Homologs in group_3722

Help

2 homologs were identified in 1 genome with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
F4V73_RS19395 F4V73_RS19395 74.3 Morganella psychrotolerans - hypothetical protein
F4V73_RS11520 F4V73_RS11520 85.7 Morganella psychrotolerans speFL leader peptide SpeFL

Distribution of the homologs in the orthogroup group_3722

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3722

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0DTV8 1.92e-12 56 76 0 34 1 speFL Leader peptide SpeFL Salmonella typhimurium (strain SL1344)
P0DTV7 5.15e-10 50 67 0 34 1 speFL Leader peptide SpeFL Escherichia coli (strain K12)
P44021 0.000136 37 64 0 25 3 speFL Leader peptide SpeFL Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS19215
Feature type CDS
Gene speFL
Product leader peptide SpeFL
Location 365199 - 365306 (strand: -1)
Length 108 (nucleotides) / 35 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_3722
Orthogroup size 3
N. genomes 2

Actions

Genomic region

Domains

PF10940 Leader peptide SpeFL

Protein Sequence

MENNNRFWPHIRRITHIMMFSHRSCFDFNLFNAQR

Flanking regions ( +/- flanking 50bp)

ATATTAATTTATAGTTGTTATATAGGTCTTAATAATTAACGGATGCGAAAATGGAAAATAATAATCGATTTTGGCCACATATAAGACGTATTACACATATAATGATGTTTTCACATCGTTCATGTTTTGATTTTAATCTTTTCAACGCTCAAAGATAATCTCTCTATTGGCATCCATCACGTGGTTTGCATATTACCAGCGTATGGAT