Homologs in group_500

Help

6 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00950 FBDBKF_00950 100.0 Morganella morganii S1 araC AraC-type DNA-binding domain and AraC-containing proteins
NLDBIP_02865 NLDBIP_02865 100.0 Morganella morganii S4 araC AraC-type DNA-binding domain and AraC-containing proteins
LHKJJB_04380 LHKJJB_04380 100.0 Morganella morganii S3 araC AraC-type DNA-binding domain and AraC-containing proteins
HKOGLL_02665 HKOGLL_02665 100.0 Morganella morganii S5 araC AraC-type DNA-binding domain and AraC-containing proteins
F4V73_RS06945 F4V73_RS06945 74.2 Morganella psychrotolerans - AraC family transcriptional regulator
F4V73_RS07325 F4V73_RS07325 43.6 Morganella psychrotolerans - AraC family transcriptional regulator

Distribution of the homologs in the orthogroup group_500

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_500

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q46855 3.87e-41 147 32 5 299 4 yqhC Uncharacterized HTH-type transcriptional regulator YqhC Escherichia coli (strain K12)
P26993 1.21e-11 67 23 3 260 1 exsA HTH-type transcriptional regulator ExsA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B4TPQ9 1.94e-10 63 26 1 152 3 rhaS HTH-type transcriptional activator RhaS Salmonella schwarzengrund (strain CVM19633)
B5F0M9 2.18e-10 63 28 3 153 3 rhaS HTH-type transcriptional activator RhaS Salmonella agona (strain SL483)
B4TBY3 2.63e-10 63 26 1 152 3 rhaS HTH-type transcriptional activator RhaS Salmonella heidelberg (strain SL476)
P0A2S9 2.81e-10 63 26 1 152 3 rhaS HTH-type transcriptional activator RhaS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2T0 2.81e-10 63 26 1 152 3 rhaS HTH-type transcriptional activator RhaS Salmonella typhi
C0Q3L4 2.81e-10 63 26 1 152 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi C (strain RKS4594)
A9MZC8 2.81e-10 63 26 1 152 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZZ3 2.81e-10 63 26 1 152 3 rhaS HTH-type transcriptional activator RhaS Salmonella newport (strain SL254)
B5RFC3 2.81e-10 63 26 1 152 3 rhaS HTH-type transcriptional activator RhaS Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QWY4 2.81e-10 63 26 1 152 3 rhaS HTH-type transcriptional activator RhaS Salmonella enteritidis PT4 (strain P125109)
B5BJG8 5.72e-10 62 26 1 152 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi A (strain AKU_12601)
Q5PKG2 5.72e-10 62 26 1 152 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5FPP5 6.34e-10 62 26 1 152 3 rhaS HTH-type transcriptional activator RhaS Salmonella dublin (strain CT_02021853)
Q57HG8 7.11e-10 62 26 1 152 3 rhaS HTH-type transcriptional activator RhaS Salmonella choleraesuis (strain SC-B67)
A9MI64 2.73e-09 60 25 1 152 3 rhaS HTH-type transcriptional activator RhaS Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P76138 4.02e-09 55 67 0 37 5 yneL Putative HTH-type transcriptional regulator YneL Escherichia coli (strain K12)
A8AL27 7.67e-09 58 28 2 153 3 rhaS HTH-type transcriptional activator RhaS Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B6I4P8 5.01e-08 56 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain SE11)
G3XCU2 5.94e-08 56 27 0 93 4 argR HTH-type transcriptional regulator ArgR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q32A70 5.99e-08 56 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Shigella dysenteriae serotype 1 (strain Sd197)
A7ZUB7 6.33e-08 56 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O139:H28 (strain E24377A / ETEC)
B7N2P7 6.45e-08 56 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O81 (strain ED1a)
Q1R414 6.57e-08 56 24 1 152 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain UTI89 / UPEC)
B7NFK3 6.57e-08 56 24 1 152 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q0TAF8 6.57e-08 56 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AI82 6.57e-08 56 24 1 152 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O1:K1 / APEC
B7NUA1 6.57e-08 56 24 1 152 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MI37 6.57e-08 56 24 1 152 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UNM6 6.57e-08 56 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B1LMU6 6.69e-08 56 24 1 152 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain SMS-3-5 / SECEC)
Q3YV71 6.95e-08 56 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Shigella sonnei (strain Ss046)
Q83PE0 6.95e-08 56 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Shigella flexneri
Q0SZ95 6.95e-08 56 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Shigella flexneri serotype 5b (strain 8401)
B7LVD8 6.95e-08 56 25 1 152 3 rhaS HTH-type transcriptional activator RhaS Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q31U84 7.01e-08 56 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Shigella boydii serotype 4 (strain Sb227)
P09377 7.01e-08 56 25 3 155 1 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12)
B1IVH3 7.01e-08 56 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A709 7.01e-08 56 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O9:H4 (strain HS)
B1XB72 7.01e-08 56 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12 / DH10B)
C5A073 7.01e-08 56 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12 / MC4100 / BW2952)
B7M6V7 7.01e-08 56 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O8 (strain IAI1)
B7L9G1 7.01e-08 56 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain 55989 / EAEC)
P40883 8.29e-08 56 29 1 115 2 pchR Regulatory protein PchR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8ZM00 9.47e-08 55 30 2 106 1 STM3175 Probable HTH-type transcriptional regulator STM3175 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8CXW5 1.2e-07 55 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A4WG91 1.52e-07 55 25 1 152 3 rhaS HTH-type transcriptional activator RhaS Enterobacter sp. (strain 638)
P96660 1.66e-07 55 20 5 258 4 ydeC Uncharacterized HTH-type transcriptional regulator YdeC Bacillus subtilis (strain 168)
P77396 2.18e-07 54 26 0 97 4 ypdC Uncharacterized HTH-type transcriptional regulator YpdC Escherichia coli (strain K12)
P77379 2.4e-07 54 37 0 85 1 rclR RCS-specific HTH-type transcriptional activator RclR Escherichia coli (strain K12)
Q9HTH5 2.47e-07 54 28 0 112 1 cdhR HTH-type transcriptional regulator CdhR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P43462 2.62e-07 54 31 1 100 4 thcR Probable thc operon regulatory protein Rhodococcus erythropolis
Q9HTI4 3.17e-07 54 29 0 96 1 gbdR HTH-type transcriptional regulator GbdR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A0H2ZIC3 3.17e-07 54 29 0 96 1 gbdR HTH-type transcriptional regulator GbdR Pseudomonas aeruginosa (strain UCBPP-PA14)
B2TVP7 3.83e-07 53 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B5YZ43 3.83e-07 53 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X897 3.83e-07 53 25 3 155 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O157:H7
B5XZ49 5.91e-07 53 26 2 153 3 rhaS HTH-type transcriptional activator RhaS Klebsiella pneumoniae (strain 342)
A6TGA9 1.46e-06 52 25 2 153 3 rhaS HTH-type transcriptional activator RhaS Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
H9L484 2.24e-06 48 27 0 99 1 ramA Transcriptional regulator RamA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P28808 7.31e-06 50 23 4 259 4 lcrF Thermoregulatory protein LcrF Yersinia pestis
P0C2V5 9.03e-06 49 25 5 259 2 virF Virulence regulon transcriptional activator VirF Yersinia enterocolitica
P0ACH8 1.34e-05 49 24 0 99 1 melR Melibiose operon regulatory protein Escherichia coli (strain K12)
P0ACH9 1.34e-05 49 24 0 99 3 melR Melibiose operon regulatory protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P77402 1.58e-05 49 27 0 100 4 ydiP Uncharacterized HTH-type transcriptional regulator YdiP Escherichia coli (strain K12)
O31249 1.86e-05 48 28 0 101 4 alkR HTH-type transcriptional regulator AlkR Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A7ML57 2.3e-05 48 33 0 87 3 rhaR HTH-type transcriptional activator RhaR Cronobacter sakazakii (strain ATCC BAA-894)
Q6DA21 2.58e-05 48 28 1 114 3 rhaR HTH-type transcriptional activator RhaR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A4WG90 3.43e-05 48 28 0 106 3 rhaR HTH-type transcriptional activator RhaR Enterobacter sp. (strain 638)
A1JU91 4.37e-05 47 24 5 259 3 virF Virulence regulon transcriptional activator VirF Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C6DJR5 4.98e-05 47 28 1 114 3 rhaR HTH-type transcriptional activator RhaR Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q9ZFU7 6.29e-05 47 27 1 105 1 eutR HTH-type DNA-binding transcriptional activator EutR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P36547 6.52e-05 47 27 1 105 3 eutR HTH-type DNA-binding transcriptional activator EutR Escherichia coli (strain K12)
P43465 7.29e-05 47 23 0 106 4 rafR Raffinose operon transcriptional regulatory protein RafR Pediococcus pentosaceus
Q65Q30 8.48e-05 47 30 2 112 3 rhaR HTH-type transcriptional activator RhaR Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q00753 9.46e-05 46 20 6 258 4 msmR Msm operon regulatory protein Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
O87389 0.000122 46 28 0 97 4 glxA HTH-type transcriptional regulator GlxA Rhizobium meliloti (strain 1021)
Q9WW32 0.00014 46 26 0 83 1 mtrA HTH-type transcriptional regulator MtrA Neisseria gonorrhoeae
P55922 0.000186 43 29 0 99 4 ramA Transcriptional activator RamA Enterobacter cloacae
P35319 0.000189 45 31 0 83 4 None Putative AraC-like transcription regulator Streptomyces lividans
Q56143 0.000196 43 26 0 101 3 soxS Regulatory protein SoxS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B1JNC5 0.000248 45 24 2 144 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TRS8 0.000248 45 24 2 144 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis (strain Pestoides F)
B2K1W5 0.000248 45 24 2 144 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FN80 0.000248 45 24 2 144 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P40331 0.000294 45 21 2 149 4 yisR Uncharacterized HTH-type transcriptional regulator YisR Bacillus subtilis (strain 168)
Q66FF2 0.000323 45 24 2 144 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype I (strain IP32953)
O34901 0.000335 44 23 1 116 4 yobQ Uncharacterized HTH-type transcriptional regulator YobQ Bacillus subtilis (strain 168)
P0A9E2 0.000348 42 26 0 101 1 soxS Regulatory protein SoxS Escherichia coli (strain K12)
P0A9E3 0.000348 42 26 0 101 3 soxS Regulatory protein SoxS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9E4 0.000348 42 26 0 101 3 soxS Regulatory protein SoxS Escherichia coli O157:H7
P45008 0.000383 45 32 0 86 4 HI_1052 Uncharacterized HTH-type transcriptional regulator HI_1052 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q51872 0.000484 44 30 1 107 4 lumQ Probable transcriptional regulator LumQ Photobacterium leiognathi
A9QYR8 0.000533 44 23 2 144 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis bv. Antiqua (strain Angola)
B1JNC4 0.000536 44 29 1 102 3 rhaR HTH-type transcriptional activator RhaR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q84BZ4 0.000556 44 27 1 93 4 andR Anthranilate 1,2-dioxygenase regulatory protein Burkholderia cepacia
P40408 0.000627 44 23 0 100 1 btr HTH-type transcriptional activator Btr Bacillus subtilis (strain 168)
A4TRS7 0.000743 43 29 1 102 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis (strain Pestoides F)
Q1CEB6 0.000743 43 29 1 102 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis bv. Antiqua (strain Nepal516)
A9QYR6 0.000743 43 29 1 102 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis bv. Antiqua (strain Angola)
Q8ZIZ9 0.000743 43 29 1 102 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis
B2K1W6 0.000743 43 29 1 102 3 rhaR HTH-type transcriptional activator RhaR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C0W2 0.000743 43 29 1 102 3 rhaR HTH-type transcriptional activator RhaR Yersinia pestis bv. Antiqua (strain Antiqua)
Q66FF1 0.000785 43 29 1 102 3 rhaR HTH-type transcriptional activator RhaR Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FN79 0.000785 43 29 1 102 3 rhaR HTH-type transcriptional activator RhaR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A6TGB0 0.000841 43 28 0 87 3 rhaR HTH-type transcriptional activator RhaR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_00595
Feature type CDS
Gene araC
Product AraC-type DNA-binding domain and AraC-containing proteins
Location 134282 - 135169 (strand: 1)
Length 888 (nucleotides) / 295 (amino acids)

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_500
Orthogroup size 7
N. genomes 6

Actions

Genomic region

Domains

PF06719 AraC-type transcriptional regulator N-terminus
PF12833 Helix-turn-helix domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4977 Transcription (K) K Transcriptional regulator GlxA, contains an amidase domain and an AraC-type DNA-binding HTH domain

Protein Sequence

MKTEDRLRCLKQLLQTHTAERSGGWDTAVPGLALCRWTAPSQAQTWTYEPGIALAVQGAKRITLGDNTYCYRPGDVLLTSVDIPAIAQVCEASEQAPFLALLVSLNLSDLPALMQESGFQLLTSEPPVPQAVCPVTEALLSAVCRLVALLDKPDDIPVMAPLIHKEILYYLLKSGQGARLQLMAAHNKQCRQISGVLNYLKAHFDQPVSVETLCRHAQMSESSFHRHFRRVTRMSPLQYQKWLRLNEARRLLLVESADASEAAFRVGYESASQFNREYRRLFGLPPGQDKKRVLL

Flanking regions ( +/- flanking 50bp)

CGGTCTTTTCCGTTATGCTGTAGCCCTGTTAATCAGTCGCTGAGAATATAATGAAAACGGAAGATCGCCTGCGCTGCCTGAAGCAGTTGTTACAGACTCACACCGCAGAGCGCAGCGGCGGGTGGGATACGGCCGTTCCCGGTCTCGCATTATGCCGGTGGACGGCCCCGTCACAGGCGCAAACCTGGACTTATGAGCCGGGTATCGCGCTTGCGGTTCAGGGCGCGAAACGGATCACGCTCGGAGATAACACCTATTGTTACCGCCCCGGGGATGTATTGCTGACATCCGTGGATATCCCCGCGATAGCGCAGGTCTGTGAGGCATCAGAGCAGGCACCGTTTCTGGCACTGCTGGTCAGTCTTAACCTCAGTGACCTTCCGGCACTGATGCAGGAAAGCGGCTTTCAGCTGCTGACTTCAGAACCCCCTGTACCTCAGGCAGTGTGTCCGGTCACAGAAGCGTTGCTCAGTGCGGTCTGCCGCCTGGTGGCGCTGCTGGACAAACCGGACGATATCCCGGTCATGGCTCCGCTTATCCATAAAGAAATTCTTTATTACCTGCTGAAAAGCGGTCAGGGAGCACGGCTCCAGCTGATGGCCGCACATAATAAACAGTGCCGCCAGATAAGCGGCGTACTGAATTATCTGAAAGCGCATTTTGATCAGCCGGTATCGGTGGAGACACTCTGCCGCCATGCTCAGATGAGCGAATCCTCTTTTCACCGCCATTTCCGCCGGGTCACCCGGATGAGCCCGCTGCAATATCAGAAATGGCTGCGGCTGAATGAAGCCCGTCGCCTGCTGCTGGTGGAATCGGCGGATGCCTCGGAAGCGGCTTTTCGTGTCGGGTATGAAAGTGCCTCTCAGTTTAACCGTGAATACCGGCGGTTATTCGGGTTACCTCCCGGACAGGATAAAAAGCGGGTTCTTCTCTGACCGGTGTGTGATTTCCGGGCAAAATGACAGGATCAGGCAAACATCAGAGC