Homologs in group_500

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00950 FBDBKF_00950 43.6 Morganella morganii S1 araC AraC-type DNA-binding domain and AraC-containing proteins
EHELCC_00595 EHELCC_00595 43.6 Morganella morganii S2 araC AraC-type DNA-binding domain and AraC-containing proteins
NLDBIP_02865 NLDBIP_02865 43.6 Morganella morganii S4 araC AraC-type DNA-binding domain and AraC-containing proteins
LHKJJB_04380 LHKJJB_04380 43.6 Morganella morganii S3 araC AraC-type DNA-binding domain and AraC-containing proteins
HKOGLL_02665 HKOGLL_02665 43.6 Morganella morganii S5 araC AraC-type DNA-binding domain and AraC-containing proteins
F4V73_RS06945 F4V73_RS06945 44.1 Morganella psychrotolerans - AraC family transcriptional regulator

Distribution of the homologs in the orthogroup group_500

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_500

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q46855 1.14e-46 162 34 2 292 4 yqhC Uncharacterized HTH-type transcriptional regulator YqhC Escherichia coli (strain K12)
P43465 3.6e-08 57 27 4 164 4 rafR Raffinose operon transcriptional regulatory protein RafR Pediococcus pentosaceus
P76138 1.61e-07 50 59 0 37 5 yneL Putative HTH-type transcriptional regulator YneL Escherichia coli (strain K12)
Q66FF2 5.41e-07 53 24 3 143 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype I (strain IP32953)
A9QYR8 6.45e-07 53 24 3 143 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis bv. Antiqua (strain Angola)
B1JNC5 7.34e-07 53 24 3 143 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TRS8 7.34e-07 53 24 3 143 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis (strain Pestoides F)
B2K1W5 7.34e-07 53 24 3 143 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FN80 7.34e-07 53 24 3 143 3 rhaS HTH-type transcriptional activator RhaS Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P96660 8.39e-07 53 20 4 195 4 ydeC Uncharacterized HTH-type transcriptional regulator YdeC Bacillus subtilis (strain 168)
B5XZ49 1.08e-06 52 28 4 124 3 rhaS HTH-type transcriptional activator RhaS Klebsiella pneumoniae (strain 342)
P40883 1.21e-06 52 27 1 113 2 pchR Regulatory protein PchR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7LVD8 1.36e-06 52 26 4 145 3 rhaS HTH-type transcriptional activator RhaS Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A6TGA9 2.36e-06 51 27 4 124 3 rhaS HTH-type transcriptional activator RhaS Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q1CEB5 3.89e-06 50 23 3 143 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZJ00 3.89e-06 50 23 3 143 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis
Q1C0W1 3.89e-06 50 23 3 143 3 rhaS HTH-type transcriptional activator RhaS Yersinia pestis bv. Antiqua (strain Antiqua)
B5BJG8 9.45e-06 49 23 4 163 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi A (strain AKU_12601)
Q5PKG2 9.45e-06 49 23 4 163 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9HTH5 9.5e-06 50 29 0 115 1 cdhR HTH-type transcriptional regulator CdhR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P77379 9.54e-06 49 35 0 80 1 rclR RCS-specific HTH-type transcriptional activator RclR Escherichia coli (strain K12)
T2KMF4 1.04e-05 50 27 0 69 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
P35319 1.92e-05 48 27 0 101 4 None Putative AraC-like transcription regulator Streptomyces lividans
B5FPP5 7.31e-05 47 22 5 234 3 rhaS HTH-type transcriptional activator RhaS Salmonella dublin (strain CT_02021853)
Q9HTI4 0.000105 47 25 0 100 1 gbdR HTH-type transcriptional regulator GbdR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A0H2ZIC3 0.000105 47 25 0 100 1 gbdR HTH-type transcriptional regulator GbdR Pseudomonas aeruginosa (strain UCBPP-PA14)
O31249 0.000109 46 32 0 81 4 alkR HTH-type transcriptional regulator AlkR Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A8AL27 0.000111 46 25 5 137 3 rhaS HTH-type transcriptional activator RhaS Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P0A2S9 0.000116 46 23 4 163 3 rhaS HTH-type transcriptional activator RhaS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2T0 0.000116 46 23 4 163 3 rhaS HTH-type transcriptional activator RhaS Salmonella typhi
C0Q3L4 0.000116 46 23 4 163 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi C (strain RKS4594)
A9MZC8 0.000116 46 23 4 163 3 rhaS HTH-type transcriptional activator RhaS Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZZ3 0.000116 46 23 4 163 3 rhaS HTH-type transcriptional activator RhaS Salmonella newport (strain SL254)
B5RFC3 0.000116 46 23 4 163 3 rhaS HTH-type transcriptional activator RhaS Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QWY4 0.000116 46 23 4 163 3 rhaS HTH-type transcriptional activator RhaS Salmonella enteritidis PT4 (strain P125109)
B4TBY3 0.000123 46 23 4 163 3 rhaS HTH-type transcriptional activator RhaS Salmonella heidelberg (strain SL476)
Q32A70 0.000138 46 21 6 233 3 rhaS HTH-type transcriptional activator RhaS Shigella dysenteriae serotype 1 (strain Sd197)
B5F0M9 0.000141 46 23 4 163 3 rhaS HTH-type transcriptional activator RhaS Salmonella agona (strain SL483)
B6I4P8 0.000147 46 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain SE11)
Q0TAF8 0.000153 46 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7UNM6 0.000153 46 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B2TVP7 0.000163 46 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q57HG8 0.000163 46 23 4 163 3 rhaS HTH-type transcriptional activator RhaS Salmonella choleraesuis (strain SC-B67)
Q31U84 0.000169 46 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Shigella boydii serotype 4 (strain Sb227)
P09377 0.000169 46 22 2 161 1 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12)
B1IVH3 0.000169 46 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A709 0.000169 46 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O9:H4 (strain HS)
B1XB72 0.000169 46 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12 / DH10B)
C5A073 0.000169 46 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain K12 / MC4100 / BW2952)
B7M6V7 0.000169 46 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O8 (strain IAI1)
B7L9G1 0.000169 46 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain 55989 / EAEC)
B1LMU6 0.00017 46 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain SMS-3-5 / SECEC)
Q3YV71 0.000172 45 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Shigella sonnei (strain Ss046)
Q83PE0 0.000172 45 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Shigella flexneri
Q0SZ95 0.000172 45 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Shigella flexneri serotype 5b (strain 8401)
B7N2P7 0.000175 45 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O81 (strain ED1a)
Q8CXW5 0.000182 45 23 2 151 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A7ZUB7 0.000201 45 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O139:H28 (strain E24377A / ETEC)
B4TPQ9 0.000205 45 23 4 163 3 rhaS HTH-type transcriptional activator RhaS Salmonella schwarzengrund (strain CVM19633)
Q65Q31 0.000205 45 22 1 120 3 rhaS HTH-type transcriptional activator RhaS Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
H9L484 0.000206 43 24 0 94 1 ramA Transcriptional regulator RamA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1R414 0.000232 45 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli (strain UTI89 / UPEC)
B7NFK3 0.000232 45 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A1AI82 0.000232 45 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O1:K1 / APEC
B7NUA1 0.000232 45 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MI37 0.000232 45 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O45:K1 (strain S88 / ExPEC)
A4WG91 0.000243 45 27 3 111 3 rhaS HTH-type transcriptional activator RhaS Enterobacter sp. (strain 638)
A9MI64 0.000284 45 24 4 153 3 rhaS HTH-type transcriptional activator RhaS Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
O33813 0.000474 44 21 0 90 4 lacR Lactose operon transcription activator Staphylococcus xylosus
G3XCU2 0.000734 44 24 1 113 4 argR HTH-type transcriptional regulator ArgR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B5YZ43 0.001 43 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X897 0.001 43 22 2 161 3 rhaS HTH-type transcriptional activator RhaS Escherichia coli O157:H7

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS07325
Feature type CDS
Gene -
Product AraC family transcriptional regulator
Location 1529150 - 1530061 (strand: -1)
Length 912 (nucleotides) / 303 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_500
Orthogroup size 7
N. genomes 6

Actions

Genomic region

Domains

PF06719 AraC-type transcriptional regulator N-terminus
PF12833 Helix-turn-helix domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4977 Transcription (K) K Transcriptional regulator GlxA, contains an amidase domain and an AraC-type DNA-binding HTH domain

Protein Sequence

MNSQEHMERATRKLAGQIEKLTQNTNQSDTDIPGLRLSHWVSPTSPAGYTHISSICLIAQGKKRVLLGEDSFTYDENHFLISSVDLPIIANIIEASEDKPYLALTLELDLHEISQLIAESGLSFNQSTGAQKGIAVGELSEPLLDAFIRLMALLEHPESIKILAPVIKREIFYRMLTTGQGARLNQIVTAGSHSHQISKAIDWLKNNFVRSLSINELAAYAGMSKSAFYTHFRIMTSMTPLQFQKKLRLSEARRLMLTEHLDAATTTFRVGYESPSQFSREYSRLFGAPPLTDIKALRETGSV

Flanking regions ( +/- flanking 50bp)

TACAGCATCAAAGCCGGGAGAATAATTCCCCGGTTACCGATGGAGGCGACATGAACAGCCAGGAACACATGGAGAGAGCAACAAGAAAACTCGCCGGACAAATTGAAAAACTGACACAGAATACGAATCAGTCTGATACTGATATTCCCGGGTTGAGACTCAGCCATTGGGTATCTCCGACATCACCTGCGGGTTATACACATATATCAAGTATTTGTTTGATTGCTCAGGGAAAGAAACGTGTTCTGCTCGGCGAAGACAGTTTCACTTATGATGAGAATCATTTTCTTATTTCATCCGTTGATCTGCCCATTATTGCTAATATTATTGAAGCCAGCGAAGATAAACCCTATCTGGCGCTTACCCTGGAGTTAGATCTGCATGAAATATCACAATTGATTGCAGAAAGTGGCTTATCATTTAATCAGAGTACCGGTGCACAAAAAGGAATTGCGGTCGGTGAGTTATCAGAGCCGTTACTGGATGCCTTTATTCGCCTGATGGCGCTGCTTGAACATCCTGAAAGTATTAAAATCCTCGCCCCGGTTATTAAACGTGAAATTTTTTACCGTATGCTGACTACCGGACAAGGTGCCCGTTTAAATCAGATAGTGACTGCCGGTAGCCATAGTCACCAAATATCTAAGGCCATCGACTGGCTGAAAAATAATTTTGTGAGGTCGTTAAGTATTAATGAACTTGCTGCTTATGCCGGTATGAGTAAATCTGCGTTTTATACACATTTTCGAATAATGACATCAATGACCCCGCTGCAATTTCAGAAAAAACTTCGCCTGAGTGAAGCCCGCCGTTTAATGCTGACTGAACATCTGGATGCGGCTACCACCACATTCAGGGTGGGTTACGAAAGCCCGTCACAATTTAGCCGGGAATACAGCCGCTTGTTTGGCGCACCACCTTTAACCGATATTAAAGCGCTGAGAGAAACGGGATCAGTCTGACCCCGGTACAGGTAAATATGCGTACGATTATTTTTTTCTTTATTTTTGTA