Homologs in group_473

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00715 FBDBKF_00715 100.0 Morganella morganii S1 flgB flagellar basal body rod protein FlgB
NLDBIP_02630 NLDBIP_02630 100.0 Morganella morganii S4 flgB flagellar basal body rod protein FlgB
LHKJJB_04145 LHKJJB_04145 100.0 Morganella morganii S3 flgB flagellar basal body rod protein FlgB
HKOGLL_02900 HKOGLL_02900 100.0 Morganella morganii S5 flgB flagellar basal body rod protein FlgB
F4V73_RS06725 F4V73_RS06725 94.2 Morganella psychrotolerans flgB flagellar basal body rod protein FlgB
PMI_RS08075 PMI_RS08075 67.2 Proteus mirabilis HI4320 flgB flagellar basal body rod protein FlgB

Distribution of the homologs in the orthogroup group_473

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_473

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EYN9 2e-60 185 66 1 138 3 flgB Flagellar basal body rod protein FlgB Proteus mirabilis (strain HI4320)
P96972 1.66e-55 173 63 2 140 3 flgB Flagellar basal body rod protein FlgB Proteus mirabilis
P16437 2.23e-54 170 60 1 138 1 flgB Flagellar basal body rod protein FlgB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C8BKB7 2.03e-53 167 57 1 138 3 flgB Flagellar basal body rod protein FlgB Yersinia ruckeri
Q56893 7.57e-53 166 57 1 138 3 flgB Flagellar basal body rod protein FlgB Yersinia enterocolitica
P0ABX1 1.08e-49 158 55 1 138 3 flgB Flagellar basal body rod protein FlgB Shigella flexneri
P0ABW9 1.08e-49 158 55 1 138 3 flgB Flagellar basal body rod protein FlgB Escherichia coli (strain K12)
P0ABX0 1.08e-49 158 55 1 138 3 flgB Flagellar basal body rod protein FlgB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8VLR6 9.66e-30 107 44 2 128 3 flgB Flagellar basal body rod protein FlgB Cereibacter sphaeroides
A3PKG3 3.13e-29 106 43 2 128 3 flgB Flagellar basal body rod protein FlgB Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q3J1S6 4.2e-29 105 43 2 128 3 flgB Flagellar basal body rod protein FlgB Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
B9KJG2 6.81e-28 102 42 2 128 3 flgB Flagellar basal body rod protein FlgB Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q8GLP8 1.69e-27 101 41 4 137 3 flgB Flagellar basal body rod protein FlgB Aeromonas hydrophila
P57419 3.87e-27 100 39 4 140 3 flgB Flagellar basal body rod protein FlgB Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9K9 3.12e-25 96 40 3 137 3 flgB Flagellar basal body rod protein FlgB Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A0KM45 4.99e-24 92 40 4 137 3 flgB Flagellar basal body rod protein FlgB Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q89AI0 2.11e-23 91 36 1 136 3 flgB Flagellar basal body rod protein FlgB Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P24500 2.03e-09 55 29 2 126 1 flgB Flagellar basal body rod protein FlgB Bacillus subtilis (strain 168)
P52608 1.49e-07 50 28 2 110 3 flgB Flagellar basal body rod protein FlgB Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P70910 6.65e-05 43 27 2 107 3 flgB Flagellar basal body rod protein FlgB Borrelia hermsii

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_00830
Feature type CDS
Gene flgB
Product flagellar basal body rod protein FlgB
Location 188546 - 188962 (strand: 1)
Length 417 (nucleotides) / 138 (amino acids)

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_473
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00460 Flagella basal body rod protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1815 Cell motility (N) N Flagellar basal body rod protein FlgB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02387 flagellar basal-body rod protein FlgB Flagellar assembly -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG043022 flagellar basal body rod protein FlgB VF0967 Motility

Protein Sequence

MLDKLNATFAFQQQALSLRETRQTILASNIANADTPGYQARDIDFSRQLKQAMNNGTVKNGGLAMAVTAKGHISGHGAATPSAVDLKYRVPYQTSMDGNTVDMDVERSQFADNTLKYQADLTFINSRVKSMLAVLQQG

Flanking regions ( +/- flanking 50bp)

ATAATATACCTGTCACTAAAACAGGCGTAACACATCAACAGAGGGCAGACATGCTTGATAAGTTAAATGCCACGTTTGCATTTCAGCAGCAGGCTCTTTCGCTGCGGGAAACGCGTCAGACAATCCTGGCATCCAATATTGCCAATGCGGATACCCCCGGGTATCAGGCACGGGATATCGATTTCAGCCGCCAGCTGAAACAGGCGATGAATAACGGCACGGTGAAGAACGGCGGCCTGGCGATGGCAGTGACCGCGAAGGGTCATATCAGCGGACACGGTGCCGCAACACCGTCAGCGGTTGATCTGAAATACCGGGTGCCGTATCAGACATCGATGGACGGCAATACCGTGGATATGGATGTTGAACGCAGTCAGTTTGCTGATAACACCCTGAAATATCAGGCTGACCTGACCTTTATTAACAGCCGCGTGAAAAGCATGCTGGCCGTCTTACAGCAAGGGTAATTCTGATGGCACTACTGAGTATTTTTGATATTTCCGCCTCCGCACTGACC