Homologs in group_550

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00715 FBDBKF_00715 67.2 Morganella morganii S1 flgB flagellar basal body rod protein FlgB
EHELCC_00830 EHELCC_00830 67.2 Morganella morganii S2 flgB flagellar basal body rod protein FlgB
NLDBIP_02630 NLDBIP_02630 67.2 Morganella morganii S4 flgB flagellar basal body rod protein FlgB
LHKJJB_04145 LHKJJB_04145 67.2 Morganella morganii S3 flgB flagellar basal body rod protein FlgB
HKOGLL_02900 HKOGLL_02900 67.2 Morganella morganii S5 flgB flagellar basal body rod protein FlgB
F4V73_RS06725 F4V73_RS06725 67.2 Morganella psychrotolerans flgB flagellar basal body rod protein FlgB

Distribution of the homologs in the orthogroup group_550

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_550

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EYN9 1.05e-100 287 100 0 137 3 flgB Flagellar basal body rod protein FlgB Proteus mirabilis (strain HI4320)
P96972 4.15e-95 273 95 1 139 3 flgB Flagellar basal body rod protein FlgB Proteus mirabilis
Q56893 1.55e-62 190 64 0 137 3 flgB Flagellar basal body rod protein FlgB Yersinia enterocolitica
C8BKB7 6.31e-62 189 64 0 137 3 flgB Flagellar basal body rod protein FlgB Yersinia ruckeri
P16437 3.11e-58 179 64 0 137 1 flgB Flagellar basal body rod protein FlgB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0ABX1 4.39e-56 174 60 0 137 3 flgB Flagellar basal body rod protein FlgB Shigella flexneri
P0ABW9 4.39e-56 174 60 0 137 3 flgB Flagellar basal body rod protein FlgB Escherichia coli (strain K12)
P0ABX0 4.39e-56 174 60 0 137 3 flgB Flagellar basal body rod protein FlgB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P57419 5.32e-31 110 43 2 136 3 flgB Flagellar basal body rod protein FlgB Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8GLP8 1.61e-27 102 41 4 139 3 flgB Flagellar basal body rod protein FlgB Aeromonas hydrophila
Q8K9K9 3.66e-26 98 40 4 140 3 flgB Flagellar basal body rod protein FlgB Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AI0 1.06e-25 97 39 2 136 3 flgB Flagellar basal body rod protein FlgB Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A0KM45 2.39e-25 96 40 4 139 3 flgB Flagellar basal body rod protein FlgB Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A3PKG3 2.02e-24 94 41 3 123 3 flgB Flagellar basal body rod protein FlgB Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q3J1S6 2.43e-24 93 41 3 123 3 flgB Flagellar basal body rod protein FlgB Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
B9KJG2 2.66e-24 93 40 3 123 3 flgB Flagellar basal body rod protein FlgB Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q8VLR6 6.33e-24 92 40 3 123 3 flgB Flagellar basal body rod protein FlgB Cereibacter sphaeroides
P24500 5.98e-09 53 31 5 130 1 flgB Flagellar basal body rod protein FlgB Bacillus subtilis (strain 168)
P52608 1.18e-07 50 29 3 119 3 flgB Flagellar basal body rod protein FlgB Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P70910 2.58e-07 49 32 5 116 3 flgB Flagellar basal body rod protein FlgB Borrelia hermsii
O67244 0.000547 40 25 2 115 3 flgB Flagellar basal body rod protein FlgB Aquifex aeolicus (strain VF5)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS08075
Feature type CDS
Gene flgB
Product flagellar basal body rod protein FlgB
Location 1764340 - 1764753 (strand: -1)
Length 414 (nucleotides) / 137 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_550
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00460 Flagella basal body rod protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1815 Cell motility (N) N Flagellar basal body rod protein FlgB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02387 flagellar basal-body rod protein FlgB Flagellar assembly -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG002351 flagellar basal-body rod protein FlgB VF0394 Motility

Protein Sequence

MLDKLENTFHFQQEALSLRNKRQEILAANIANADTPGFQARDIDFAAELKKTMENGRTGSHGLQLTMTSERHIPIKPGYRLEADLLYRVPHQTSMDGNTVDMDMERSNFADNSVKYQADVTFINSQVKSMMAVLQQG

Flanking regions ( +/- flanking 50bp)

GAAATTGTTTTATCAGCTGAGGTGAGTGGTTTAGCCACCAAGGATAGAAGATGCTCGATAAATTAGAAAATACGTTTCATTTTCAACAAGAAGCGCTTTCACTACGTAATAAACGCCAAGAAATTTTGGCGGCAAATATTGCTAATGCTGATACGCCAGGCTTCCAAGCTCGGGATATTGATTTCGCGGCTGAGTTGAAAAAAACCATGGAAAACGGGCGTACTGGTAGTCATGGATTGCAACTGACAATGACATCAGAACGCCATATTCCTATTAAGCCGGGTTATCGCTTAGAGGCTGATTTGCTTTATCGGGTTCCTCATCAAACATCGATGGATGGTAACACGGTCGATATGGATATGGAACGGAGTAATTTTGCCGATAATAGCGTTAAATATCAGGCAGATGTGACATTTATTAACTCTCAAGTTAAAAGCATGATGGCTGTATTGCAACAAGGATAAAGAGTATGTCTTTATTTAGTATTTTCGATATTTCAGGTTCTGCACTTTCA