Homologs in group_785

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03635 FBDBKF_03635 72.0 Morganella morganii S1 hydN electron transport protein HydN
EHELCC_06900 EHELCC_06900 72.0 Morganella morganii S2 hydN electron transport protein HydN
NLDBIP_07225 NLDBIP_07225 72.0 Morganella morganii S4 hydN electron transport protein HydN
LHKJJB_06760 LHKJJB_06760 72.0 Morganella morganii S3 hydN electron transport protein HydN
HKOGLL_04170 HKOGLL_04170 72.0 Morganella morganii S5 hydN electron transport protein HydN
F4V73_RS11230 F4V73_RS11230 70.9 Morganella psychrotolerans hydN electron transport protein HydN

Distribution of the homologs in the orthogroup group_785

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_785

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P20925 2.21e-112 319 98 0 157 4 None Frd operon probable iron-sulfur subunit A (Fragment) Proteus vulgaris
P0AAK4 4.06e-77 231 62 1 177 3 hydN Electron transport protein HydN Escherichia coli (strain K12)
P0AAK5 4.06e-77 231 62 1 177 3 hydN Electron transport protein HydN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAK6 4.06e-77 231 62 1 177 3 hydN Electron transport protein HydN Escherichia coli O157:H7
P56256 9.42e-53 168 55 5 174 4 ysaA Putative electron transport protein YsaA Escherichia coli (strain K12)
P37127 1.62e-48 169 49 2 176 2 aegA Putative oxidoreductase AegA Escherichia coli (strain K12)
Q46819 3.44e-39 134 41 2 171 4 ygfS Putative electron transport protein YgfS Escherichia coli (strain K12)
Q46820 6.38e-39 143 42 4 177 2 uacF Putative oxidoreductase UacF Escherichia coli (strain K12)
P0AAK3 7.42e-36 127 37 4 198 3 hycB Formate hydrogenlyase subunit 2 Shigella flexneri
P0AAK1 7.42e-36 127 37 4 198 1 hycB Formate hydrogenlyase subunit 2 Escherichia coli (strain K12)
P0AAK2 7.42e-36 127 37 4 198 3 hycB Formate hydrogenlyase subunit 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P23481 3.98e-34 122 36 5 208 2 hyfA Hydrogenase-4 component A Escherichia coli (strain K12)
P31894 1.42e-27 105 37 5 179 1 cooF Iron-sulfur protein Rhodospirillum rubrum
P18776 3.92e-17 78 32 8 188 1 dmsB Anaerobic dimethyl sulfoxide reductase chain B Escherichia coli (strain K12)
P0AAJ1 5.2e-17 78 33 7 168 3 ynfG Probable anaerobic dimethyl sulfoxide reductase chain YnfG Escherichia coli (strain K12)
P0AAJ2 5.2e-17 78 33 7 168 3 ynfG Probable anaerobic dimethyl sulfoxide reductase chain YnfG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q83RZ7 5.83e-17 78 32 8 188 3 dmsB Anaerobic dimethyl sulfoxide reductase chain B Shigella flexneri
P0A1I1 2.3e-16 76 31 8 190 1 phsB Thiosulfate reductase electron transfer subunit PhsB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1I2 2.3e-16 76 31 8 190 3 phsB Thiosulfate reductase electron transfer subunit PhsB Salmonella typhi
Q57619 2.56e-16 75 30 5 177 3 MJ0155 Uncharacterized ferredoxin MJ0155 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q7WTT9 2.68e-16 77 29 6 207 1 arrB Arsenate respiratory reductase iron-sulfur subunit ArrB Shewanella sp. (strain ANA-3)
P27273 4.8e-15 73 30 7 192 1 fdhB1 Formate dehydrogenase iron-sulfur subunit Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
P45003 8.82e-15 72 30 5 166 3 dmsB Anaerobic dimethyl sulfoxide reductase chain B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HR73 1.45e-14 72 28 6 183 2 dmsB Putative dimethyl sulfoxide reductase iron-sulfur subunit B Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q57713 1.97e-14 70 33 2 124 3 MJ0265 Uncharacterized ferredoxin MJ0265 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8X616 6.01e-14 70 31 8 169 3 ydhX Uncharacterized ferredoxin-like protein YdhX Escherichia coli O157:H7
P77375 7.31e-14 70 30 7 169 2 ydhX Uncharacterized ferredoxin-like protein YdhX Escherichia coli (strain K12)
O30080 3.41e-13 68 31 8 160 3 ttrB Tetrathionate reductase subunit B Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P31076 5.4e-13 67 33 6 161 4 psrB Polysulfide reductase chain B Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
D3RNN7 6.4e-13 68 31 7 174 1 soeB Sulfite dehydrogenase subunit B Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
P33389 7.22e-13 68 29 6 185 4 DVU_0535 Protein DVU_0535 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
P0AAK9 9.94e-13 67 30 6 177 3 nrfC Protein NrfC Shigella flexneri
P0AAK7 9.94e-13 67 30 6 177 3 nrfC Protein NrfC Escherichia coli (strain K12)
P0AAK8 9.94e-13 67 30 6 177 3 nrfC Protein NrfC Escherichia coli O157:H7
P45015 1.17e-12 67 28 5 186 3 nrfC Protein NrfC homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7CQM9 1.37e-12 67 30 5 163 1 ttrB Tetrathionate reductase subunit B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AAL8 4.89e-10 59 28 4 163 4 ydhY Uncharacterized ferredoxin-like protein YdhY Shigella flexneri
P0AAL6 4.89e-10 59 28 4 163 2 ydhY Uncharacterized ferredoxin-like protein YdhY Escherichia coli (strain K12)
P0AAL7 4.89e-10 59 28 4 163 4 ydhY Uncharacterized ferredoxin-like protein YdhY Escherichia coli O157:H7
Q57712 4.23e-09 56 26 5 169 3 MJ0264 Uncharacterized protein MJ0264 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q72E85 1.83e-08 55 26 7 208 1 qrcC Menaquinone reductase, iron-sulfur cluster-binding subunit Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8L3A9 1.99e-08 56 30 7 156 1 padI NADH-dependent phenylglyoxylate dehydrogenase subunit beta Aromatoleum evansii
P0AAK0 3.55e-08 55 24 9 209 3 hybA Hydrogenase-2 operon protein HybA Shigella flexneri
P0AAJ8 3.55e-08 55 24 9 209 3 hybA Hydrogenase-2 operon protein HybA Escherichia coli (strain K12)
P0AAJ9 3.55e-08 55 24 9 209 3 hybA Hydrogenase-2 operon protein HybA Escherichia coli O157:H7
O29751 4.21e-07 52 26 4 138 1 hmeA Hdr-like menaquinol oxidoreductase iron-sulfur subunit 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P0AAJ4 8.84e-07 51 27 7 188 3 fdnH Formate dehydrogenase, nitrate-inducible, iron-sulfur subunit Shigella flexneri
P0AAJ3 8.84e-07 51 27 7 188 1 fdnH Formate dehydrogenase, nitrate-inducible, iron-sulfur subunit Escherichia coli (strain K12)
P0AAJ7 1.65e-06 50 27 7 185 3 fdoH Formate dehydrogenase-O iron-sulfur subunit Shigella flexneri
P0AAJ5 1.65e-06 50 27 7 185 1 fdoH Formate dehydrogenase-O iron-sulfur subunit Escherichia coli (strain K12)
P0AAJ6 1.65e-06 50 27 7 185 3 fdoH Formate dehydrogenase-O iron-sulfur subunit Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q58344 1.9e-06 49 32 7 127 4 MJ0934 Uncharacterized polyferredoxin-like protein MJ0934 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P60069 1.16e-05 48 28 5 145 1 clrB Chlorate reductase subunit beta Ideonella dechloratans
Q9S1G9 5.15e-05 46 30 3 107 1 serB Selenate reductase subunit beta Thauera selenatis
Q83RN5 5.7e-05 46 23 4 141 3 narH Respiratory nitrate reductase 1 beta chain Shigella flexneri
P11349 5.76e-05 46 23 4 141 1 narH Respiratory nitrate reductase 1 beta chain Escherichia coli (strain K12)
Q58699 0.000229 44 34 3 89 4 MJ1303 Uncharacterized polyferredoxin-like protein MJ1303 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P44450 0.000233 44 25 7 186 3 fdxH Formate dehydrogenase iron-sulfur subunit Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P19318 0.000268 44 23 4 134 1 narY Respiratory nitrate reductase 2 beta chain Escherichia coli (strain K12)
I3R9M8 0.000652 42 30 4 105 1 narH Respiratory nitrate reductase subunit beta Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
Q57661 0.00071 42 37 2 64 1 dmrX Dihydromethanopterin reductase (acceptor) Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS17815
Feature type CDS
Gene hydN
Product electron transport protein HydN
Location 3915209 - 3915766 (strand: 1)
Length 558 (nucleotides) / 185 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_785
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00037 4Fe-4S binding domain
PF12800 4Fe-4S binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1142 Energy production and conversion (C) C Fe-S-cluster-containing hydrogenase component 2

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05796 electron transport protein HydN - -

Protein Sequence

MNRFIIADPKKCIGCHTCEVACVVSHQQASQDNLAIDQISEQNFQPRIHVVKGFSISTAVVCHQCEDAPCANVCPNGAIIHNKDYYYVDQDKCIGCKTCVLACPYGTMEVVSRPVMRKLTALNTIEAFKAEANKCDLCHHRAEGPACVEVCPTQALVCIDRDALEDMVKERRRKAAFETGADLLF

Flanking regions ( +/- flanking 50bp)

CGTTTATCGCCAATATAACGGCTATATATAACAAACAGCAGGAGAATATGATGAACCGTTTCATCATTGCAGACCCTAAAAAGTGTATTGGTTGCCATACCTGTGAAGTAGCATGTGTTGTTTCACATCAGCAAGCTTCCCAAGATAATTTAGCAATCGACCAAATTAGTGAGCAAAATTTCCAACCACGCATTCATGTGGTGAAAGGCTTTTCAATTAGTACCGCAGTTGTCTGCCATCAATGTGAAGATGCTCCTTGTGCCAATGTCTGTCCTAATGGTGCCATTATTCATAATAAAGATTATTACTATGTCGATCAGGATAAATGCATTGGTTGTAAAACCTGTGTCTTGGCTTGTCCTTATGGCACTATGGAAGTGGTTTCTCGTCCGGTTATGCGTAAATTAACCGCTCTCAATACGATTGAAGCATTTAAAGCTGAAGCCAATAAATGTGATTTATGTCATCACCGTGCTGAAGGTCCTGCTTGTGTTGAGGTCTGCCCAACGCAGGCATTAGTCTGTATTGATAGAGATGCACTTGAAGATATGGTTAAAGAGCGTCGTCGTAAAGCGGCTTTTGAAACAGGCGCTGATTTATTGTTCTAAGATCAAGAATAAAGCAACTATGTCCTGATACTATAGTTGCTATTATTTAT