Homologs in group_706

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03060 FBDBKF_03060 78.3 Morganella morganii S1 rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
EHELCC_07475 EHELCC_07475 78.3 Morganella morganii S2 rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
NLDBIP_07800 NLDBIP_07800 78.3 Morganella morganii S4 rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
LHKJJB_07335 LHKJJB_07335 78.3 Morganella morganii S3 rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
HKOGLL_03595 HKOGLL_03595 78.3 Morganella morganii S5 rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
F4V73_RS11860 F4V73_RS11860 79.7 Morganella psychrotolerans rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase

Distribution of the homologs in the orthogroup group_706

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_706

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P67087 5.12e-154 434 77 1 285 1 rsmI Ribosomal RNA small subunit methyltransferase I Escherichia coli (strain K12)
P67088 5.12e-154 434 77 1 285 3 rsmI Ribosomal RNA small subunit methyltransferase I Escherichia coli O157:H7
Q9KUD9 4.17e-137 391 69 1 277 3 rsmI Ribosomal RNA small subunit methyltransferase I Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9CN04 3.78e-133 381 67 0 271 3 rsmI Ribosomal RNA small subunit methyltransferase I Pasteurella multocida (strain Pm70)
P45298 4.23e-133 381 65 1 278 3 rsmI Ribosomal RNA small subunit methyltransferase I Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8KA29 5.44e-107 315 50 2 288 3 rsmI Ribosomal RNA small subunit methyltransferase I Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57192 6.82e-107 315 52 0 274 3 rsmI Ribosomal RNA small subunit methyltransferase I Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9HVZ3 1.05e-101 301 57 1 276 3 rsmI Ribosomal RNA small subunit methyltransferase I Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q89AY5 3.85e-99 295 47 0 281 3 rsmI Ribosomal RNA small subunit methyltransferase I Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q87B70 3.38e-91 275 52 1 270 3 rsmI Ribosomal RNA small subunit methyltransferase I Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PFV5 7.48e-91 273 52 1 270 3 rsmI Ribosomal RNA small subunit methyltransferase I Xylella fastidiosa (strain 9a5c)
P74038 2.6e-74 232 46 2 269 3 rsmI Ribosomal RNA small subunit methyltransferase I Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9JXE3 1.51e-69 220 42 1 272 3 rsmI Ribosomal RNA small subunit methyltransferase I Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JWJ7 6.44e-69 218 42 1 272 3 rsmI Ribosomal RNA small subunit methyltransferase I Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9KGL2 2.84e-67 214 51 2 223 3 rsmI Ribosomal RNA small subunit methyltransferase I Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q98DM9 8.03e-66 210 44 3 270 3 rsmI Ribosomal RNA small subunit methyltransferase I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P0DF47 1.62e-64 207 43 4 276 3 rsmI Ribosomal RNA small subunit methyltransferase I Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DF46 1.62e-64 207 43 4 276 3 rsmI Ribosomal RNA small subunit methyltransferase I Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q9A186 2.19e-64 206 43 4 276 3 rsmI Ribosomal RNA small subunit methyltransferase I Streptococcus pyogenes serotype M1
Q8P2A6 2.64e-63 204 43 4 276 3 rsmI Ribosomal RNA small subunit methyltransferase I Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q08329 3.32e-63 204 43 4 275 3 rsmI Ribosomal RNA small subunit methyltransferase I (Fragment) Micromonospora olivasterospora
Q5XDL7 1.75e-61 199 42 4 276 3 rsmI Ribosomal RNA small subunit methyltransferase I Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q2NAK3 1.24e-59 194 40 5 284 3 rsmI Ribosomal RNA small subunit methyltransferase I Erythrobacter litoralis (strain HTCC2594)
Q9WZG8 1.11e-53 177 40 3 223 3 rsmI Ribosomal RNA small subunit methyltransferase I Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P37544 1.91e-53 179 44 2 228 3 rsmI Ribosomal RNA small subunit methyltransferase I Bacillus subtilis (strain 168)
Q9ZCJ3 3.7e-50 170 38 2 226 3 rsmI Ribosomal RNA small subunit methyltransferase I Rickettsia prowazekii (strain Madrid E)
B4U6H0 3.61e-46 158 40 5 221 3 rsmI Ribosomal RNA small subunit methyltransferase I Hydrogenobaculum sp. (strain Y04AAS1)
Q98RF5 3.51e-45 155 39 3 218 3 rsmI Ribosomal RNA small subunit methyltransferase I Mycoplasmopsis pulmonis (strain UAB CTIP)
P9WGW7 9.67e-45 156 38 2 228 1 rsmI Ribosomal RNA small subunit methyltransferase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A641 9.67e-45 156 38 2 228 3 rsmI Ribosomal RNA small subunit methyltransferase I Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGW6 1.24e-44 155 38 2 228 3 rsmI Ribosomal RNA small subunit methyltransferase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q661J3 3.7e-44 152 40 3 220 3 rsmI Ribosomal RNA small subunit methyltransferase I Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
O83940 9.89e-42 148 38 4 272 3 rsmI Ribosomal RNA small subunit methyltransferase I Treponema pallidum (strain Nichols)
B0SPB4 4.08e-41 145 43 6 195 3 rsmI Ribosomal RNA small subunit methyltransferase I Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
C5J6H5 1.88e-36 133 38 8 226 3 rsmI Ribosomal RNA small subunit methyltransferase I Mesomycoplasma conjunctivae (strain ATCC 25834 / NCTC 10147 / HRC/581)
P56204 4.56e-36 133 34 8 284 3 rsmI Ribosomal RNA small subunit methyltransferase I Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZLS8 2.88e-35 131 32 7 298 3 rsmI Ribosomal RNA small subunit methyltransferase I Helicobacter pylori (strain J99 / ATCC 700824)
B5Y7N9 1.96e-29 114 34 5 220 3 rsmI Ribosomal RNA small subunit methyltransferase I Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
A0RMQ7 8.05e-29 114 33 8 281 3 rsmI Ribosomal RNA small subunit methyltransferase I Campylobacter fetus subsp. fetus (strain 82-40)
Q053G0 2.69e-25 104 32 5 225 3 rsmI Ribosomal RNA small subunit methyltransferase I Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
P47302 1.42e-21 94 26 5 231 3 rsmI Ribosomal RNA small subunit methyltransferase I Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P75046 1.96e-20 91 26 6 273 3 rsmI Ribosomal RNA small subunit methyltransferase I Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS18375
Feature type CDS
Gene rsmI
Product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
Location 4032526 - 4033404 (strand: 1)
Length 879 (nucleotides) / 292 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_706
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00590 Tetrapyrrole (Corrin/Porphyrin) Methylases
PF23016 RsmI C-terminal HTH domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0313 Translation, ribosomal structure and biogenesis (J) J 16S rRNA C1402 (ribose-2'-O) methylase RsmI

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07056 16S rRNA (cytidine1402-2'-O)-methyltransferase [EC:2.1.1.198] - -

Protein Sequence

MNQPNRAAVTTSTLYIVPTPIGNLGDITQRALDVLSHVDLIAAEDTRHTGLLLQHFAINARLFALHDHNEQQKADQLISKLQQGLSIALVSDAGTPLINDPGYHLVNQCRKNGIKVVPLPGACAAITALSAAGLPSDRFCYEGFLPAKTKSRQDCLRDLAQEPRTLIFYESTHRLLDSLADMVTVWGEARYVVLARELTKTWETIQGMPVGELLNWVREDENRRKGEMVLIVEGYQKPQEDHFAPEVLRTLAILQKELPLKKAAAVTAEIYGVKKNALYKHVIAQNEAEQDQ

Flanking regions ( +/- flanking 50bp)

TGATGTTTTATAATTATGCTCAATTTTAAATCGGTCATTCGGAATAAACAATGAATCAACCTAATCGAGCAGCGGTAACGACATCCACACTGTACATAGTACCCACACCCATTGGTAATCTGGGCGATATCACCCAGCGGGCACTTGATGTGCTGTCTCATGTCGATTTAATAGCTGCAGAAGATACCCGTCATACAGGGCTTCTATTACAGCATTTTGCCATTAACGCACGTTTGTTTGCGTTACATGATCATAATGAACAGCAAAAAGCAGATCAATTAATTAGCAAATTACAACAAGGGCTAAGTATCGCATTAGTCTCTGATGCAGGTACACCATTAATTAATGATCCCGGCTATCATTTAGTCAATCAGTGTCGCAAAAACGGTATAAAAGTGGTGCCATTACCTGGGGCATGTGCGGCAATTACCGCGCTATCAGCCGCCGGATTACCTTCTGACCGTTTTTGTTATGAAGGTTTTTTACCAGCAAAAACAAAAAGTCGTCAAGATTGTTTGCGTGATTTAGCACAAGAGCCACGTACTTTAATCTTTTATGAGTCCACCCACCGTTTATTAGATAGTTTAGCGGATATGGTGACGGTTTGGGGGGAAGCGCGCTATGTTGTATTGGCAAGAGAATTAACCAAAACGTGGGAAACCATTCAAGGAATGCCTGTTGGGGAATTACTTAACTGGGTTCGTGAAGATGAAAATCGCCGTAAAGGGGAAATGGTATTAATTGTTGAAGGGTATCAAAAGCCACAAGAAGACCATTTTGCCCCAGAAGTATTACGCACATTGGCGATTTTACAAAAAGAGTTACCTTTGAAAAAGGCGGCAGCAGTTACCGCTGAGATTTATGGCGTGAAGAAAAATGCGTTGTACAAACACGTCATTGCGCAAAATGAAGCGGAACAAGATCAGTAAAACGATTTTTTGTTTCTTTCGCTATACATTAACGCGGAAAATCCTTATAA