLTRQGAGIVCMSDFMTHEMRESGEFRQILTSFTYENKQPIHAVYYRSQTLSPRLRCFIDFIMQHSQSLKRLS

Flanking regions ( +/- flanking 50bp)

TGGCGGAAATAGTCGTTAATCTGCAAAAAATAATTGAGTGAAACGCGAAAATGAACATTACGCTGGAAGAGATGCGGGTATTTATCGCTGTGGTGGACAGCGGATCTATCACTGCCGCCGCCGCACAGAGCGGACTGACGGTTTCTGCCACCAGCCGCGCCCTGCTGCGTCTGGAAGAAAAAATGAACAGCACACTCGTCTTACGTACGACCCGGCGGCTGAAACTGAGTGAGGAAGGCGCGGTATTTTTGCACAAAGCCCGGGATGTGGTACAGCTCGCACAGGAAGCAGAAGATGCGCTGATGAACCACCAGCAGATCCCGTCCGGTATTTTGCGGGTGGATGCATCAACGCCCTTTCTTATTCATGTGATAACACCGCTGGTGGCGCAGTTTAATGAGCTCTACCCGCAGATCCGCCTGGAACTGACCAACTATGAAGGTGTTATTAATTTACTTGAAAAACAGACAGATATTGCATTTCGTATCGGGACACTCGCGGACTCTTCTCTTCACGCCACATTACTGGGTCACAGCCGGTTGCGCATTTTAGCCAGCCCGCACTATCTGCAACAGTACGGCGAACCCAAAACACCACAGGAGCTGACACAACACCGCCTGCTGGGATTTACCTCGCCGGAAAGTCTGAATGAATGGCCGCTGTATTATAATGATAAAAAAGGACTGAAAATCACCCCTGATATTGCCGCAAGCAGCGGGGAAATTCTCTGTAATCTGACTCGTCAGGGTGCAGGGATTGTCTGTATGTCCGATTTTATGACCCATGAGATGCGCGAAAGCGGCGAATTCCGGCAGATCCTGACCTCATTTACGTATGAAAACAAACAACCCATTCACGCAGTCTATTACCGGAGTCAGACTCTCTCCCCGCGCCTGCGCTGCTTTATCGATTTCATTATGCAGCACAGCCAGAGCCTCAAACGCCTGAGCTGAATCTGAACACAATATTAAGCCCACAACGGATAGCTCAGGGAAATGTTCGA