Homologs in group_785

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03635 FBDBKF_03635 100.0 Morganella morganii S1 hydN electron transport protein HydN
EHELCC_06900 EHELCC_06900 100.0 Morganella morganii S2 hydN electron transport protein HydN
NLDBIP_07225 NLDBIP_07225 100.0 Morganella morganii S4 hydN electron transport protein HydN
LHKJJB_06760 LHKJJB_06760 100.0 Morganella morganii S3 hydN electron transport protein HydN
F4V73_RS11230 F4V73_RS11230 94.0 Morganella psychrotolerans hydN electron transport protein HydN
PMI_RS17815 PMI_RS17815 72.0 Proteus mirabilis HI4320 hydN electron transport protein HydN

Distribution of the homologs in the orthogroup group_785

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_785

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AAK4 1.83e-76 229 64 1 174 3 hydN Electron transport protein HydN Escherichia coli (strain K12)
P0AAK5 1.83e-76 229 64 1 174 3 hydN Electron transport protein HydN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAK6 1.83e-76 229 64 1 174 3 hydN Electron transport protein HydN Escherichia coli O157:H7
P20925 3.68e-75 225 69 0 150 4 None Frd operon probable iron-sulfur subunit A (Fragment) Proteus vulgaris
P56256 3.6e-53 169 55 2 161 4 ysaA Putative electron transport protein YsaA Escherichia coli (strain K12)
P37127 2.19e-50 174 49 2 173 2 aegA Putative oxidoreductase AegA Escherichia coli (strain K12)
Q46819 2.36e-40 137 42 4 178 4 ygfS Putative electron transport protein YgfS Escherichia coli (strain K12)
P0AAK3 1.04e-39 137 42 4 188 3 hycB Formate hydrogenlyase subunit 2 Shigella flexneri
P0AAK1 1.04e-39 137 42 4 188 1 hycB Formate hydrogenlyase subunit 2 Escherichia coli (strain K12)
P0AAK2 1.04e-39 137 42 4 188 3 hycB Formate hydrogenlyase subunit 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q46820 8.21e-37 137 41 4 174 2 uacF Putative oxidoreductase UacF Escherichia coli (strain K12)
P23481 3.4e-36 127 38 5 195 2 hyfA Hydrogenase-4 component A Escherichia coli (strain K12)
P31894 3.9e-32 117 39 3 176 1 cooF Iron-sulfur protein Rhodospirillum rubrum
Q57619 7.94e-19 81 32 4 170 3 MJ0155 Uncharacterized ferredoxin MJ0155 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P18776 3.37e-18 81 32 7 190 1 dmsB Anaerobic dimethyl sulfoxide reductase chain B Escherichia coli (strain K12)
Q83RZ7 4.16e-18 81 32 7 190 3 dmsB Anaerobic dimethyl sulfoxide reductase chain B Shigella flexneri
P0A1I1 9.37e-18 79 36 9 175 1 phsB Thiosulfate reductase electron transfer subunit PhsB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1I2 9.37e-18 79 36 9 175 3 phsB Thiosulfate reductase electron transfer subunit PhsB Salmonella typhi
P0AAJ1 1.18e-17 80 34 7 170 3 ynfG Probable anaerobic dimethyl sulfoxide reductase chain YnfG Escherichia coli (strain K12)
P0AAJ2 1.18e-17 80 34 7 170 3 ynfG Probable anaerobic dimethyl sulfoxide reductase chain YnfG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q57713 2.49e-15 72 33 3 129 3 MJ0265 Uncharacterized ferredoxin MJ0265 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
D3RNN7 4.75e-15 73 30 8 197 1 soeB Sulfite dehydrogenase subunit B Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
Q7CQM9 8.23e-15 73 30 4 157 1 ttrB Tetrathionate reductase subunit B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AAL8 1.31e-14 72 28 6 171 4 ydhY Uncharacterized ferredoxin-like protein YdhY Shigella flexneri
P0AAL6 1.31e-14 72 28 6 171 2 ydhY Uncharacterized ferredoxin-like protein YdhY Escherichia coli (strain K12)
P0AAL7 1.31e-14 72 28 6 171 4 ydhY Uncharacterized ferredoxin-like protein YdhY Escherichia coli O157:H7
Q8X616 1.46e-14 72 31 6 162 3 ydhX Uncharacterized ferredoxin-like protein YdhX Escherichia coli O157:H7
P77375 1.52e-14 72 29 8 187 2 ydhX Uncharacterized ferredoxin-like protein YdhX Escherichia coli (strain K12)
Q7WTT9 1.59e-14 72 27 10 211 1 arrB Arsenate respiratory reductase iron-sulfur subunit ArrB Shewanella sp. (strain ANA-3)
P45003 2.02e-14 71 30 8 188 3 dmsB Anaerobic dimethyl sulfoxide reductase chain B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P27273 3.96e-14 70 29 6 185 1 fdhB1 Formate dehydrogenase iron-sulfur subunit Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q9HR73 4.37e-14 71 27 7 205 2 dmsB Putative dimethyl sulfoxide reductase iron-sulfur subunit B Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
O30080 7.33e-13 67 31 8 171 3 ttrB Tetrathionate reductase subunit B Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8L3A9 6.73e-12 66 30 6 153 1 padI NADH-dependent phenylglyoxylate dehydrogenase subunit beta Aromatoleum evansii
P0AAK0 1.51e-11 65 26 9 203 3 hybA Hydrogenase-2 operon protein HybA Shigella flexneri
P0AAJ8 1.51e-11 65 26 9 203 3 hybA Hydrogenase-2 operon protein HybA Escherichia coli (strain K12)
P0AAJ9 1.51e-11 65 26 9 203 3 hybA Hydrogenase-2 operon protein HybA Escherichia coli O157:H7
P0AAK9 1.91e-11 63 31 9 177 3 nrfC Protein NrfC Shigella flexneri
P0AAK7 1.91e-11 63 31 9 177 3 nrfC Protein NrfC Escherichia coli (strain K12)
P0AAK8 1.91e-11 63 31 9 177 3 nrfC Protein NrfC Escherichia coli O157:H7
P31076 2.88e-11 62 28 7 176 4 psrB Polysulfide reductase chain B Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
P45015 7.39e-11 62 31 8 174 3 nrfC Protein NrfC homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57712 1.36e-10 60 27 5 166 3 MJ0264 Uncharacterized protein MJ0264 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P33389 1.37e-09 59 27 8 185 4 DVU_0535 Protein DVU_0535 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
O29751 1.4e-08 56 31 6 148 1 hmeA Hdr-like menaquinol oxidoreductase iron-sulfur subunit 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P0AAJ4 1.3e-07 53 27 7 187 3 fdnH Formate dehydrogenase, nitrate-inducible, iron-sulfur subunit Shigella flexneri
P0AAJ3 1.3e-07 53 27 7 187 1 fdnH Formate dehydrogenase, nitrate-inducible, iron-sulfur subunit Escherichia coli (strain K12)
P0AAJ7 4.23e-07 52 27 8 187 3 fdoH Formate dehydrogenase-O iron-sulfur subunit Shigella flexneri
P0AAJ5 4.23e-07 52 27 8 187 1 fdoH Formate dehydrogenase-O iron-sulfur subunit Escherichia coli (strain K12)
P0AAJ6 4.23e-07 52 27 8 187 3 fdoH Formate dehydrogenase-O iron-sulfur subunit Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P60069 1.03e-06 51 31 6 134 1 clrB Chlorate reductase subunit beta Ideonella dechloratans
Q57661 5.07e-06 48 51 0 37 1 dmrX Dihydromethanopterin reductase (acceptor) Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9S1G9 5.11e-06 48 28 4 126 1 serB Selenate reductase subunit beta Thauera selenatis
P19318 2.17e-05 47 25 5 127 1 narY Respiratory nitrate reductase 2 beta chain Escherichia coli (strain K12)
Q83RN5 2.45e-05 47 25 6 156 3 narH Respiratory nitrate reductase 1 beta chain Shigella flexneri
P11349 2.47e-05 47 25 6 156 1 narH Respiratory nitrate reductase 1 beta chain Escherichia coli (strain K12)
Q00388 6.96e-05 45 25 7 201 4 vhuB Polyferredoxin protein VhuB Methanococcus voltae
P42176 9.18e-05 45 26 7 167 3 narH Nitrate reductase beta chain Bacillus subtilis (strain 168)
Q72E85 9.2e-05 45 23 8 209 1 qrcC Menaquinone reductase, iron-sulfur cluster-binding subunit Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
I3R9M8 0.000127 45 29 4 116 1 narH Respiratory nitrate reductase subunit beta Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
P85098 0.000138 44 30 5 100 1 narH Respiratory nitrate reductase beta chain (Fragments) Bradyrhizobium sp.
E5Y7I3 0.000258 43 43 1 55 3 hpsH (2S)-3-sulfopropanediol sulfolyase activating enzyme Bilophila wadsworthia (strain 3_1_6)
P44450 0.000268 43 29 5 119 3 fdxH Formate dehydrogenase iron-sulfur subunit Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
D8GR71 0.000683 42 33 5 119 3 rnfB Proton-translocating ferredoxin:NAD(+) oxidoreductase complex subunit B Clostridium ljungdahlii (strain ATCC 55383 / DSM 13528 / PETC)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_04170
Feature type CDS
Gene hydN
Product electron transport protein HydN
Location 152664 - 153212 (strand: -1)
Length 549 (nucleotides) / 182 (amino acids)

Contig

Accession ZDB_681
Length 269562 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_785
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF12800 4Fe-4S binding domain
PF13247 4Fe-4S dicluster domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1142 Energy production and conversion (C) C Fe-S-cluster-containing hydrogenase component 2

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05796 electron transport protein HydN - -

Protein Sequence

MNRFIIADPKKCIGCHTCEVACVVSHQEQETGIETVVKDEFFPRIHVMKGYTISTAVVCRQCEDAPCANVCPNGAISRKDDFVYVDQTKCIGCKTCVIACPYGTMEVVSRPVAQQITALNTIPQYRAEAHKCDLCHTRAGGPACVEVCPTHALMVVDRNKMDEIVKERRRRAAFEMPADLMS

Flanking regions ( +/- flanking 50bp)

GCACCGGAGTGCCGGATGTGAAGTCGCCGCGTATCATTCAGGAGAGTATGATGAACCGTTTCATCATTGCAGACCCAAAAAAGTGCATTGGCTGTCACACATGTGAAGTCGCTTGTGTTGTTTCGCATCAAGAGCAGGAAACCGGTATTGAAACAGTGGTGAAAGATGAATTCTTTCCCCGTATTCATGTGATGAAAGGGTACACCATCAGTACGGCGGTTGTCTGCCGTCAGTGTGAAGACGCACCGTGTGCCAATGTCTGCCCGAACGGCGCTATCAGCCGTAAAGATGATTTTGTGTATGTCGATCAGACCAAATGTATCGGCTGCAAAACCTGTGTGATTGCCTGTCCTTACGGCACCATGGAAGTGGTCAGCCGTCCTGTTGCACAACAGATCACTGCGCTGAACACCATTCCGCAGTACCGCGCGGAAGCCCACAAGTGCGATTTATGCCATACCCGTGCAGGCGGACCTGCCTGTGTGGAGGTGTGCCCGACTCATGCATTAATGGTGGTTGACCGTAATAAGATGGATGAGATTGTCAAAGAACGCCGCCGCCGCGCCGCATTTGAAATGCCGGCCGACCTGATGTCCTGAGGACAGACGGATGCATGAGGTGACGTTATGCCAGAATGCGCTTGATATTA