Homologs in group_127

Help

10 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17330 FBDBKF_17330 100.0 Morganella morganii S1 dinP Nucleotidyltransferase/DNA polymerase DinP involved in DNA repair
FBDBKF_20095 FBDBKF_20095 96.9 Morganella morganii S1 - DUF4113 domain-containing protein
EHELCC_19370 EHELCC_19370 96.9 Morganella morganii S2 - DUF4113 domain-containing protein
NLDBIP_01900 NLDBIP_01900 100.0 Morganella morganii S4 dinP Nucleotidyltransferase/DNA polymerase DinP involved in DNA repair
NLDBIP_19500 NLDBIP_19500 96.9 Morganella morganii S4 - DUF4113 domain-containing protein
LHKJJB_00135 LHKJJB_00135 100.0 Morganella morganii S3 dinP Nucleotidyltransferase/DNA polymerase DinP involved in DNA repair
LHKJJB_19450 LHKJJB_19450 96.9 Morganella morganii S3 - DUF4113 domain-containing protein
HKOGLL_00175 HKOGLL_00175 100.0 Morganella morganii S5 dinP Nucleotidyltransferase/DNA polymerase DinP involved in DNA repair
HKOGLL_19380 HKOGLL_19380 96.9 Morganella morganii S5 - DUF4113 domain-containing protein
PMI_RS12285 PMI_RS12285 57.7 Proteus mirabilis HI4320 umuC translesion error-prone DNA polymerase V subunit UmuC

Distribution of the homologs in the orthogroup group_127

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_127

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P04152 1.7e-175 499 58 3 422 1 umuC Protein UmuC Escherichia coli (strain K12)
P22494 2.28e-170 486 58 3 422 3 umuC Protein UmuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P18642 1.3e-168 482 56 2 422 3 impB Protein ImpB Salmonella typhimurium
P23832 1.08e-167 479 56 2 422 3 samB Protein SamB Salmonella typhimurium
P07375 1.65e-138 405 48 3 418 3 mucB Protein MucB Escherichia coli
P14303 6.35e-135 396 48 2 418 3 mucB Protein MucB Salmonella typhimurium
A5D243 1.57e-32 130 27 12 369 3 dinB DNA polymerase IV Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q3ABL2 3.44e-31 126 33 5 221 3 dinB DNA polymerase IV Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q2RJ46 1.52e-30 124 29 13 374 3 dinB DNA polymerase IV Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q98JM5 2.27e-30 124 27 10 371 3 dinB2 DNA polymerase IV 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9KCU7 3.25e-30 124 28 11 384 3 dinB1 DNA polymerase IV 1 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A5N2U5 1.05e-28 119 26 12 396 3 dinB DNA polymerase IV Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
A7Z6F3 1.51e-28 119 27 14 375 3 dinB DNA polymerase IV Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P54560 2.66e-28 118 27 14 392 3 dinB2 DNA polymerase IV 2 Bacillus subtilis (strain 168)
Q635E0 5.5e-27 114 27 11 386 3 dinB DNA polymerase IV Bacillus cereus (strain ZK / E33L)
Q8EQ56 6.37e-27 114 26 13 383 3 dinB DNA polymerase IV Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q9K9A8 1.53e-26 113 25 14 393 3 dinB2 DNA polymerase IV 2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q81M86 2.06e-26 113 27 11 386 3 dinB DNA polymerase IV Bacillus anthracis
P54545 3.48e-26 112 31 4 229 3 dinB1 DNA polymerase IV 1 Bacillus subtilis (strain 168)
Q818U9 3.81e-26 112 27 12 387 3 dinB DNA polymerase IV Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P58965 3.86e-26 112 28 8 298 1 dinB DNA polymerase IV Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q67QM6 7.2e-26 110 26 9 362 3 dinB DNA polymerase IV Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q7USY7 1.78e-25 110 30 7 276 3 dinB DNA polymerase IV Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q97MB3 3.93e-25 109 27 12 388 3 dinB DNA polymerase IV Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B8FBE8 1.37e-24 107 25 11 389 3 dinB DNA polymerase IV Desulfatibacillum aliphaticivorans
A8MGJ5 3.55e-23 103 29 10 303 3 dinB DNA polymerase IV Alkaliphilus oremlandii (strain OhILAs)
Q974T8 2.62e-22 100 29 6 225 3 dbh DNA polymerase IV Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q97W02 5.43e-22 99 32 5 207 1 dbh DNA polymerase IV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q2YU32 7.31e-22 99 26 7 294 3 dinB DNA polymerase IV Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9A5I1 9.39e-22 99 26 8 367 3 dinB DNA polymerase IV Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q73P36 1.03e-21 99 28 5 224 3 dinB DNA polymerase IV Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8FW50 1.74e-21 99 26 10 357 3 dinB DNA polymerase IV Brucella suis biovar 1 (strain 1330)
Q3ZAI3 2.18e-21 98 25 11 353 3 dinB DNA polymerase IV Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
P9WNT1 2.46e-21 97 28 7 327 3 dinB2 DNA polymerase IV 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNT0 2.46e-21 97 28 7 327 3 dinB2 DNA polymerase IV 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63988 2.46e-21 97 28 7 327 3 dinB2 DNA polymerase IV 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P58964 5.86e-21 96 26 7 294 3 dinB DNA polymerase IV Staphylococcus aureus (strain MW2)
Q6G838 5.86e-21 96 26 7 294 3 dinB DNA polymerase IV Staphylococcus aureus (strain MSSA476)
A6QIC3 5.86e-21 96 26 7 294 3 dinB DNA polymerase IV Staphylococcus aureus (strain Newman)
Q5HEM7 5.86e-21 96 26 7 294 3 dinB DNA polymerase IV Staphylococcus aureus (strain COL)
Q6GFG2 7.52e-21 96 26 7 294 3 dinB DNA polymerase IV Staphylococcus aureus (strain MRSA252)
P63992 8.6e-21 96 26 7 294 3 dinB DNA polymerase IV Staphylococcus aureus (strain N315)
P63991 8.6e-21 96 26 7 294 3 dinB DNA polymerase IV Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X420 8.6e-21 96 26 7 294 3 dinB DNA polymerase IV Staphylococcus aureus (strain Mu3 / ATCC 700698)
A5IU61 8.77e-21 96 26 7 294 3 dinB DNA polymerase IV Staphylococcus aureus (strain JH9)
A6U2Z9 8.77e-21 96 26 7 294 3 dinB DNA polymerase IV Staphylococcus aureus (strain JH1)
Q8YC76 1.28e-20 97 26 10 357 3 dinB DNA polymerase IV Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q6NGD8 1.6e-20 96 27 8 299 3 dinB DNA polymerase IV Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q6KZW2 2.49e-20 94 30 5 233 3 dbh DNA polymerase IV Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q3ZWB2 7.44e-20 94 24 11 353 3 dinB DNA polymerase IV Dehalococcoides mccartyi (strain CBDB1)
A5FSS1 2.87e-19 92 24 11 353 3 dinB DNA polymerase IV Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q9JYS8 3.49e-19 91 29 5 216 3 dinB DNA polymerase IV Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q6FFG4 5e-19 91 26 5 216 3 dinB DNA polymerase IV Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A4XT24 5.06e-19 91 27 6 230 3 dinB DNA polymerase IV Pseudomonas mendocina (strain ymp)
Q0A4X2 7.8e-19 90 29 5 217 3 dinB DNA polymerase IV Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
P9WNT3 8.43e-19 91 24 13 411 1 dinB1 DNA polymerase IV 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNT2 8.43e-19 91 24 13 411 3 dinB1 DNA polymerase IV 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63986 8.43e-19 91 24 13 411 3 dinB1 DNA polymerase IV 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8CNP3 1.02e-18 90 25 8 325 3 dinB DNA polymerase IV Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A1KUQ3 1.09e-18 90 29 5 216 3 dinB DNA polymerase IV Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A4VZ21 1.12e-18 90 28 9 309 3 dinB DNA polymerase IV Streptococcus suis (strain 98HAH33)
Q8PCW8 1.28e-18 90 25 11 366 3 dinB DNA polymerase IV Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UQI2 1.28e-18 90 25 11 366 3 dinB DNA polymerase IV Xanthomonas campestris pv. campestris (strain 8004)
B4SIF5 1.52e-18 89 26 12 363 3 dinB DNA polymerase IV Stenotrophomonas maltophilia (strain R551-3)
Q98LV1 1.65e-18 90 24 8 352 3 dinB1 DNA polymerase IV 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q5HN39 2.73e-18 89 25 8 325 3 dinB DNA polymerase IV Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9JRG1 3.51e-18 88 28 5 216 3 dinB DNA polymerase IV Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A4YEC1 4.6e-18 88 29 5 212 3 dbh DNA polymerase IV Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
B2FLR2 5.21e-18 88 31 5 216 3 dinB DNA polymerase IV Stenotrophomonas maltophilia (strain K279a)
Q9I534 5.99e-18 88 27 5 222 3 dinB DNA polymerase IV Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02I83 5.99e-18 88 27 5 222 3 dinB DNA polymerase IV Pseudomonas aeruginosa (strain UCBPP-PA14)
Q03J54 7.31e-18 87 25 10 365 3 dinB DNA polymerase IV Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5F8N2 7.91e-18 87 29 5 216 3 dinB DNA polymerase IV Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
O31990 8.07e-18 88 27 14 371 3 uvrX Putative UV-damage repair protein UvrX Bacillus subtilis (strain 168)
Q4ZWM4 9.21e-18 87 28 8 229 3 dinB DNA polymerase IV Pseudomonas syringae pv. syringae (strain B728a)
Q02WA3 9.78e-18 87 26 6 296 3 dinB DNA polymerase IV Lactococcus lactis subsp. cremoris (strain SK11)
A2RNH9 1.17e-17 87 26 6 296 3 dinB DNA polymerase IV Lactococcus lactis subsp. cremoris (strain MG1363)
A3CSG3 1.18e-17 87 28 6 295 3 dbh DNA polymerase IV Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q8UFV3 1.38e-17 87 26 4 231 3 dinB1 DNA polymerase IV 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5M2Y5 1.41e-17 87 25 10 365 3 dinB DNA polymerase IV Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q71Y46 1.45e-17 87 23 8 328 3 dinB DNA polymerase IV Listeria monocytogenes serotype 4b (strain F2365)
Q8DXW9 1.66e-17 87 26 8 297 3 dinB DNA polymerase IV Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E3I8 1.66e-17 87 26 8 297 3 dinB DNA polymerase IV Streptococcus agalactiae serotype III (strain NEM316)
Q3JZG9 1.66e-17 87 26 8 297 3 dinB DNA polymerase IV Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
C1KWR9 2.09e-17 86 23 7 312 3 dinB DNA polymerase IV Listeria monocytogenes serotype 4b (strain CLIP80459)
Q8Y5T0 2.39e-17 86 23 7 312 3 dinB DNA polymerase IV Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q3BP42 3.14e-17 85 25 11 373 3 dinB DNA polymerase IV Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q4JB80 3.31e-17 85 30 6 211 1 dbh DNA polymerase IV Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
P96022 3.31e-17 85 30 6 211 1 dbh DNA polymerase IV Saccharolobus solfataricus
Q92A40 4.74e-17 85 23 7 312 3 dinB DNA polymerase IV Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A1WY69 6.83e-17 85 26 9 324 3 dinB DNA polymerase IV Halorhodospira halophila (strain DSM 244 / SL1)
Q8DQZ7 6.89e-17 85 25 7 297 3 dinB DNA polymerase IV Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04M21 6.89e-17 85 25 7 297 3 dinB DNA polymerase IV Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A9A3A9 6.95e-17 85 25 5 222 3 dbh DNA polymerase IV Nitrosopumilus maritimus (strain SCM1)
Q48FB2 7.16e-17 84 27 8 229 3 dinB DNA polymerase IV Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q97SC7 7.22e-17 84 25 7 297 3 dinB DNA polymerase IV Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8DBV7 7.23e-17 84 23 7 312 3 dinB DNA polymerase IV Listeria monocytogenes serotype 4a (strain HCC23)
A6VA50 8.15e-17 84 27 5 222 3 dinB DNA polymerase IV Pseudomonas aeruginosa (strain PA7)
Q9CNG4 8.96e-17 84 27 5 222 3 dinB DNA polymerase IV Pasteurella multocida (strain Pm70)
Q92QM8 1.05e-16 85 24 11 356 3 dinB1 DNA polymerase IV 1 Rhizobium meliloti (strain 1021)
A3DH61 1.07e-16 84 27 5 217 3 dinB DNA polymerase IV Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q87Y22 1.47e-16 84 27 8 229 3 dinB DNA polymerase IV Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88V07 1.78e-16 84 24 8 274 3 dinB DNA polymerase IV Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B9DMT3 1.9e-16 83 25 7 296 3 dinB DNA polymerase IV Staphylococcus carnosus (strain TM300)
Q3KH18 1.95e-16 83 27 6 223 3 dinB DNA polymerase IV Pseudomonas fluorescens (strain Pf0-1)
Q9AK82 2.38e-16 84 26 13 367 3 dinB DNA polymerase IV Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8PT42 2.39e-16 83 29 6 250 3 dbh2 DNA polymerase IV 2 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q5LYC2 2.94e-16 83 24 10 365 3 dinB DNA polymerase IV Streptococcus thermophilus (strain CNRZ 1066)
B2UKN1 3.71e-16 82 24 9 309 3 dinB DNA polymerase IV Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q6MA55 5.11e-16 82 25 5 217 3 dinB DNA polymerase IV Protochlamydia amoebophila (strain UWE25)
Q8NNP4 5.97e-16 83 25 8 293 3 dinB DNA polymerase IV Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QFK8 6.31e-16 82 25 8 293 3 dinB DNA polymerase IV Corynebacterium glutamicum (strain R)
A0AK80 7.9e-16 81 22 7 312 3 dinB DNA polymerase IV Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8TIW3 8.05e-16 82 31 8 231 3 dbh DNA polymerase IV Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q2P7M9 8.26e-16 81 26 7 295 3 dinB DNA polymerase IV Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q0TQ38 8.34e-16 81 22 9 358 3 dinB DNA polymerase IV Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q49YT9 9.43e-16 81 24 8 325 3 dinB DNA polymerase IV Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q92XH8 1.13e-15 81 26 5 216 3 dinB2 DNA polymerase IV 2 Rhizobium meliloti (strain 1021)
Q8PGJ4 1.14e-15 81 27 6 246 3 dinB DNA polymerase IV Xanthomonas axonopodis pv. citri (strain 306)
Q6AL48 1.16e-15 81 28 5 217 3 dinB DNA polymerase IV Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q88NK4 1.88e-15 80 25 6 228 3 dinB DNA polymerase IV Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9HQT4 2.02e-15 81 30 5 227 3 dbh DNA polymerase IV Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R4P0 2.02e-15 81 30 5 227 3 dbh DNA polymerase IV Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
A5VZT3 2.24e-15 80 25 6 228 3 dinB DNA polymerase IV Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q1JF59 2.82e-15 80 26 9 299 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q5XA48 2.85e-15 80 26 9 299 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q48RJ4 3.01e-15 80 26 9 299 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M28 (strain MGAS6180)
B1ZN03 3.98e-15 80 23 14 393 3 dinB DNA polymerase IV Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
A2RCQ1 4.4e-15 79 26 9 299 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M5 (strain Manfredo)
Q8NZI1 4.65e-15 79 26 9 299 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q64X95 4.69e-15 79 23 7 278 3 dinB DNA polymerase IV Bacteroides fragilis (strain YCH46)
Q8DVR7 4.96e-15 79 22 10 366 3 dinB DNA polymerase IV Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A3N148 5.56e-15 79 27 5 222 3 dinB DNA polymerase IV Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0BPX9 5.61e-15 79 27 5 222 3 dinB DNA polymerase IV Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B0KTK6 6.34e-15 79 25 6 228 3 dinB DNA polymerase IV Pseudomonas putida (strain GB-1)
Q1I6D5 8.22e-15 79 26 7 229 3 dinB DNA polymerase IV Pseudomonas entomophila (strain L48)
Q99Y66 1.07e-14 78 26 9 299 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M1
P0DA79 1.34e-14 78 26 9 299 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DA78 1.34e-14 78 26 9 299 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q9CE21 1.53e-14 78 27 7 255 3 dinB DNA polymerase IV Lactococcus lactis subsp. lactis (strain IL1403)
Q5WYY8 1.72e-14 77 26 7 243 3 dinB DNA polymerase IV Legionella pneumophila (strain Lens)
B8F542 2.03e-14 77 27 5 222 3 dinB DNA polymerase IV Glaesserella parasuis serovar 5 (strain SH0165)
Q5X7J1 2.38e-14 77 26 7 243 3 dinB DNA polymerase IV Legionella pneumophila (strain Paris)
Q5ZY20 3.11e-14 77 26 7 243 3 dinB DNA polymerase IV Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A8H771 3.15e-14 77 27 7 232 3 dinB DNA polymerase IV Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A5IH02 3.25e-14 77 26 7 243 3 dinB DNA polymerase IV Legionella pneumophila (strain Corby)
Q8XK37 6.1e-14 76 27 5 204 3 dinB DNA polymerase IV Clostridium perfringens (strain 13 / Type A)
Q3II35 6.97e-14 75 25 6 244 3 dinB DNA polymerase IV Pseudoalteromonas translucida (strain TAC 125)
Q0SSQ2 7.47e-14 75 26 6 222 3 dinB DNA polymerase IV Clostridium perfringens (strain SM101 / Type A)
Q1JK63 8.55e-14 75 26 9 299 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JA16 8.55e-14 75 26 9 299 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q1J509 1e-13 75 25 9 299 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q5FSM8 1.16e-13 75 25 5 216 3 dinB DNA polymerase IV Gluconobacter oxydans (strain 621H)
A8AKQ2 1.22e-13 75 27 7 238 3 dinB DNA polymerase IV Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q4L7K8 1.86e-13 74 23 7 297 3 dinB DNA polymerase IV Staphylococcus haemolyticus (strain JCSC1435)
Q7N7B6 2.37e-13 74 26 5 217 3 dinB DNA polymerase IV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6R3M4 3.32e-13 75 25 5 260 1 Poli DNA polymerase iota Mus musculus
Q8F8Q2 3.34e-13 73 26 7 222 3 dinB DNA polymerase IV Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P63989 4.15e-13 73 26 9 247 3 dinB DNA polymerase IV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63990 4.15e-13 73 26 9 247 3 dinB DNA polymerase IV Salmonella typhi
A9MY13 4.15e-13 73 26 9 247 3 dinB DNA polymerase IV Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q9PQ53 4.22e-13 73 21 10 321 3 dinB DNA polymerase IV Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AJ79 4.22e-13 73 21 10 321 3 dinB DNA polymerase IV Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
Q18A91 5e-13 73 22 11 363 3 dinB DNA polymerase IV Clostridioides difficile (strain 630)
Q2A3L2 5.39e-13 73 26 5 217 3 dinB DNA polymerase IV Francisella tularensis subsp. holarctica (strain LVS)
A7NC07 5.39e-13 73 26 5 217 3 dinB DNA polymerase IV Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q65TG8 8.65e-13 72 24 5 232 3 dinB DNA polymerase IV Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q72MY7 9.73e-13 72 26 7 222 3 dinB DNA polymerase IV Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q57SU1 1e-12 72 26 8 243 3 dinB DNA polymerase IV Salmonella choleraesuis (strain SC-B67)
A7MEN4 1.2e-12 72 25 7 232 3 dinB DNA polymerase IV Cronobacter sakazakii (strain ATCC BAA-894)
A1JNY3 1.29e-12 72 26 6 227 3 dinB DNA polymerase IV Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A0Q6K9 1.36e-12 72 27 5 217 3 dinB DNA polymerase IV Francisella tularensis subsp. novicida (strain U112)
A3CKU4 1.74e-12 71 23 10 342 3 dinB DNA polymerase IV Streptococcus sanguinis (strain SK36)
Q8PYH6 1.93e-12 71 30 9 229 3 dbh1 DNA polymerase IV 1 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q5PF76 1.95e-12 71 25 8 243 3 dinB DNA polymerase IV Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q4KWZ7 2.07e-12 72 28 6 208 2 REV1 DNA repair protein REV1 Gallus gallus
A4W6W8 2.83e-12 71 26 7 238 3 dinB DNA polymerase IV Enterobacter sp. (strain 638)
Q0BM23 3.22e-12 70 26 5 217 3 dinB DNA polymerase IV Francisella tularensis subsp. holarctica (strain OSU18)
A3QGY9 3.52e-12 70 26 6 219 3 dinB DNA polymerase IV Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B1YK83 3.99e-12 70 27 5 217 3 dinB DNA polymerase IV Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
B0TQD1 4.56e-12 70 25 6 227 3 dinB DNA polymerase IV Shewanella halifaxensis (strain HAW-EB4)
B2SH34 4.64e-12 70 26 5 217 3 dinB DNA polymerase IV Francisella tularensis subsp. mediasiatica (strain FSC147)
B0TZS5 7.5e-12 69 26 5 217 3 dinB DNA polymerase IV Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B5ZBT4 7.75e-12 69 20 10 340 3 dinB DNA polymerase IV Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
Q9UNA4 7.95e-12 70 24 5 260 1 POLI DNA polymerase iota Homo sapiens
A9MNS1 8.04e-12 69 25 9 247 3 dinB DNA polymerase IV Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8AUV7 1.1e-11 69 23 9 340 3 dinB DNA polymerase IV Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q5R4N7 1.12e-11 70 24 7 301 2 REV1 DNA repair protein REV1 Pongo abelii
Q1RFU0 1.41e-11 68 24 7 238 3 dinB DNA polymerase IV Escherichia coli (strain UTI89 / UPEC)
Q0TL85 1.41e-11 68 24 7 238 3 dinB DNA polymerase IV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A7U2 1.41e-11 68 24 7 238 3 dinB DNA polymerase IV Escherichia coli O1:K1 / APEC
Q98NW7 1.45e-11 68 27 5 216 3 dinB3 DNA polymerase IV 3 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A3EWL3 1.46e-11 70 23 8 292 2 REV1 DNA repair protein REV1 Arabidopsis thaliana
A1U339 2.3e-11 68 23 7 259 3 dinB DNA polymerase IV Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q8XZ19 2.53e-11 68 24 5 216 3 dinB DNA polymerase IV Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q920Q2 3.57e-11 68 26 4 212 1 Rev1 DNA repair protein REV1 Mus musculus
Q086K1 4.14e-11 67 25 6 226 3 dinB DNA polymerase IV Shewanella frigidimarina (strain NCIMB 400)
Q9UBZ9 5.84e-11 68 23 6 302 1 REV1 DNA repair protein REV1 Homo sapiens
B2U3S3 6.69e-11 67 24 7 238 3 dinB DNA polymerase IV Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q3Z5A4 6.76e-11 67 24 7 238 3 dinB DNA polymerase IV Shigella sonnei (strain Ss046)
Q47155 6.76e-11 67 24 7 238 1 dinB DNA polymerase IV Escherichia coli (strain K12)
B1J100 6.76e-11 67 24 7 238 3 dinB DNA polymerase IV Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P59477 7.14e-11 67 24 7 238 3 dinB DNA polymerase IV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q6A763 7.25e-11 67 23 10 393 3 dinB DNA polymerase IV Cutibacterium acnes (strain DSM 16379 / KPA171202)
A7ZWJ6 7.47e-11 66 24 7 238 3 dinB DNA polymerase IV Escherichia coli O9:H4 (strain HS)
Q7MID6 7.73e-11 66 23 5 217 3 dinB DNA polymerase IV Vibrio vulnificus (strain YJ016)
Q8DBI7 7.73e-11 66 23 5 217 3 dinB DNA polymerase IV Vibrio vulnificus (strain CMCP6)
A7ZHZ2 7.89e-11 66 24 7 238 3 dinB DNA polymerase IV Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83M86 8.18e-11 66 24 7 238 3 dinB DNA polymerase IV Shigella flexneri
O94623 8.64e-11 67 29 7 219 3 rev1 DNA repair protein rev1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6JDV7 1.12e-10 67 23 16 413 1 POLK DNA polymerase kappa Arabidopsis thaliana
A6W1V6 1.46e-10 65 24 5 222 3 dinB DNA polymerase IV Marinomonas sp. (strain MWYL1)
B1KD33 1.61e-10 65 23 5 217 3 dinB DNA polymerase IV Shewanella woodyi (strain ATCC 51908 / MS32)
A8FYV3 1.66e-10 65 25 6 226 3 dinB DNA polymerase IV Shewanella sediminis (strain HAW-EB3)
Q6D1H8 2e-10 65 27 6 222 3 dinB DNA polymerase IV Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8X7Q1 2.14e-10 65 23 7 238 3 dinB DNA polymerase IV Escherichia coli O157:H7
P58963 2.22e-10 65 24 7 233 3 dinB DNA polymerase IV (Fragment) Escherichia fergusonii
Q32J17 2.61e-10 65 23 7 238 3 dinB DNA polymerase IV Shigella dysenteriae serotype 1 (strain Sd197)
A4TPK8 3.57e-10 64 25 6 227 3 dinB DNA polymerase IV Yersinia pestis (strain Pestoides F)
Q1CLD4 3.57e-10 64 25 6 227 3 dinB DNA polymerase IV Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZBZ9 3.57e-10 64 25 6 227 3 dinB DNA polymerase IV Yersinia pestis
Q1C4D9 3.57e-10 64 25 6 227 3 dinB DNA polymerase IV Yersinia pestis bv. Antiqua (strain Antiqua)
A8GAC8 6e-10 63 25 7 238 3 dinB DNA polymerase IV Serratia proteamaculans (strain 568)
Q15YP8 7.78e-10 63 24 5 218 3 dinB DNA polymerase IV Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A1S8M3 1.12e-09 63 23 6 223 3 dinB DNA polymerase IV Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q66DZ7 1.45e-09 62 24 6 227 3 dinB DNA polymerase IV Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FLI9 1.45e-09 62 24 6 227 3 dinB DNA polymerase IV Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q12Q05 1.64e-09 62 22 6 222 3 dinB DNA polymerase IV Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A9L0T3 2.12e-09 62 25 7 227 3 dinB DNA polymerase IV Shewanella baltica (strain OS195)
A3D147 3.17e-09 62 25 7 227 3 dinB DNA polymerase IV Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q8EHU9 3.85e-09 61 23 6 226 3 dinB DNA polymerase IV Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A0KHD5 3.94e-09 61 25 8 252 3 dinB DNA polymerase IV Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A6WRW5 4.01e-09 61 25 7 227 3 dinB DNA polymerase IV Shewanella baltica (strain OS185)
A1RMZ5 5.35e-09 61 24 6 226 3 dinB DNA polymerase IV Shewanella sp. (strain W3-18-1)
Q9W0P2 1.64e-08 60 21 8 266 1 Rev1 DNA repair protein Rev1 Drosophila melanogaster
O74944 1.78e-08 60 25 5 208 1 mug40 DNA polymerase kappa Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q49426 1.96e-08 59 24 8 223 3 MG360 Uncharacterized protein MG360 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q8UJK7 2.49e-08 58 25 5 216 3 dinB2 DNA polymerase IV 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q487H6 5.99e-08 57 23 5 216 3 dinB DNA polymerase IV Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q0HLP0 6.27e-08 57 23 7 227 3 dinB DNA polymerase IV Shewanella sp. (strain MR-4)
P75241 1.37e-07 57 25 9 216 3 MPN_537 Uncharacterized protein MG360 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
C0SPA8 2.25e-07 54 28 8 213 5 yobH DNA repair protein homolog YobH Bacillus subtilis (strain 168)
Q0HY21 2.34e-07 56 22 7 227 3 dinB DNA polymerase IV Shewanella sp. (strain MR-7)
Q9VHV1 3.17e-07 56 24 6 260 1 PolI DNA polymerase iota Drosophila melanogaster
A0KTR5 8.22e-07 54 22 7 227 3 dinB DNA polymerase IV Shewanella sp. (strain ANA-3)
Q9Y253 1.05e-06 54 30 4 150 1 POLH DNA polymerase eta Homo sapiens
Q9JJN0 1.63e-06 53 30 4 150 1 Polh DNA polymerase eta Mus musculus
A5F5Y1 5.21e-06 52 22 5 217 3 dinB DNA polymerase IV Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
C3LQ59 7.37e-06 51 22 5 217 3 dinB DNA polymerase IV Vibrio cholerae serotype O1 (strain M66-2)
Q9KPS5 7.37e-06 51 22 5 217 3 dinB DNA polymerase IV Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87MB4 1.33e-05 50 22 5 217 3 dinB DNA polymerase IV Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8REB0 0.000157 47 25 2 151 3 dinB DNA polymerase IV Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8H2D5 0.000219 47 31 3 116 1 POLH DNA polymerase eta Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_01560
Feature type CDS
Gene dinP
Product Nucleotidyltransferase/DNA polymerase DinP involved in DNA repair
Location 312001 - 313263 (strand: 1)
Length 1263 (nucleotides) / 420 (amino acids)
In genomic island -

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_127
Orthogroup size 11
N. genomes 6

Actions

Genomic region

Domains

PF00817 impB/mucB/samB family
PF11798 IMS family HHH motif
PF11799 impB/mucB/samB family C-terminal domain
PF13438 Domain of unknown function (DUF4113)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0389 Replication, recombination and repair (L) L Nucleotidyltransferase/DNA polymerase DinP involved in DNA repair

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03502 DNA polymerase V - -

Protein Sequence

MFALVDVNSFYTSCERVFRPDLTGKPVIVLSNNDGCVIARSAEAKALGIKMGALYYECRDFCYKNNVTVFSSNYALYGDMSSRVMTLLSSFAPATEIYSIDEAFLDFTGMTRIFSPEDYGYEIQAAILQKTHLPVGVGIAPTKTLAKLANHAAKTWKKTGGVVDLSDRLRQRKLLALIPVSEVWGIGRRISARLNTMGIRTALDLANAAPATIRKTFGVITERTLRELNGEPCIKLEEVRKVKQQILCSRSFGTKVTDIVTMRKAVCEYAERSAEKLREEKQRCRMIGLFVQTSRHANGPDYANSANISLEYPSCDTRDIINAATRALDSIWCDGYRYYKAGIILSDFTDSAVTQFDMFATRQPFKNSDELMKTIDTINNSGLGRVWFAGKGSDSGYKMKREMLSPAYTTNFSQLPVVKS

Flanking regions ( +/- flanking 50bp)

GATTTACAGATTTTCGGTGTGGTCACCTACATCATCCATCGGGCGCAGTGATGTTTGCGCTGGTGGATGTAAACAGCTTTTACACCAGCTGTGAAAGAGTATTCCGGCCCGATCTGACAGGTAAGCCGGTTATCGTCCTGAGCAATAATGATGGCTGCGTGATCGCCAGGTCAGCAGAGGCGAAAGCCCTCGGCATCAAAATGGGGGCACTGTATTATGAGTGTCGCGATTTTTGTTATAAAAACAATGTGACAGTATTCAGCTCAAATTATGCGTTGTACGGCGATATGAGCAGCCGTGTGATGACATTGCTCTCATCTTTCGCACCCGCCACAGAAATCTATTCTATAGACGAAGCCTTTCTCGATTTTACCGGCATGACCAGGATATTCAGCCCGGAAGATTACGGCTATGAGATACAGGCTGCTATTCTGCAGAAAACACACCTTCCGGTCGGTGTTGGCATTGCACCGACAAAGACACTCGCAAAACTTGCCAACCATGCAGCAAAAACATGGAAAAAAACCGGCGGAGTGGTCGACCTTTCTGATAGGCTGCGCCAGCGTAAGTTACTGGCACTGATACCGGTCAGTGAAGTGTGGGGTATCGGTCGGCGAATATCGGCCAGACTGAACACCATGGGGATTCGCACTGCATTAGATTTGGCGAACGCCGCACCGGCGACTATCCGTAAAACTTTCGGTGTTATTACTGAGCGTACGCTGCGGGAACTGAACGGAGAACCCTGCATCAAGCTGGAAGAAGTCAGAAAGGTGAAACAGCAGATCCTCTGCTCCCGATCATTCGGTACCAAAGTGACGGATATTGTCACAATGAGAAAGGCCGTGTGTGAATATGCCGAGCGGTCAGCCGAAAAACTCCGGGAAGAAAAGCAGCGCTGCCGGATGATCGGGTTGTTTGTGCAGACCAGCAGGCACGCGAACGGGCCGGATTATGCGAACAGTGCAAATATTTCACTCGAGTATCCCAGCTGCGACACGCGGGACATCATCAATGCTGCCACGAGAGCACTGGATAGTATCTGGTGTGACGGGTACCGGTATTATAAGGCGGGCATCATCCTGTCAGATTTCACTGATTCAGCCGTCACTCAGTTCGATATGTTCGCCACCAGGCAGCCATTCAAAAACAGCGACGAGCTGATGAAGACCATCGACACAATAAACAACAGTGGGCTGGGCCGTGTGTGGTTTGCCGGTAAAGGCAGTGACAGCGGATACAAGATGAAGCGCGAAATGTTGTCACCGGCATACACAACAAATTTTAGTCAGTTGCCGGTGGTAAAAAGTTAATGTAGTCCCAGTTAGACAAAGAGTTGTCGCAAATATGCAAATTGTTTAAA