Homologs in group_749

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03335 FBDBKF_03335 66.7 Morganella morganii S1 maf 7-methyl-GTP pyrophosphatase and related NTP pyrophosphatases, Maf/HAM1 superfamily
EHELCC_07200 EHELCC_07200 66.7 Morganella morganii S2 maf 7-methyl-GTP pyrophosphatase and related NTP pyrophosphatases, Maf/HAM1 superfamily
NLDBIP_07525 NLDBIP_07525 66.7 Morganella morganii S4 maf 7-methyl-GTP pyrophosphatase and related NTP pyrophosphatases, Maf/HAM1 superfamily
LHKJJB_07060 LHKJJB_07060 66.7 Morganella morganii S3 maf 7-methyl-GTP pyrophosphatase and related NTP pyrophosphatases, Maf/HAM1 superfamily
HKOGLL_03870 HKOGLL_03870 66.7 Morganella morganii S5 maf 7-methyl-GTP pyrophosphatase and related NTP pyrophosphatases, Maf/HAM1 superfamily
F4V73_RS11600 F4V73_RS11600 64.6 Morganella psychrotolerans - Maf family protein

Distribution of the homologs in the orthogroup group_749

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_749

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N035 6.54e-81 241 60 0 192 3 plu4068 dTTP/UTP pyrophosphatase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q665F6 7.89e-79 236 60 0 194 3 YPTB3562 dTTP/UTP pyrophosphatase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CDV0 7.89e-79 236 60 0 194 3 YPN_3503 dTTP/UTP pyrophosphatase Yersinia pestis bv. Antiqua (strain Nepal516)
P58636 7.89e-79 236 60 0 194 3 YPO3668 dTTP/UTP pyrophosphatase Yersinia pestis
Q1C1M9 7.89e-79 236 60 0 194 3 YPA_3681 dTTP/UTP pyrophosphatase Yersinia pestis bv. Antiqua (strain Antiqua)
Q3YX01 2.11e-78 235 59 0 193 3 yceF2 dTTP/UTP pyrophosphatase Shigella sonnei (strain Ss046)
P58630 5.77e-78 234 58 0 193 3 yhdE dTTP/UTP pyrophosphatase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57J97 5.77e-78 234 58 0 193 3 yceF2 dTTP/UTP pyrophosphatase Salmonella choleraesuis (strain SC-B67)
Q1R692 7.11e-78 234 58 0 193 3 yceF2 dTTP/UTP pyrophosphatase Escherichia coli (strain UTI89 / UPEC)
Q8FD47 7.11e-78 234 58 0 193 3 yhdE dTTP/UTP pyrophosphatase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCL8 7.11e-78 234 58 0 193 3 yceF2 dTTP/UTP pyrophosphatase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q83JE1 1.55e-77 233 58 0 193 3 yhdE Nucleoside triphosphate pyrophosphatase Shigella flexneri
Q32B92 2.12e-77 233 58 0 193 3 yceF dTTP/UTP pyrophosphatase Shigella dysenteriae serotype 1 (strain Sd197)
Q5PJV0 2.79e-77 232 57 0 193 3 yceF2 dTTP/UTP pyrophosphatase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P58631 3.67e-77 232 58 0 193 3 yhdE dTTP/UTP pyrophosphatase Salmonella typhi
P25536 1.18e-76 231 58 0 193 1 yhdE dTTP/UTP pyrophosphatase Escherichia coli (strain K12)
P58629 2.02e-76 230 58 0 193 3 yhdE dTTP/UTP pyrophosphatase Escherichia coli O157:H7
Q31WB6 2.54e-76 230 57 0 193 3 yceF2 dTTP/UTP pyrophosphatase Shigella boydii serotype 4 (strain Sb227)
Q6DAI3 3.47e-75 227 59 0 188 3 ECA0270 dTTP/UTP pyrophosphatase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5E7X6 1.01e-64 200 54 2 187 3 VF_0375 dTTP/UTP pyrophosphatase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q87LC4 2.86e-64 199 54 0 185 3 VP2688 dTTP/UTP pyrophosphatase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6LMA4 2.07e-63 197 51 1 193 3 PBPRA3267 dTTP/UTP pyrophosphatase Photobacterium profundum (strain SS9)
Q9KUU7 8.28e-61 190 53 0 182 3 VC_0418 dTTP/UTP pyrophosphatase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7MHE0 9.65e-59 185 50 0 186 3 VV2931 dTTP/UTP pyrophosphatase Vibrio vulnificus (strain YJ016)
Q8DCG8 9.65e-59 185 50 0 186 3 VV1_1452 dTTP/UTP pyrophosphatase Vibrio vulnificus (strain CMCP6)
Q12IW9 1.08e-57 182 52 3 192 3 Sden_3331 dTTP/UTP pyrophosphatase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q07WQ2 2.87e-57 181 52 2 188 3 Sfri_3735 dTTP/UTP pyrophosphatase Shewanella frigidimarina (strain NCIMB 400)
Q21FT3 4.09e-57 182 51 1 185 3 Sde_3189 dTTP/UTP pyrophosphatase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8EA14 6.6e-55 176 50 2 190 3 SO_4095 dTTP/UTP pyrophosphatase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q5QWE2 7.64e-55 176 48 2 189 3 IL0384 dTTP/UTP pyrophosphatase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q0ABM5 2.25e-54 174 45 2 187 3 Mlg_0408 dTTP/UTP pyrophosphatase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q3KI22 2.82e-54 174 50 1 187 3 Pfl01_0841 dTTP/UTP pyrophosphatase Pseudomonas fluorescens (strain Pf0-1)
Q0HZH0 9.95e-54 172 50 2 190 3 Shewmr7_0482 dTTP/UTP pyrophosphatase Shewanella sp. (strain MR-7)
Q47VG7 1.58e-53 172 52 2 185 3 CPS_4557 dTTP/UTP pyrophosphatase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q0HEI2 2.51e-53 171 49 2 190 3 Shewmr4_3469 dTTP/UTP pyrophosphatase Shewanella sp. (strain MR-4)
Q1QVC0 4.37e-53 171 52 2 191 3 Csal_2237 dTTP/UTP pyrophosphatase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q15ZH0 6.72e-53 170 50 2 191 3 Patl_0186 dTTP/UTP pyrophosphatase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q48E97 3.2e-52 169 49 1 187 3 PSPPH_4169 dTTP/UTP pyrophosphatase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q7P1T8 1.53e-51 167 46 1 186 3 CV_0124 dTTP/UTP pyrophosphatase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q87EA3 2.48e-51 166 48 2 185 3 PD_0415 Nucleoside triphosphate pyrophosphatase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I858 2.48e-51 166 48 2 185 3 XfasM23_0408 Nucleoside triphosphate pyrophosphatase Xylella fastidiosa (strain M23)
Q88PB4 3.09e-51 166 47 1 200 3 maf-1 dTTP/UTP pyrophosphatase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q3IFH5 3.6e-51 166 52 0 183 3 PSHAa2679 dTTP/UTP pyrophosphatase Pseudoalteromonas translucida (strain TAC 125)
A5G7S1 7.14e-51 165 48 2 178 3 Gura_3686 dTTP/UTP pyrophosphatase Geotalea uraniireducens (strain Rf4)
Q4ZNT2 8.2e-51 165 49 1 187 3 Psyr_4160 dTTP/UTP pyrophosphatase Pseudomonas syringae pv. syringae (strain B728a)
Q1GZF7 2.19e-50 164 49 1 183 3 Mfla_2113 dTTP/UTP pyrophosphatase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q6HD71 2.21e-50 164 47 1 185 3 maf dTTP/UTP pyrophosphatase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81LD6 3.23e-50 163 47 1 185 3 maf dTTP/UTP pyrophosphatase Bacillus anthracis
C3L6Y6 3.23e-50 163 47 1 185 3 maf dTTP/UTP pyrophosphatase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P9E0 3.23e-50 163 47 1 185 3 maf dTTP/UTP pyrophosphatase Bacillus anthracis (strain A0248)
Q4KIA3 3.55e-50 164 49 2 190 3 PFL_0899 dTTP/UTP pyrophosphatase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9PEA4 4.26e-50 163 47 2 185 3 XF_1124 Nucleoside triphosphate pyrophosphatase Xylella fastidiosa (strain 9a5c)
Q5FA52 5.54e-50 163 43 1 188 3 NGO0180 dTTP/UTP pyrophosphatase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5P2U3 5.6e-50 163 45 2 195 3 AZOSEA22460 dTTP/UTP pyrophosphatase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q31FH4 5.61e-50 163 45 1 180 3 Tcr_1507 dTTP/UTP pyrophosphatase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B7HQL2 6.84e-50 162 47 1 185 3 maf dTTP/UTP pyrophosphatase Bacillus cereus (strain AH187)
Q46Y94 8.88e-50 162 47 2 191 3 Reut_A2528 dTTP/UTP pyrophosphatase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q633Y9 9.28e-50 162 47 1 185 3 maf dTTP/UTP pyrophosphatase Bacillus cereus (strain ZK / E33L)
Q9K0J8 1.57e-49 162 44 2 188 3 NMB0598 dTTP/UTP pyrophosphatase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q72ZX1 1.6e-49 162 47 1 185 3 maf dTTP/UTP pyrophosphatase Bacillus cereus (strain ATCC 10987 / NRS 248)
C1ETQ1 1.63e-49 162 47 1 185 3 maf dTTP/UTP pyrophosphatase Bacillus cereus (strain 03BB102)
B7JQ48 1.63e-49 162 47 1 185 3 maf dTTP/UTP pyrophosphatase Bacillus cereus (strain AH820)
Q7VKR7 1.78e-49 162 46 1 183 3 HD_1805 Nucleoside triphosphate pyrophosphatase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B9IZ30 2.03e-49 161 47 1 185 3 maf dTTP/UTP pyrophosphatase Bacillus cereus (strain Q1)
Q3BRF4 2.29e-49 161 48 2 186 3 XCV2928 dTTP/UTP pyrophosphatase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q5GXK1 3.58e-49 160 47 2 186 3 XOO3316 dTTP/UTP pyrophosphatase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P0P1 3.58e-49 160 47 2 186 3 XOO3131 dTTP/UTP pyrophosphatase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q2SBH1 5.75e-49 160 47 1 184 3 HCH_05331 dTTP/UTP pyrophosphatase Hahella chejuensis (strain KCTC 2396)
Q65GL2 1.29e-48 159 47 2 185 3 maf dTTP/UTP pyrophosphatase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q1LQB1 1.77e-48 159 45 2 189 3 Rmet_0779 dTTP/UTP pyrophosphatase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B7IIW6 2.98e-48 158 44 1 185 3 maf dTTP/UTP pyrophosphatase Bacillus cereus (strain G9842)
A9VIS9 4.61e-48 158 45 1 185 3 maf dTTP/UTP pyrophosphatase Bacillus mycoides (strain KBAB4)
B7HE87 5.13e-48 158 45 1 185 3 maf dTTP/UTP pyrophosphatase Bacillus cereus (strain B4264)
Q3J7T5 5.9e-48 158 46 1 182 3 Noc_2658 dTTP/UTP pyrophosphatase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q817R9 8.75e-48 157 45 1 185 3 maf dTTP/UTP pyrophosphatase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9CLG6 8.82e-48 157 44 1 190 3 PM1268 dTTP/UTP pyrophosphatase Pasteurella multocida (strain Pm70)
Q8PIX4 9.78e-48 157 47 2 186 3 XAC2771 dTTP/UTP pyrophosphatase Xanthomonas axonopodis pv. citri (strain 306)
Q9JVK3 1.05e-47 157 43 2 188 3 NMA0802 dTTP/UTP pyrophosphatase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A7Z794 1.3e-47 157 46 2 183 3 maf dTTP/UTP pyrophosphatase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q74A46 1.34e-47 157 48 2 177 3 GSU2545 dTTP/UTP pyrophosphatase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q1D912 1.91e-47 157 49 2 179 3 MXAN_2642 dTTP/UTP pyrophosphatase Myxococcus xanthus (strain DK1622)
Q8P7K1 3.1e-47 156 46 2 186 3 XCC2610 dTTP/UTP pyrophosphatase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UWJ9 3.1e-47 156 46 2 186 3 XC_1506 dTTP/UTP pyrophosphatase Xanthomonas campestris pv. campestris (strain 8004)
Q87WS4 5.72e-47 155 49 1 187 3 maf-2 dTTP/UTP pyrophosphatase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q39X87 9.85e-47 155 46 2 177 3 Gmet_0895 dTTP/UTP pyrophosphatase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A7GTD6 1.13e-46 154 46 1 190 3 maf dTTP/UTP pyrophosphatase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q9HVU3 1.27e-46 155 50 1 188 3 PA4478 dTTP/UTP pyrophosphatase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6AMI5 1.59e-46 154 49 2 176 3 DP1711 dTTP/UTP pyrophosphatase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B8JH92 3.53e-46 153 46 3 183 3 A2cp1_1450 dTTP/UTP pyrophosphatase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q2IKU4 4.79e-46 153 46 2 183 3 Adeh_2502 dTTP/UTP pyrophosphatase Anaeromyxobacter dehalogenans (strain 2CP-C)
A8FFU1 5.24e-46 152 44 1 185 3 maf dTTP/UTP pyrophosphatase Bacillus pumilus (strain SAFR-032)
Q2KYV3 5.76e-46 153 44 2 187 3 BAV2213 dTTP/UTP pyrophosphatase Bordetella avium (strain 197N)
A6TQH7 6.53e-46 152 44 3 185 3 Amet_2288 dTTP/UTP pyrophosphatase Alkaliphilus metalliredigens (strain QYMF)
Q0VS67 1.24e-45 152 46 1 182 3 ABO_0533 dTTP/UTP pyrophosphatase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q18B07 1.55e-45 152 41 2 189 3 CD630_11430 dTTP/UTP pyrophosphatase Clostridioides difficile (strain 630)
Q47JQ0 1.92e-45 152 43 2 196 3 Daro_0172 dTTP/UTP pyrophosphatase Dechloromonas aromatica (strain RCB)
Q7W7U4 2.27e-45 152 45 2 187 3 BPP2416 dTTP/UTP pyrophosphatase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WL84 2.27e-45 152 45 2 187 3 BB1865 dTTP/UTP pyrophosphatase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B4UJ23 2.52e-45 151 46 3 183 3 AnaeK_1353 dTTP/UTP pyrophosphatase Anaeromyxobacter sp. (strain K)
Q02169 3.18e-45 150 43 1 182 1 maf dTTP/UTP pyrophosphatase Bacillus subtilis (strain 168)
B5EHR3 3.87e-45 150 46 2 178 3 Gbem_2708 dTTP/UTP pyrophosphatase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q9K8H3 4.03e-45 150 43 1 178 3 maf dTTP/UTP pyrophosphatase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q0AWG2 4.86e-45 150 44 2 181 3 Swol_1643 dTTP/UTP pyrophosphatase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q2YC50 6.35e-45 150 44 2 193 3 Nmul_A0363 dTTP/UTP pyrophosphatase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q60BT7 8.39e-45 150 45 0 181 3 MCA0378 dTTP/UTP pyrophosphatase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q12C38 1.2e-44 150 44 2 189 3 Bpro_1974 dTTP/UTP pyrophosphatase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q7VWE3 1.22e-44 150 44 2 187 3 BP2314 dTTP/UTP pyrophosphatase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A8MHM5 1.51e-44 149 48 5 181 3 Clos_1767 dTTP/UTP pyrophosphatase Alkaliphilus oremlandii (strain OhILAs)
Q3SG65 2.1e-44 149 43 3 193 3 Tbd_2438 dTTP/UTP pyrophosphatase Thiobacillus denitrificans (strain ATCC 25259)
Q82XC7 2.12e-44 149 44 3 194 3 NE0356 dTTP/UTP pyrophosphatase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q1IV55 2.7e-44 148 47 1 172 3 Acid345_0240 dTTP/UTP pyrophosphatase Koribacter versatilis (strain Ellin345)
A3DBJ9 3.39e-44 148 41 3 193 3 Cthe_0087 dTTP/UTP pyrophosphatase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q5KWN2 3.7e-44 148 50 2 174 3 maf dTTP/UTP pyrophosphatase Geobacillus kaustophilus (strain HTA426)
Q67SI8 1.54e-43 147 44 2 188 3 STH370 dTTP/UTP pyrophosphatase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
C5D5H8 1.62e-43 146 47 1 178 3 maf dTTP/UTP pyrophosphatase Geobacillus sp. (strain WCH70)
C6E559 6.78e-43 145 44 2 178 3 GM21_1532 dTTP/UTP pyrophosphatase Geobacter sp. (strain M21)
Q5JI98 1.75e-42 144 45 1 172 3 TK0954 dTTP/UTP pyrophosphatase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q2RL24 2.33e-42 144 47 5 189 3 Moth_0535 dTTP/UTP pyrophosphatase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q6FDX8 9.27e-42 142 43 2 180 3 ACIAD0829 dTTP/UTP pyrophosphatase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q0SR36 1.05e-41 142 45 4 177 3 CPR_2112 dTTP/UTP pyrophosphatase Clostridium perfringens (strain SM101 / Type A)
A0PZG3 1.09e-41 142 46 4 174 3 NT01CX_1686 dTTP/UTP pyrophosphatase Clostridium novyi (strain NT)
Q6MQJ7 1.42e-41 141 40 3 188 3 Bd0469 dTTP/UTP pyrophosphatase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
C3L3L1 2.76e-41 141 42 5 192 3 CLJ_B3262 dTTP/UTP pyrophosphatase Clostridium botulinum (strain 657 / Type Ba4)
A5N6I4 2.87e-41 140 44 4 179 3 CKL_0864 dTTP/UTP pyrophosphatase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E003 2.87e-41 140 44 4 179 3 CKR_0777 dTTP/UTP pyrophosphatase Clostridium kluyveri (strain NBRC 12016)
B6YWV3 3.51e-41 140 46 2 172 3 TON_1078 dTTP/UTP pyrophosphatase Thermococcus onnurineus (strain NA1)
A7HA27 4.21e-41 140 45 2 184 3 Anae109_1366 dTTP/UTP pyrophosphatase Anaeromyxobacter sp. (strain Fw109-5)
Q2LSD6 7.23e-41 140 46 2 176 3 SYNAS_11200 dTTP/UTP pyrophosphatase Syntrophus aciditrophicus (strain SB)
B1KZT1 8.42e-41 139 42 5 190 3 CLK_2388 dTTP/UTP pyrophosphatase Clostridium botulinum (strain Loch Maree / Type A3)
A5D426 1.06e-40 139 42 2 187 3 PTH_0815 dTTP/UTP pyrophosphatase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
C5A216 1.45e-40 139 44 2 172 3 TGAM_1933 dTTP/UTP pyrophosphatase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
C1FVY3 2.6e-40 138 41 4 191 3 CLM_3400 dTTP/UTP pyrophosphatase Clostridium botulinum (strain Kyoto / Type A2)
Q5LLE9 2.62e-40 138 44 2 183 3 SPOA0078 dTTP/UTP pyrophosphatase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q1GLE1 2.67e-40 138 43 3 182 3 TM1040_3556 dTTP/UTP pyrophosphatase Ruegeria sp. (strain TM1040)
A9KHL6 3.12e-40 138 38 3 192 3 Cphy_1933 dTTP/UTP pyrophosphatase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B1IM03 3.44e-40 138 41 4 191 3 CLD_1540 dTTP/UTP pyrophosphatase Clostridium botulinum (strain Okra / Type B1)
Q1GRU5 4.79e-40 137 45 4 188 3 Sala_1915 dTTP/UTP pyrophosphatase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
P58634 6.25e-40 138 44 3 192 3 RSc2196 dTTP/UTP pyrophosphatase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q0TNG7 8.26e-40 137 44 4 177 3 CPF_2400 dTTP/UTP pyrophosphatase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A5I684 1.25e-39 137 41 5 195 3 CBO3004 dTTP/UTP pyrophosphatase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXW4 1.25e-39 137 41 5 195 3 CLB_3029 dTTP/UTP pyrophosphatase Clostridium botulinum (strain ATCC 19397 / Type A)
Q8XIH4 1.51e-39 136 44 4 177 3 maf dTTP/UTP pyrophosphatase Clostridium perfringens (strain 13 / Type A)
Q3AF81 1.69e-39 136 42 4 177 3 CHY_0340 dTTP/UTP pyrophosphatase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q24SM2 1.77e-39 137 46 2 178 3 DSY3181 dTTP/UTP pyrophosphatase Desulfitobacterium hafniense (strain Y51)
Q0C2H1 3.21e-39 135 43 4 181 3 HNE_1355 dTTP/UTP pyrophosphatase Hyphomonas neptunium (strain ATCC 15444)
A7GHM0 3.42e-39 135 41 4 191 3 CLI_3058 dTTP/UTP pyrophosphatase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
O67613 4.27e-39 135 38 2 184 3 aq_1718 dTTP/UTP pyrophosphatase Aquifex aeolicus (strain VF5)
B9MRU6 4.95e-39 135 40 2 190 3 Athe_1300 dTTP/UTP pyrophosphatase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
A4SE83 5.41e-39 135 44 3 176 3 Cvib_0777 dTTP/UTP pyrophosphatase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q3A7I0 8.84e-39 135 44 2 177 3 Pcar_0404 dTTP/UTP pyrophosphatase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q21WP7 1.2e-38 134 39 2 192 3 Rfer_2081 dTTP/UTP pyrophosphatase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B5YF11 3.84e-38 133 37 3 187 3 DICTH_1299 dTTP/UTP pyrophosphatase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
B0K437 4e-38 132 42 2 176 3 Teth514_2136 dTTP/UTP pyrophosphatase Thermoanaerobacter sp. (strain X514)
B0KAE1 4e-38 132 42 2 176 3 Teth39_1454 dTTP/UTP pyrophosphatase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q63VT5 4.43e-38 133 44 3 191 3 BPSL1159 dTTP/UTP pyrophosphatase Burkholderia pseudomallei (strain K96243)
Q3JUG5 4.43e-38 133 44 3 191 3 BURPS1710b_1378 dTTP/UTP pyrophosphatase Burkholderia pseudomallei (strain 1710b)
Q62II4 4.43e-38 133 44 3 191 3 BMA1890 dTTP/UTP pyrophosphatase Burkholderia mallei (strain ATCC 23344)
B8E0U2 1.09e-37 132 38 3 183 3 Dtur_1405 dTTP/UTP pyrophosphatase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
A4XKL5 1.19e-37 132 38 3 192 3 Csac_1865 dTTP/UTP pyrophosphatase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q97JN3 2.89e-37 130 40 3 185 3 CA_C1240 dTTP/UTP pyrophosphatase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q2SZT6 3.05e-37 131 43 3 191 3 BTH_I1009 dTTP/UTP pyrophosphatase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q5GT91 4.1e-37 130 39 3 189 3 Wbm0192 dTTP/UTP pyrophosphatase Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q892M0 4.74e-37 130 39 4 188 3 CTC_02076 dTTP/UTP pyrophosphatase Clostridium tetani (strain Massachusetts / E88)
A4J7K7 9.12e-37 129 40 3 178 3 Dred_2550 dTTP/UTP pyrophosphatase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
B3CL80 9.72e-37 129 39 3 189 3 WP0036 dTTP/UTP pyrophosphatase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q8RBC6 9.82e-37 129 40 2 185 3 maf dTTP/UTP pyrophosphatase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B2V089 2.24e-36 128 38 3 184 3 CLH_0546 dTTP/UTP pyrophosphatase Clostridium botulinum (strain Alaska E43 / Type E3)
B2TK54 3.14e-36 127 39 3 184 3 CLL_A0561 dTTP/UTP pyrophosphatase Clostridium botulinum (strain Eklund 17B / Type B)
A6LQP7 7.06e-36 127 42 2 173 3 Cbei_0489 dTTP/UTP pyrophosphatase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q8KDS1 9.45e-36 127 41 2 181 3 maf dTTP/UTP pyrophosphatase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q5WEQ9 1.44e-35 126 41 3 187 3 maf dTTP/UTP pyrophosphatase Shouchella clausii (strain KSM-K16)
C0R2U8 1.98e-35 126 38 3 189 3 WRi_004530 dTTP/UTP pyrophosphatase Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q1BUW3 2.18e-35 126 40 3 191 3 Bcen_1688 dTTP/UTP pyrophosphatase Burkholderia orbicola (strain AU 1054)
B2RIL9 3.04e-35 125 42 4 176 3 PGN_0695 dTTP/UTP pyrophosphatase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
B1I4S1 3.38e-35 125 42 4 180 3 Daud_1468 Nucleoside triphosphate pyrophosphatase Desulforudis audaxviator (strain MP104C)
Q1QDI9 3.59e-35 126 38 7 220 3 Pcryo_0481 dTTP/UTP pyrophosphatase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q73I47 4.65e-35 125 38 3 189 3 WD_0333 dTTP/UTP pyrophosphatase Wolbachia pipientis wMel
Q169N3 4.94e-35 125 42 2 178 3 RD1_1686 dTTP/UTP pyrophosphatase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q9A5V5 4.98e-35 125 40 3 184 3 CC_2342 dTTP/UTP pyrophosphatase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
C4ZDP0 7.35e-35 125 41 5 192 3 EUBREC_3290 dTTP/UTP pyrophosphatase Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q142M3 9.21e-35 124 39 3 191 3 Bxeno_A1178 dTTP/UTP pyrophosphatase Paraburkholderia xenovorans (strain LB400)
B3QNY9 1.12e-34 124 39 2 193 3 Cpar_1237 dTTP/UTP pyrophosphatase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q2S4I1 1.16e-34 124 43 6 176 3 SRU_0763 dTTP/UTP pyrophosphatase Salinibacter ruber (strain DSM 13855 / M31)
Q82ZA4 1.96e-34 123 41 3 181 3 maf dTTP/UTP pyrophosphatase Enterococcus faecalis (strain ATCC 700802 / V583)
Q8RFE6 2.17e-34 123 36 3 174 3 FN0759 dTTP/UTP pyrophosphatase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q9RV24 2.21e-34 123 41 2 173 3 DR_1206 dTTP/UTP pyrophosphatase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q8U476 2.29e-34 123 40 3 183 3 PF0216 dTTP/UTP pyrophosphatase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q39E95 2.52e-34 124 39 3 188 3 Bcep18194_A5627 dTTP/UTP pyrophosphatase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q6MDL5 3.46e-34 122 37 2 171 3 pc0610 dTTP/UTP pyrophosphatase Protochlamydia amoebophila (strain UWE25)
Q7NH22 5.09e-34 122 41 1 184 3 glr2715 dTTP/UTP pyrophosphatase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q12TU6 6.09e-34 122 38 3 178 3 Mbur_2269 dTTP/UTP pyrophosphatase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q3B3P0 6.85e-34 122 40 3 192 3 Plut_1179 dTTP/UTP pyrophosphatase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q5NNS3 7.35e-34 122 40 3 182 3 ZMO1013 dTTP/UTP pyrophosphatase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q46BZ6 8.69e-34 122 39 3 178 3 Mbar_A1652 dTTP/UTP pyrophosphatase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q7MWG0 1.19e-33 121 42 4 176 3 maf dTTP/UTP pyrophosphatase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q2RQN0 2.39e-33 121 41 3 182 3 Rru_A2768 dTTP/UTP pyrophosphatase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q4FUF9 2.97e-33 121 37 7 222 3 Psyc_0486 dTTP/UTP pyrophosphatase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q0AQL3 7.26e-33 120 41 3 181 3 Mmar10_1131 dTTP/UTP pyrophosphatase Maricaulis maris (strain MCS10)
Q1IYX1 8.73e-33 119 40 2 175 3 Dgeo_1267 dTTP/UTP pyrophosphatase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
B7IFS5 8.83e-33 119 40 1 174 3 THA_448 dTTP/UTP pyrophosphatase Thermosipho africanus (strain TCF52B)
Q2W1Y3 1.08e-32 119 40 3 187 3 amb3338 dTTP/UTP pyrophosphatase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q28NC5 1.13e-32 119 39 3 182 3 Jann_2870 Nucleoside triphosphate pyrophosphatase 2 Jannaschia sp. (strain CCS1)
B9KIX1 1.15e-32 119 37 3 189 3 AMF_588 Nucleoside triphosphate pyrophosphatase Anaplasma marginale (strain Florida)
Q89V00 2.05e-32 119 41 3 185 3 blr1259 dTTP/UTP pyrophosphatase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q20Y49 3.02e-32 118 41 4 185 3 RPC_4414 dTTP/UTP pyrophosphatase Rhodopseudomonas palustris (strain BisB18)
Q92S22 3.58e-32 118 39 3 186 3 R00615 dTTP/UTP pyrophosphatase Rhizobium meliloti (strain 1021)
Q38YR2 4.64e-32 117 39 2 173 3 LCA_0364 dTTP/UTP pyrophosphatase Latilactobacillus sakei subsp. sakei (strain 23K)
B2UPE6 4.8e-32 117 40 1 170 3 Amuc_0586 dTTP/UTP pyrophosphatase Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
A5EAG4 7.21e-32 117 40 3 187 3 BBta_0900 dTTP/UTP pyrophosphatase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q11LY4 1.05e-31 117 40 3 187 3 Meso_0186 dTTP/UTP pyrophosphatase Chelativorans sp. (strain BNC1)
A6LJI7 1.21e-31 115 37 2 170 3 Tmel_0214 dTTP/UTP pyrophosphatase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q5PAF5 1.21e-31 116 36 3 189 3 AM793 Nucleoside triphosphate pyrophosphatase Anaplasma marginale (strain St. Maries)
Q2IRX7 1.69e-31 116 39 4 187 3 RPB_4346 dTTP/UTP pyrophosphatase Rhodopseudomonas palustris (strain HaA2)
Q3SVZ7 1.73e-31 116 41 3 187 3 Nwi_0277 dTTP/UTP pyrophosphatase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q8G2R6 2.29e-31 116 40 3 187 3 maf-1 dTTP/UTP pyrophosphatase Brucella suis biovar 1 (strain 1330)
Q8YF55 2.29e-31 116 40 3 187 3 BMEI1672 dTTP/UTP pyrophosphatase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q57FA3 2.29e-31 116 40 3 187 3 BruAb1_0276 dTTP/UTP pyrophosphatase Brucella abortus biovar 1 (strain 9-941)
Q2YPC2 2.29e-31 116 40 3 187 3 BAB1_0281 dTTP/UTP pyrophosphatase Brucella abortus (strain 2308)
Q1QRF9 2.33e-31 115 38 3 189 3 Nham_0292 dTTP/UTP pyrophosphatase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q8UHX5 2.68e-31 115 42 3 187 3 maf1 dTTP/UTP pyrophosphatase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9UXZ1 3.6e-31 115 40 5 172 3 PYRAB17160 dTTP/UTP pyrophosphatase Pyrococcus abyssi (strain GE5 / Orsay)
A6L391 3.83e-31 115 40 2 172 3 BVU_2498 dTTP/UTP pyrophosphatase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q5FS71 3.9e-31 115 40 2 185 3 GOX1003 dTTP/UTP pyrophosphatase Gluconobacter oxydans (strain 621H)
Q130J6 4.35e-31 115 39 4 187 3 RPD_4276 dTTP/UTP pyrophosphatase Rhodopseudomonas palustris (strain BisB5)
Q2GKV0 4.75e-31 114 38 3 192 3 APH_0396 Nucleoside triphosphate pyrophosphatase Anaplasma phagocytophilum (strain HZ)
B8I6Q1 5.12e-31 114 40 4 179 3 Ccel_2565 dTTP/UTP pyrophosphatase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q035Z4 5.66e-31 114 39 3 173 3 LSEI_2233 dTTP/UTP pyrophosphatase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q2GGV6 5.86e-31 114 36 3 188 3 ECH_0512 Nucleoside triphosphate pyrophosphatase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
B3W9W2 6.03e-31 114 39 3 174 3 LCABL_24150 dTTP/UTP pyrophosphatase Lacticaseibacillus casei (strain BL23)
Q6N181 8.74e-31 114 39 3 187 3 RPA4527 dTTP/UTP pyrophosphatase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B9KXM8 1.14e-30 114 40 2 184 3 trd_0215 dTTP/UTP pyrophosphatase Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
B1LB65 1.17e-30 114 39 5 184 3 TRQ2_1219 dTTP/UTP pyrophosphatase Thermotoga sp. (strain RQ2)
Q9X1P2 1.17e-30 114 39 5 184 3 TM_1556 dTTP/UTP pyrophosphatase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
O59604 1.3e-30 113 38 5 182 3 PH1941 dTTP/UTP pyrophosphatase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q5HB21 1.31e-30 113 37 4 191 3 Erum5100 Nucleoside triphosphate pyrophosphatase Ehrlichia ruminantium (strain Welgevonden)
A5IM27 1.38e-30 114 39 5 184 3 Tpet_1236 dTTP/UTP pyrophosphatase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q989F1 1.64e-30 114 40 4 187 3 mll6452 dTTP/UTP pyrophosphatase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8TSP7 2.91e-30 112 36 3 178 3 MA_0748 dTTP/UTP pyrophosphatase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8PVQ2 5.15e-30 112 37 3 178 3 MM_1910 dTTP/UTP pyrophosphatase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q73K74 6.07e-30 112 38 4 190 3 TDE_2348 dTTP/UTP pyrophosphatase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q3J086 6.24e-30 112 43 3 174 3 RHOS4_22300 dTTP/UTP pyrophosphatase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q823U1 8.05e-30 111 32 2 184 3 CCA_00314 dTTP/UTP pyrophosphatase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q3AQS4 8.13e-30 111 38 4 191 3 Cag_1393 dTTP/UTP pyrophosphatase Chlorobium chlorochromatii (strain CaD3)
Q253S7 1.22e-29 111 33 2 184 3 CF0689 dTTP/UTP pyrophosphatase Chlamydia felis (strain Fe/C-56)
A9NE14 1.54e-29 110 36 4 177 3 ACL_1383 dTTP/UTP pyrophosphatase Acholeplasma laidlawii (strain PG-8A)
Q3YRV1 1.62e-29 110 36 3 188 3 Ecaj_0518 Nucleoside triphosphate pyrophosphatase Ehrlichia canis (strain Jake)
Q64R56 1.69e-29 110 38 2 172 3 BF3281 dTTP/UTP pyrophosphatase Bacteroides fragilis (strain YCH46)
Q5FGZ7 2.27e-29 110 37 4 191 3 ERGA_CDS_05250 Nucleoside triphosphate pyrophosphatase Ehrlichia ruminantium (strain Gardel)
Q5LAQ8 2.76e-29 110 38 2 172 3 BF3120 dTTP/UTP pyrophosphatase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
B4SA80 3.48e-29 110 35 2 187 3 Ppha_1527 dTTP/UTP pyrophosphatase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
O95671 4.04e-29 116 39 4 185 1 ASMTL Probable bifunctional dTTP/UTP pyrophosphatase/methyltransferase protein Homo sapiens
Q04XA6 5.13e-29 109 37 3 170 3 LBL_2976 dTTP/UTP pyrophosphatase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04NX0 5.13e-29 109 37 3 170 3 LBJ_3012 dTTP/UTP pyrophosphatase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
A0M2D8 7.92e-29 109 34 1 183 3 GFO_1813 dTTP/UTP pyrophosphatase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q6G132 9.02e-29 110 37 4 198 3 BQ11190 dTTP/UTP pyrophosphatase Bartonella quintana (strain Toulouse)
Q2G9H1 3.02e-28 107 42 3 181 3 Saro_1057 dTTP/UTP pyrophosphatase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A5FQJ4 3.67e-28 108 36 4 183 3 DehaBAV1_0949 dTTP/UTP pyrophosphatase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q72JE7 4.25e-28 107 36 3 181 3 TT_C0825 dTTP/UTP pyrophosphatase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q5SJ26 7.59e-28 106 36 3 181 3 TTHA1188 dTTP/UTP pyrophosphatase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q2KCN4 9.35e-28 106 40 3 186 3 RHE_CH00585 dTTP/UTP pyrophosphatase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8A749 1.13e-27 106 37 2 172 3 BT_1676 dTTP/UTP pyrophosphatase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q6G253 1.2e-27 107 37 4 198 3 BH14130 dTTP/UTP pyrophosphatase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q3ZY38 1.29e-27 107 36 4 183 3 cbdbA1046 dTTP/UTP pyrophosphatase Dehalococcoides mccartyi (strain CBDB1)
Q1MLP2 1.32e-27 106 39 3 186 3 RL0617 dTTP/UTP pyrophosphatase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8FA20 1.44e-27 105 37 3 170 3 LA_0017 dTTP/UTP pyrophosphatase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72WC1 1.44e-27 105 37 3 170 3 LIC_10016 dTTP/UTP pyrophosphatase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q315F5 1.52e-27 106 41 3 175 3 Dde_0640 dTTP/UTP pyrophosphatase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A6L8E5 1.56e-27 105 36 2 172 3 BDI_0169 dTTP/UTP pyrophosphatase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q3IHD5 6.54e-27 104 32 3 185 3 PSHAa1813 7-methyl-GTP pyrophosphatase Pseudoalteromonas translucida (strain TAC 125)
O84353 7.86e-27 103 30 2 184 3 CT_349 dTTP/UTP pyrophosphatase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KM09 7.86e-27 103 30 2 184 3 CTA_0378 dTTP/UTP pyrophosphatase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
A5FFP4 7.98e-27 103 37 3 172 3 Fjoh_2955 dTTP/UTP pyrophosphatase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
B0BBY3 1.61e-26 103 30 2 184 3 CTLon_0601 dTTP/UTP pyrophosphatase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B7R8 1.61e-26 103 30 2 184 3 CTL0603 dTTP/UTP pyrophosphatase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q606K9 1.99e-26 103 35 3 182 3 MCA2007 7-methyl-GTP pyrophosphatase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
P58628 2.07e-26 102 36 3 179 3 yceF 7-methyl-GTP pyrophosphatase Salmonella typhi
Q0BTC5 2.32e-26 103 37 4 194 3 GbCGDNIH1_1029 dTTP/UTP pyrophosphatase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q5L6G5 3.03e-26 102 33 2 182 3 CAB310 dTTP/UTP pyrophosphatase Chlamydia abortus (strain DSM 27085 / S26/3)
Q11VI6 3.52e-26 102 35 4 175 3 CHU_1308 dTTP/UTP pyrophosphatase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q5PGT7 4.06e-26 102 36 3 179 3 yceF1 7-methyl-GTP pyrophosphatase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q55G28 4.11e-26 102 34 6 183 3 DDB_G0267852 Nucleoside triphosphate pyrophosphatase Dictyostelium discoideum
Q3A587 4.37e-26 102 33 4 189 3 Pcar_1221 7-methyl-GTP pyrophosphatase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
P58627 5.08e-26 102 36 3 179 1 yceF 7-methyl-GTP pyrophosphatase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6D694 5.64e-26 102 35 4 179 3 ECA1791 7-methyl-GTP pyrophosphatase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q57QG8 5.77e-26 101 36 3 179 3 yceF1 7-methyl-GTP pyrophosphatase Salmonella choleraesuis (strain SC-B67)
B8HN65 7.57e-26 101 33 1 177 3 Cyan7425_4892 Nucleoside triphosphate pyrophosphatase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q8FIP6 7.96e-26 101 35 3 179 3 yceF 7-methyl-GTP pyrophosphatase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8GTV6 8.03e-26 102 37 3 182 3 A1G_06950 Nucleoside triphosphate pyrophosphatase Rickettsia rickettsii (strain Sheila Smith)
B0BVE4 8.03e-26 102 37 3 182 3 RrIowa_1484 Nucleoside triphosphate pyrophosphatase Rickettsia rickettsii (strain Iowa)
C4K258 8.03e-26 102 37 3 182 3 RPR_05215 Nucleoside triphosphate pyrophosphatase Rickettsia peacockii (strain Rustic)
B2KC30 8.38e-26 100 34 5 189 3 Emin_0602 dTTP/UTP pyrophosphatase Elusimicrobium minutum (strain Pei191)
Q72EP2 8.48e-26 101 40 4 180 3 DVU_0527 dTTP/UTP pyrophosphatase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A6GZH5 9.88e-26 101 36 1 170 3 FP1422 dTTP/UTP pyrophosphatase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q0A8R1 1.15e-25 101 37 3 176 3 Mlg_1427 7-methyl-GTP pyrophosphatase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q2JNH4 1.46e-25 100 35 1 174 3 CYB_0709 Nucleoside triphosphate pyrophosphatase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q0VQN6 1.68e-25 100 34 4 188 3 ABO_1064 7-methyl-GTP pyrophosphatase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q2KUK9 1.7e-25 100 34 2 183 3 BAV1115 7-methyl-GTP pyrophosphatase Bordetella avium (strain 197N)
Q4UJZ5 1.82e-25 100 37 3 182 3 RF_1293 Nucleoside triphosphate pyrophosphatase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P58626 2.15e-25 100 35 3 179 3 yceF 7-methyl-GTP pyrophosphatase Escherichia coli O157:H7
Q3Z330 2.29e-25 100 35 3 179 3 yceF1 7-methyl-GTP pyrophosphatase Shigella sonnei (strain Ss046)
P0A730 2.29e-25 100 35 3 179 3 yceF 7-methyl-GTP pyrophosphatase Shigella flexneri
Q1RD70 2.29e-25 100 35 3 179 3 yceF1 7-methyl-GTP pyrophosphatase Escherichia coli (strain UTI89 / UPEC)
P0A729 2.29e-25 100 35 3 179 1 yceF 7-methyl-GTP pyrophosphatase Escherichia coli (strain K12)
Q0TIY7 2.29e-25 100 35 3 179 3 yceF1 7-methyl-GTP pyrophosphatase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q31ZE2 2.69e-25 100 35 3 179 3 yceF1 7-methyl-GTP pyrophosphatase Shigella boydii serotype 4 (strain Sb227)
Q15TZ2 3.95e-25 99 35 5 188 3 Patl_2128 7-methyl-GTP pyrophosphatase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q1RK90 4.35e-25 99 35 2 182 3 RBE_0143 Nucleoside triphosphate pyrophosphatase Rickettsia bellii (strain RML369-C)
A8GXY9 4.35e-25 99 35 2 182 3 A1I_07195 Nucleoside triphosphate pyrophosphatase Rickettsia bellii (strain OSU 85-389)
Q92G57 6.13e-25 99 36 3 182 3 RC1266 Nucleoside triphosphate pyrophosphatase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q482K5 6.92e-25 99 31 4 190 3 CPS_2292 7-methyl-GTP pyrophosphatase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B0SK44 7.84e-25 98 37 3 170 3 LEPBI_I0014 dTTP/UTP pyrophosphatase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0S919 7.84e-25 98 37 3 170 3 LBF_0016 dTTP/UTP pyrophosphatase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q7VB43 1.32e-24 98 31 3 191 3 maf Nucleoside triphosphate pyrophosphatase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
C3PLU6 1.33e-24 99 37 3 182 3 RAF_ORF1157 Nucleoside triphosphate pyrophosphatase Rickettsia africae (strain ESF-5)
Q2SK56 2.14e-24 97 33 5 187 3 HCH_02139 7-methyl-GTP pyrophosphatase Hahella chejuensis (strain KCTC 2396)
Q9PK45 2.71e-24 97 29 2 184 3 TC_0628 Nucleoside triphosphate pyrophosphatase Chlamydia muridarum (strain MoPn / Nigg)
Q3JAF4 3.49e-24 97 36 3 185 3 Noc_1720 7-methyl-GTP pyrophosphatase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q5E405 3.91e-24 97 31 3 176 3 VF_1746 7-methyl-GTP pyrophosphatase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q2GCP9 5.21e-24 97 35 3 179 3 NSE_0881 Nucleoside triphosphate pyrophosphatase Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
A8GQ13 6.09e-24 96 35 2 182 3 A1C_06305 Nucleoside triphosphate pyrophosphatase Rickettsia akari (strain Hartford)
Q2JXB4 6.94e-24 96 35 1 172 3 CYA_0360 Nucleoside triphosphate pyrophosphatase Synechococcus sp. (strain JA-3-3Ab)
Q1QX59 8.07e-24 96 34 3 179 3 Csal_1596 7-methyl-GTP pyrophosphatase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q8DJC5 8.42e-24 96 33 3 175 3 tlr1302 Nucleoside triphosphate pyrophosphatase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B0JH94 8.55e-24 96 30 2 186 3 MAE_24240 Nucleoside triphosphate pyrophosphatase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q8D8G2 2.87e-23 94 34 2 164 3 VV1_3015 7-methyl-GTP pyrophosphatase Vibrio vulnificus (strain CMCP6)
Q3Z7G4 2.91e-23 95 35 4 174 3 DET1120 dTTP/UTP pyrophosphatase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q9Z9F9 3.65e-23 94 32 4 187 3 CPn_0022 Nucleoside triphosphate pyrophosphatase Chlamydia pneumoniae
A5CCC1 3.78e-23 94 32 4 192 3 OTBS_0250 Nucleoside triphosphate pyrophosphatase Orientia tsutsugamushi (strain Boryong)
B0C1T2 4.09e-23 94 31 1 186 3 AM1_1059 Nucleoside triphosphate pyrophosphatase Acaryochloris marina (strain MBIC 11017)
Q31HS1 4.49e-23 94 34 3 182 3 Tcr_0706 7-methyl-GTP pyrophosphatase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A8F031 4.51e-23 94 35 2 182 3 A1E_05240 Nucleoside triphosphate pyrophosphatase Rickettsia canadensis (strain McKiel)
Q0HTU8 5.87e-23 94 31 4 192 3 Shewmr7_2472 7-methyl-GTP pyrophosphatase Shewanella sp. (strain MR-7)
Q88LM1 6.92e-23 93 32 3 179 3 maf-2 7-methyl-GTP pyrophosphatase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q7N380 9e-23 93 32 4 188 3 plu2839 7-methyl-GTP pyrophosphatase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7V6H8 1.16e-22 92 33 1 171 3 PMT_1181 Nucleoside triphosphate pyrophosphatase Prochlorococcus marinus (strain MIT 9313)
Q28VZ8 1.67e-22 92 33 4 187 3 Jann_0197 Nucleoside triphosphate pyrophosphatase 1 Jannaschia sp. (strain CCS1)
Q6MKE8 1.93e-22 92 33 3 177 3 Bd2448 7-methyl-GTP pyrophosphatase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q6LSX6 2.16e-22 92 33 4 179 3 PBPRA1189 7-methyl-GTP pyrophosphatase Photobacterium profundum (strain SS9)
Q7MM04 2.29e-22 92 34 2 164 3 VV1269 7-methyl-GTP pyrophosphatase Vibrio vulnificus (strain YJ016)
A2C7X9 3.06e-22 92 32 1 173 3 P9303_08381 Nucleoside triphosphate pyrophosphatase Prochlorococcus marinus (strain MIT 9303)
A5GMB7 3.75e-22 91 33 5 191 3 SynWH7803_1656 Nucleoside triphosphate pyrophosphatase Synechococcus sp. (strain WH7803)
Q2P7C2 5.6e-22 91 35 2 183 3 XOO0800 7-methyl-GTP pyrophosphatase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8EDG7 5.65e-22 91 35 5 185 3 SO_2782 7-methyl-GTP pyrophosphatase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q1AVT5 6.03e-22 91 33 2 187 3 Rxyl_1531 dTTP/UTP pyrophosphatase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q5H4J1 6.44e-22 91 35 2 183 3 XOO0876 7-methyl-GTP pyrophosphatase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2J6P8 8.57e-22 90 35 2 172 3 Npun_F5518 Nucleoside triphosphate pyrophosphatase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q1LKL5 1.16e-21 90 33 3 182 3 Rmet_2434 7-methyl-GTP pyrophosphatase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q5N2H7 1.22e-21 90 33 1 171 3 syc1303_d Nucleoside triphosphate pyrophosphatase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31RS8 1.22e-21 90 33 1 171 3 Synpcc7942_0209 Nucleoside triphosphate pyrophosphatase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q12LU7 1.48e-21 90 30 3 196 3 Sden_2299 7-methyl-GTP pyrophosphatase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q5QZ35 1.94e-21 90 31 3 179 3 IL1346 7-methyl-GTP pyrophosphatase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q126I4 2.98e-21 90 35 4 185 3 Bpro_3654 7-methyl-GTP pyrophosphatase Polaromonas sp. (strain JS666 / ATCC BAA-500)
B1YJT1 3.65e-21 89 43 5 181 3 Exig_2117 dTTP/UTP pyrophosphatase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q1H156 3.96e-21 89 32 4 189 3 Mfla_1513 7-methyl-GTP pyrophosphatase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q9ZCE2 4.17e-21 89 35 3 182 3 RP815 Nucleoside triphosphate pyrophosphatase Rickettsia prowazekii (strain Madrid E)
A3DMH6 5.62e-21 89 31 4 192 3 Smar_0734 dTTP/UTP pyrophosphatase Staphylothermus marinus (strain ATCC 43588 / DSM 3639 / JCM 9404 / F1)
Q7U5K1 8.88e-21 88 32 4 178 3 SYNW1702 Nucleoside triphosphate pyrophosphatase Parasynechococcus marenigrum (strain WH8102)
Q8PNF1 9.43e-21 88 34 2 185 3 XAC1120 7-methyl-GTP pyrophosphatase Xanthomonas axonopodis pv. citri (strain 306)
Q87N16 1.05e-20 88 31 4 178 3 VP2060 7-methyl-GTP pyrophosphatase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6A725 1.18e-20 88 33 5 188 3 PPA1709 Nucleoside triphosphate pyrophosphatase Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q1MQH1 1.37e-20 88 31 4 185 3 LI0702 dTTP/UTP pyrophosphatase Lawsonia intracellularis (strain PHE/MN1-00)
Q68VT4 1.39e-20 88 34 3 182 3 RT0803 Nucleoside triphosphate pyrophosphatase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9KQH1 1.4e-20 87 31 3 177 3 VC_2027 7-methyl-GTP pyrophosphatase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P58633 1.83e-20 87 38 3 176 3 RSc1046 7-methyl-GTP pyrophosphatase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B7K400 3.42e-20 87 31 3 175 3 PCC8801_2532 Nucleoside triphosphate pyrophosphatase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q9HZN2 3.94e-20 86 37 4 182 3 PA2972 7-methyl-GTP pyrophosphatase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q084H1 6.17e-20 86 29 3 189 3 Sfri_1493 7-methyl-GTP pyrophosphatase Shewanella frigidimarina (strain NCIMB 400)
Q21XP8 6.44e-20 86 33 4 185 3 Rfer_1726 7-methyl-GTP pyrophosphatase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q21CL6 7.31e-20 86 36 6 180 3 RPC_0295 Nucleoside triphosphate pyrophosphatase Rhodopseudomonas palustris (strain BisB18)
Q47EH5 7.37e-20 85 35 4 179 3 Daro_2011 7-methyl-GTP pyrophosphatase Dechloromonas aromatica (strain RCB)
Q1DAV2 1.2e-19 85 30 3 180 3 MXAN_1986 Nucleoside triphosphate pyrophosphatase Myxococcus xanthus (strain DK1622)
Q46JR8 1.59e-19 85 31 5 189 3 PMN2A_0769 Nucleoside triphosphate pyrophosphatase Prochlorococcus marinus (strain NATL2A)
Q3AWW1 1.81e-19 84 30 3 180 3 Syncc9902_1594 Nucleoside triphosphate pyrophosphatase Synechococcus sp. (strain CC9902)
Q0HHJ4 2.05e-19 84 34 4 176 3 Shewmr4_2402 7-methyl-GTP pyrophosphatase Shewanella sp. (strain MR-4)
A4X378 2.06e-19 85 32 3 177 3 Strop_0851 Nucleoside triphosphate pyrophosphatase Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
Q82U64 2.26e-19 84 32 3 176 3 NE1642 7-methyl-GTP pyrophosphatase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q7UWY8 2.79e-19 85 34 7 190 3 RB1703 dTTP/UTP pyrophosphatase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q92TF1 2.91e-19 84 33 5 182 3 R00002 7-methyl-GTP pyrophosphatase Rhizobium meliloti (strain 1021)
Q46Z01 3.04e-19 84 36 3 184 3 Reut_A2269 7-methyl-GTP pyrophosphatase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q7VW25 3.41e-19 84 35 2 183 3 BP2447 7-methyl-GTP pyrophosphatase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q1CI15 3.91e-19 84 33 6 191 3 YPN_2036 7-methyl-GTP pyrophosphatase Yersinia pestis bv. Antiqua (strain Nepal516)
P58635 3.91e-19 84 33 6 191 3 YPO1593 7-methyl-GTP pyrophosphatase Yersinia pestis
Q1C6M4 3.91e-19 84 33 6 191 3 YPA_1932 7-methyl-GTP pyrophosphatase Yersinia pestis bv. Antiqua (strain Antiqua)
P58632 3.95e-19 84 32 4 173 3 all3075 Nucleoside triphosphate pyrophosphatase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P74331 4.21e-19 84 30 2 175 3 sll0905 Nucleoside triphosphate pyrophosphatase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q13VL1 4.47e-19 84 37 4 178 3 Bxeno_A3340 7-methyl-GTP pyrophosphatase Paraburkholderia xenovorans (strain LB400)
Q7W5I0 5.25e-19 83 35 2 183 3 BPP3311 7-methyl-GTP pyrophosphatase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WD16 5.25e-19 83 35 2 183 3 BB3762 7-methyl-GTP pyrophosphatase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q669K7 6.98e-19 83 33 6 191 3 YPTB2477 7-methyl-GTP pyrophosphatase Yersinia pseudotuberculosis serotype I (strain IP32953)
B7KJY0 7.84e-19 83 32 3 177 3 PCC7424_1128 Nucleoside triphosphate pyrophosphatase Gloeothece citriformis (strain PCC 7424)
Q89WP0 8.24e-19 83 32 6 177 3 blr0638 Nucleoside triphosphate pyrophosphatase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q11A17 1.39e-18 82 30 3 183 3 Tery_0163 Nucleoside triphosphate pyrophosphatase Trichodesmium erythraeum (strain IMS101)
Q1MNF5 1.65e-18 82 34 5 178 3 RL0002 7-methyl-GTP pyrophosphatase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q319X8 1.92e-18 82 30 4 193 3 PMT9312_1258 Nucleoside triphosphate pyrophosphatase Prochlorococcus marinus (strain MIT 9312)
Q5P0E0 2.6e-18 81 35 5 177 3 AZOSEA30990 7-methyl-GTP pyrophosphatase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A2C3V6 2.67e-18 82 29 4 189 3 NATL1_16091 Nucleoside triphosphate pyrophosphatase Prochlorococcus marinus (strain NATL1A)
Q87YG2 2.83e-18 81 34 4 182 3 maf-1 7-methyl-GTP pyrophosphatase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A6Q573 3.25e-18 81 29 2 183 3 NIS_1525 Nucleoside triphosphate pyrophosphatase Nitratiruptor sp. (strain SB155-2)
Q2NU46 3.39e-18 81 31 4 182 3 SG1054 7-methyl-GTP pyrophosphatase Sodalis glossinidius (strain morsitans)
Q3MEX6 4.45e-18 81 31 4 173 3 Ava_0836 Nucleoside triphosphate pyrophosphatase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q57AJ0 4.49e-18 81 31 5 180 3 BruAb1_2043 7-methyl-GTP pyrophosphatase Brucella abortus biovar 1 (strain 9-941)
Q2YR05 4.49e-18 81 31 5 180 3 BAB1_2069 7-methyl-GTP pyrophosphatase Brucella abortus (strain 2308)
Q8YE19 8.16e-18 80 30 5 180 3 BMEI2059 7-methyl-GTP pyrophosphatase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FY22 1.1e-17 80 30 5 180 3 maf-2 7-methyl-GTP pyrophosphatase Brucella suis biovar 1 (strain 1330)
Q4JTL6 1.37e-17 79 30 3 180 3 jk1664 Nucleoside triphosphate pyrophosphatase Corynebacterium jeikeium (strain K411)
Q8PBV4 1.51e-17 79 33 4 189 3 XCC1013 7-methyl-GTP pyrophosphatase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4URP7 1.51e-17 79 33 4 189 3 XC_3232 7-methyl-GTP pyrophosphatase Xanthomonas campestris pv. campestris (strain 8004)
Q8G4U8 1.93e-17 82 34 1 125 3 BL1276 Nucleoside triphosphate pyrophosphatase/Nudix hydrolase fusion protein Bifidobacterium longum (strain NCC 2705)
A8G5U9 2.82e-17 79 29 5 193 3 P9215_13651 Nucleoside triphosphate pyrophosphatase Prochlorococcus marinus (strain MIT 9215)
Q0IBR4 4.18e-17 79 28 4 203 3 sync_0895 Nucleoside triphosphate pyrophosphatase Synechococcus sp. (strain CC9311)
Q21K93 5.29e-17 78 29 3 177 3 Sde_1624 7-methyl-GTP pyrophosphatase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q7V0U3 5.65e-17 78 29 4 196 3 PMM1159 Nucleoside triphosphate pyrophosphatase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A3PDZ9 6.2e-17 78 29 5 193 3 P9301_13511 Nucleoside triphosphate pyrophosphatase Prochlorococcus marinus (strain MIT 9301)
Q4KFS2 7.59e-17 77 35 4 182 3 PFL_1791 7-methyl-GTP pyrophosphatase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A2BS59 2.17e-16 77 28 4 193 3 A9601_13361 Nucleoside triphosphate pyrophosphatase Prochlorococcus marinus (strain AS9601)
O14141 6.59e-16 76 31 7 199 1 SPAC3G6.03c dTTP/UTP pyrophosphatase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q2KEA0 6.61e-16 75 31 5 176 3 RHE_CH00002 7-methyl-GTP pyrophosphatase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A5IDM1 7.17e-16 75 26 2 175 3 LPC_1522 Nucleoside triphosphate pyrophosphatase Legionella pneumophila (strain Corby)
Q1BXV8 7.6e-16 75 33 4 180 3 Bcen_0637 7-methyl-GTP pyrophosphatase Burkholderia orbicola (strain AU 1054)
Q5WV03 7.79e-16 75 25 2 175 3 lpl2014 Nucleoside triphosphate pyrophosphatase Legionella pneumophila (strain Lens)
Q5X3L5 1.5e-15 74 26 2 175 3 lpp2019 Nucleoside triphosphate pyrophosphatase Legionella pneumophila (strain Paris)
Q8FRM5 1.54e-15 74 31 5 179 3 CE0735 Nucleoside triphosphate pyrophosphatase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q3ALJ5 1.75e-15 73 29 3 176 3 Syncc9605_0768 Nucleoside triphosphate pyrophosphatase Synechococcus sp. (strain CC9605)
Q11CM5 3.93e-15 73 31 5 183 3 Meso_3479 7-methyl-GTP pyrophosphatase Chelativorans sp. (strain BNC1)
C1B1A6 4.32e-15 73 31 6 195 3 ROP_63540 Nucleoside triphosphate pyrophosphatase Rhodococcus opacus (strain B4)
Q5ZTX2 4.57e-15 73 28 4 176 3 lpg2036 Nucleoside triphosphate pyrophosphatase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q1GCM3 6.73e-15 72 30 6 186 3 TM1040_2861 Nucleoside triphosphate pyrophosphatase Ruegeria sp. (strain TM1040)
Q2YA50 7.81e-15 72 30 4 179 3 Nmul_A1068 7-methyl-GTP pyrophosphatase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q4FNS4 8.2e-15 72 27 5 183 3 SAR11_0342 Nucleoside triphosphate pyrophosphatase Pelagibacter ubique (strain HTCC1062)
Q1QRY3 1.02e-14 72 32 4 174 3 Nham_0113 Nucleoside triphosphate pyrophosphatase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q7NSK3 2.12e-14 71 29 6 182 3 CV_3420 7-methyl-GTP pyrophosphatase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q0S319 2.3e-14 71 31 6 195 3 RHA1_ro06290 Nucleoside triphosphate pyrophosphatase Rhodococcus jostii (strain RHA1)
A4QC50 3.31e-14 70 30 4 179 3 cgR_0825 Nucleoside triphosphate pyrophosphatase Corynebacterium glutamicum (strain R)
Q99210 3.58e-14 71 31 9 200 1 YOR111W dTTP/UTP pyrophosphatase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
C0ZWV2 4.76e-14 70 32 5 194 3 RER_21290 Nucleoside triphosphate pyrophosphatase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q3SWH0 5.13e-14 70 32 4 174 3 Nwi_0103 Nucleoside triphosphate pyrophosphatase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q8NSH0 5.67e-14 70 30 4 179 3 Cgl0705 Nucleoside triphosphate pyrophosphatase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q6FB05 7.32e-14 70 30 5 180 3 ACIAD1930 Nucleoside triphosphate pyrophosphatase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A1T5Q3 7.78e-14 70 31 4 193 3 Mvan_1674 Nucleoside triphosphate pyrophosphatase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A7H4N2 8.46e-14 69 26 1 175 3 JJD26997_1428 Nucleoside triphosphate pyrophosphatase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q39I90 1.18e-13 69 32 3 178 3 Bcep18194_A4229 7-methyl-GTP pyrophosphatase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A0QTE5 1.21e-13 69 27 4 198 3 MSMEG_1811 Nucleoside triphosphate pyrophosphatase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q6AGN3 1.24e-13 69 29 3 200 3 Lxx04750 Nucleoside triphosphate pyrophosphatase Leifsonia xyli subsp. xyli (strain CTCB07)
Q3K8K5 1.46e-13 69 32 4 182 3 Pfl01_4162 7-methyl-GTP pyrophosphatase Pseudomonas fluorescens (strain Pf0-1)
Q2SXV1 2.37e-13 68 33 3 178 3 BTH_I1713 7-methyl-GTP pyrophosphatase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q8UJC6 5.86e-13 67 29 5 176 3 maf2 Nucleoside triphosphate pyrophosphatase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q48L46 7.03e-13 67 32 4 171 3 PSPPH_1636 7-methyl-GTP pyrophosphatase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q5HVQ6 7.08e-13 67 25 1 182 3 CJE0614 Nucleoside triphosphate pyrophosphatase Campylobacter jejuni (strain RM1221)
A1VYL9 7.08e-13 67 25 1 182 3 CJJ81176_0535 Nucleoside triphosphate pyrophosphatase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9PI04 7.08e-13 67 25 1 182 3 Cj0507 Nucleoside triphosphate pyrophosphatase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q13E26 8.3e-13 67 30 7 180 3 RPD_0425 Nucleoside triphosphate pyrophosphatase Rhodopseudomonas palustris (strain BisB5)
Q63S79 8.52e-13 67 34 3 178 3 BPSL2446 7-methyl-GTP pyrophosphatase Burkholderia pseudomallei (strain K96243)
Q3JQ61 8.52e-13 67 34 3 178 3 BURPS1710b_2911 7-methyl-GTP pyrophosphatase Burkholderia pseudomallei (strain 1710b)
Q62LU6 8.52e-13 67 34 3 178 3 BMA0526 7-methyl-GTP pyrophosphatase Burkholderia mallei (strain ATCC 23344)
B2HEK5 1.16e-12 67 28 5 207 3 MMAR_1254 Nucleoside triphosphate pyrophosphatase Mycobacterium marinum (strain ATCC BAA-535 / M)
A0PRJ3 1.22e-12 67 28 5 207 3 MUL_2634 Nucleoside triphosphate pyrophosphatase Mycobacterium ulcerans (strain Agy99)
A8FKT3 1.33e-12 66 25 1 182 3 C8J_0471 Nucleoside triphosphate pyrophosphatase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q5F4W9 2.02e-12 66 30 6 182 3 NGO2175 7-methyl-GTP pyrophosphatase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A4TF31 2.5e-12 66 31 3 148 3 Mflv_4776 Nucleoside triphosphate pyrophosphatase Mycolicibacterium gilvum (strain PYR-GCK)
Q2J353 2.51e-12 65 31 7 179 3 RPB_0396 Nucleoside triphosphate pyrophosphatase Rhodopseudomonas palustris (strain HaA2)
Q4ZVY2 2.68e-12 65 32 3 168 3 Psyr_1642 7-methyl-GTP pyrophosphatase Pseudomonas syringae pv. syringae (strain B728a)
Q9AC58 3.4e-12 65 28 6 182 3 CC_0002 Nucleoside triphosphate pyrophosphatase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q5Z154 3.66e-12 65 28 3 184 3 NFA_9920 Nucleoside triphosphate pyrophosphatase Nocardia farcinica (strain IFM 10152)
Q5NRI7 3.9e-12 65 29 5 180 3 ZMO0043 Nucleoside triphosphate pyrophosphatase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q98DY4 4.09e-12 65 28 4 178 3 mlr4491 7-methyl-GTP pyrophosphatase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q82I23 4.69e-12 65 29 3 187 3 SAV_3335 Nucleoside triphosphate pyrophosphatase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
C3PEA3 6.31e-12 64 30 6 186 3 cauri_0560 Nucleoside triphosphate pyrophosphatase Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
Q9JXS2 8.84e-12 64 29 6 182 3 NMB1909 7-methyl-GTP pyrophosphatase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q3SIL8 9.17e-12 64 31 4 185 3 Tbd_1557 7-methyl-GTP pyrophosphatase Thiobacillus denitrificans (strain ATCC 25259)
Q0C6A7 1.13e-11 64 29 6 178 3 HNE_0002 Nucleoside triphosphate pyrophosphatase Hyphomonas neptunium (strain ATCC 15444)
Q6NIW2 1.58e-11 63 30 7 185 3 DIP0654 Nucleoside triphosphate pyrophosphatase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q9JW50 1.62e-11 63 29 6 182 3 NMA0546 7-methyl-GTP pyrophosphatase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q0AKD7 1.63e-11 63 28 4 189 3 Mmar10_2975 Nucleoside triphosphate pyrophosphatase Maricaulis maris (strain MCS10)
Q49670 1.67e-11 63 25 4 198 3 ML0729 Nucleoside triphosphate pyrophosphatase Mycobacterium leprae (strain TN)
B8ZUX8 1.67e-11 63 25 4 198 3 MLBr00729 Nucleoside triphosphate pyrophosphatase Mycobacterium leprae (strain Br4923)
A4FNQ1 2.02e-11 63 32 3 129 3 SACE_6507 Nucleoside triphosphate pyrophosphatase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q2RN87 3.33e-11 63 31 6 179 3 Rru_A3614 Nucleoside triphosphate pyrophosphatase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q6ND10 5.48e-11 62 31 7 179 3 RPA0299 Nucleoside triphosphate pyrophosphatase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q9EWV6 6.11e-11 62 29 3 174 3 SCO4923 Nucleoside triphosphate pyrophosphatase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q5LLN0 7.12e-11 62 27 6 185 3 SPO3892 Nucleoside triphosphate pyrophosphatase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q6G1B6 7.61e-11 62 28 5 178 3 BQ00020 7-methyl-GTP pyrophosphatase Bartonella quintana (strain Toulouse)
C1AH56 7.36e-10 59 27 6 200 3 JTY_3307 Nucleoside triphosphate pyrophosphatase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KNT4 7.36e-10 59 27 6 200 3 BCG_3311 Nucleoside triphosphate pyrophosphatase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7TWT7 7.36e-10 59 27 6 200 3 BQ2027_MB3310 Nucleoside triphosphate pyrophosphatase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WK27 8.29e-10 59 27 6 200 1 Rv3282 Nucleoside triphosphate pyrophosphatase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WK26 8.29e-10 59 27 6 200 3 MT3381 Nucleoside triphosphate pyrophosphatase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U7V6 8.29e-10 59 27 6 200 3 MRA_3323 Nucleoside triphosphate pyrophosphatase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q73UG7 1.56e-09 58 28 5 187 3 MAP_3401 Nucleoside triphosphate pyrophosphatase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q6G5B0 2.13e-09 58 26 6 180 3 BH00020 7-methyl-GTP pyrophosphatase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q1BCI0 2.55e-09 57 28 3 125 3 Mmcs_1292 Nucleoside triphosphate pyrophosphatase Mycobacterium sp. (strain MCS)
A1UCG3 2.55e-09 57 28 3 125 3 Mkms_1309 Nucleoside triphosphate pyrophosphatase Mycobacterium sp. (strain KMS)
A3PW53 2.55e-09 57 28 3 125 3 Mjls_1328 Nucleoside triphosphate pyrophosphatase Mycobacterium sp. (strain JLS)
Q2VYH3 3.88e-09 57 25 5 179 3 amb4548 Nucleoside triphosphate pyrophosphatase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q54TC5 4.25e-09 57 25 6 192 3 DDB_G0281937 7-methyl-GTP pyrophosphatase Dictyostelium discoideum
Q0BWA0 4.6e-09 57 25 5 178 3 GbCGDNIH1_0004 Nucleoside triphosphate pyrophosphatase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q5FS37 6.77e-09 56 28 3 179 3 GOX1038 Nucleoside triphosphate pyrophosphatase Gluconobacter oxydans (strain 621H)
Q1GP76 2.1e-08 55 24 5 185 3 Sala_2841 Nucleoside triphosphate pyrophosphatase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q2GC58 3.23e-08 54 25 3 181 3 Saro_0116 Nucleoside triphosphate pyrophosphatase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q3IYH0 2.84e-07 52 26 6 179 3 RHOS4_28460 Nucleoside triphosphate pyrophosphatase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q16CZ1 6.58e-07 51 27 5 176 3 RD1_0437 Nucleoside triphosphate pyrophosphatase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS18080
Feature type CDS
Gene -
Product Maf family protein
Location 3971206 - 3971793 (strand: 1)
Length 588 (nucleotides) / 195 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_749
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02545 Maf-like protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0424 Secondary metabolites biosynthesis, transport and catabolism (Q) Q 7-methyl-GTP pyrophosphatase and related NTP pyrophosphatases, Maf/HAM1 superfamily

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06287 nucleoside triphosphate pyrophosphatase [EC:3.6.1.-] Pyrimidine metabolism
Metabolic pathways
Nucleotide metabolism		 -

Protein Sequence

MITLYLASSSPRRRELLSLLDVQFSTITPAIDEIWQQGEAPEDYVIRLAREKSQEGVRQATNDYPVLGSDTIVVQAGRILEKPRDKAHAAQMLSNLSGATHQVMTAIAISDKTRTISQLVVTDVTFRKMTESEISAYIETGEPMDKAGAYGIQGKGGRFVQRIEGSYHAVVGLPLVETEALIAQFLSLANDKEIS

Flanking regions ( +/- flanking 50bp)

CTCTCTGGATCATGACGGTATTTTTGTGTCACCGTCATGAGGATATTATTGTGATCACTCTTTACCTTGCATCGAGTTCCCCCAGAAGGCGAGAGCTTCTGTCACTGTTGGATGTTCAATTTAGCACCATTACACCGGCAATTGATGAAATTTGGCAACAAGGTGAAGCACCAGAAGATTATGTTATCCGTTTGGCGAGGGAGAAATCTCAAGAGGGGGTACGTCAAGCGACAAATGACTATCCGGTATTAGGCTCTGATACTATCGTGGTTCAAGCAGGTCGTATTCTGGAAAAACCACGAGATAAAGCGCATGCAGCACAAATGCTAAGTAATCTTTCAGGTGCAACCCACCAAGTGATGACGGCGATTGCTATTTCAGATAAAACCCGAACAATAAGCCAATTAGTTGTCACGGATGTGACTTTTAGAAAGATGACAGAAAGTGAAATTAGTGCGTATATTGAAACGGGAGAGCCAATGGATAAAGCTGGCGCTTACGGTATTCAGGGAAAAGGAGGCCGTTTTGTACAACGGATTGAGGGTAGCTATCATGCTGTTGTCGGCTTACCGCTTGTTGAAACCGAAGCATTGATAGCTCAATTTTTGTCTCTAGCGAATGATAAGGAGATTTCATGACAGCAGAGCTATTAGTGAATGTGACTCCCTCTGAAACCCGAGTGGCCTAT