Homologs in group_786

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03640 FBDBKF_03640 70.9 Morganella morganii S1 fhlA FhlA-type transcriptional regulator, contains GAF, AAA-type ATPase, and DNA-binding Fis domains
EHELCC_06895 EHELCC_06895 70.9 Morganella morganii S2 fhlA FhlA-type transcriptional regulator, contains GAF, AAA-type ATPase, and DNA-binding Fis domains
NLDBIP_07220 NLDBIP_07220 70.9 Morganella morganii S4 fhlA FhlA-type transcriptional regulator, contains GAF, AAA-type ATPase, and DNA-binding Fis domains
LHKJJB_06755 LHKJJB_06755 70.9 Morganella morganii S3 fhlA FhlA-type transcriptional regulator, contains GAF, AAA-type ATPase, and DNA-binding Fis domains
HKOGLL_04175 HKOGLL_04175 70.9 Morganella morganii S5 fhlA FhlA-type transcriptional regulator, contains GAF, AAA-type ATPase, and DNA-binding Fis domains
F4V73_RS11225 F4V73_RS11225 70.2 Morganella psychrotolerans - sigma 54-interacting transcriptional regulator

Distribution of the homologs in the orthogroup group_786

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_786

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P71229 0.0 588 55 8 540 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
E1WAA4 0.0 547 55 8 531 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
P0CL46 0.0 545 55 8 531 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P19323 0.0 545 55 9 531 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
Q9APD9 1.85e-89 285 48 4 322 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
P12626 2.25e-88 285 46 4 343 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
P14375 6.99e-88 280 47 3 315 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
Q06065 1.18e-87 280 44 4 349 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
Q8X613 2.1e-87 279 46 3 340 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
P25852 4.4e-87 278 47 2 315 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z333 4.54e-87 278 48 3 317 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
P27713 4.24e-84 274 42 6 396 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
Q53206 1.09e-82 271 55 1 237 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P26047 1.91e-82 272 42 6 342 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
P09570 1.92e-82 269 42 7 380 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
P56266 4.03e-82 268 44 5 339 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
P03027 4.67e-82 268 44 5 339 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
P54930 7.01e-82 267 45 3 332 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
P12627 1.55e-80 264 44 3 336 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
P05407 1.54e-79 263 48 4 307 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O87455 6.24e-79 260 37 5 419 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P09828 1.39e-78 259 43 4 347 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
P54931 1.75e-78 260 53 1 237 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q3K999 3.58e-78 253 49 1 251 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
P24426 4.71e-78 252 52 1 235 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
A0KEJ0 1.08e-77 256 54 0 234 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4STH5 1.13e-77 256 53 0 235 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
A6TCX4 9.33e-77 254 41 3 363 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P54929 1.07e-76 256 53 1 249 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
P30667 1.89e-76 256 53 1 249 1 nifA Nif-specific regulatory protein Azospirillum brasilense
C0PWN2 2.04e-76 253 47 4 300 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
A4WDR5 2.16e-76 253 41 3 366 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
B5XVA2 5.11e-76 252 38 7 452 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
P10577 5.54e-76 251 42 6 343 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
P0AFB8 6.76e-76 250 41 7 370 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 6.76e-76 250 41 7 370 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
G3XCV0 7.92e-76 251 43 6 344 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0AFU5 8.79e-76 249 52 0 243 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 8.79e-76 249 52 0 243 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
P09133 1.03e-75 254 52 1 244 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9I4N3 1.28e-75 249 51 1 243 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B4T3B0 1.67e-75 250 52 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
Q8Z4C6 2.13e-75 250 46 4 300 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 2.13e-75 250 46 4 300 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 2.13e-75 250 46 4 300 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 2.13e-75 250 46 4 300 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
B5RDG4 2.3e-75 250 46 4 300 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q5PF20 2.4e-75 250 46 4 300 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q6D8R9 2.56e-75 250 44 4 297 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P28787 4.55e-75 248 35 12 481 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
Q9K4U8 1.06e-74 248 44 3 316 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P41789 1.06e-74 247 41 7 370 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZMJ8 1.37e-74 248 52 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 1.37e-74 248 52 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
B5F363 1.4e-74 248 52 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
A9MFX7 1.74e-74 248 52 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q04848 2.01e-74 246 46 2 269 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
B5FSZ0 2.02e-74 247 52 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
B7LW25 2.64e-74 247 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P45671 4.74e-74 246 41 5 342 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
B6I695 4.92e-74 246 52 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
B4TF23 5.06e-74 246 46 4 300 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
A8GG93 7.51e-74 246 50 1 244 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
B7NSI9 7.99e-74 246 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A8ANR6 8.14e-74 246 52 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A7ZQD8 9.36e-74 246 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
Q845S7 1.08e-73 241 48 1 250 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
P23747 1.1e-73 244 50 1 244 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P06519 1.27e-73 247 51 0 231 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
Q1R7Z1 1.46e-73 245 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 1.46e-73 245 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 1.46e-73 245 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
Q7MFY9 1.51e-73 245 40 4 327 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
B1LQ27 1.6e-73 245 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
B7MZ04 1.62e-73 245 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
P37013 1.74e-73 245 51 0 237 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 1.74e-73 245 51 0 237 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 1.74e-73 245 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
Q3YYF5 2.02e-73 244 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
B7LEC0 2.04e-73 244 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
B7UHC1 2.18e-73 244 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q8FEN6 2.22e-73 244 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7N6T9 2.52e-73 244 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q0TEH1 2.55e-73 244 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7M9E6 2.66e-73 244 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
Q31X73 3.05e-73 244 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
A8A3I6 3.05e-73 244 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
B1IUX0 3.08e-73 244 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q5E3W8 3.24e-73 244 41 4 340 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5Z370 3.36e-73 244 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 3.36e-73 244 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
Q32CL9 3.81e-73 244 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
P59402 3.89e-73 244 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 3.89e-73 244 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
O85057 4.8e-73 245 42 7 328 1 None Limonene hydroxylase Geobacillus stearothermophilus
Q8D4F9 7.56e-73 243 35 5 420 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
P17899 3.12e-72 240 44 1 270 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P03029 4.89e-72 240 42 5 338 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
P54529 3.38e-71 243 52 1 236 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
P03028 2.18e-70 238 44 3 312 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
Q46802 2.89e-70 239 50 1 231 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
O31551 5.43e-70 238 41 7 338 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
P0CY94 6.38e-70 238 50 1 239 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
D5ARW9 6.45e-70 238 50 1 239 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P10576 1.17e-69 234 49 2 239 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
Q9HU19 3.15e-69 233 41 6 323 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88RJ6 1.21e-68 231 50 0 229 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q43965 2.95e-68 233 48 0 231 1 mopR Phenol regulator MopR Acinetobacter guillouiae
Q00934 9.13e-68 228 40 4 322 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88AQ2 1.37e-67 228 46 1 257 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P29267 4.68e-67 227 43 4 316 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9K4V0 1.34e-66 227 42 3 317 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q01265 2.12e-66 220 46 2 241 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
P37344 8.09e-66 219 46 3 254 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
Q87MX7 1.43e-65 223 37 6 362 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P13632 1.44e-65 223 39 3 319 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
P0C5S5 5.31e-65 221 39 2 292 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 5.31e-65 221 39 2 292 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
P31908 1.92e-64 221 43 5 324 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7MM78 3.03e-64 219 37 2 318 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 3.03e-64 219 37 2 318 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
Q9KT84 4.37e-64 219 41 0 262 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P10046 7.98e-64 218 39 3 320 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
P38022 8.55e-64 218 39 9 357 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
O25408 5.46e-62 211 48 0 215 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
P77743 3.05e-61 213 39 8 331 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
Q9KN48 5.13e-61 213 46 0 236 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P74839 3.1e-59 208 39 8 334 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P36219 3.45e-56 194 48 1 213 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
P28614 1.65e-54 198 29 12 517 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9ZIB7 2.26e-53 192 41 0 243 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
P07604 3.96e-53 191 37 7 327 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
P37931 1.14e-52 184 44 1 215 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
P0A2D7 1.53e-52 189 37 5 324 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 1.53e-52 189 37 5 324 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
P37930 4.99e-52 182 45 2 217 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
P26316 8.1e-52 182 46 4 217 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
O54426 1.72e-50 184 41 1 244 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
Q04849 2.07e-47 174 41 1 234 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P44694 5.02e-46 167 33 5 334 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q68WH4 1.2e-42 161 37 2 225 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZCY9 2e-42 161 37 2 225 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q4UL27 4.24e-41 157 36 2 225 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q1RJS1 5.91e-41 157 34 3 252 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
P26408 3.06e-40 155 34 8 339 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
P38035 6.3e-37 147 32 6 310 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
P45512 9.19e-37 147 33 6 303 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
P76016 1.78e-36 147 33 5 301 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
Q92HC2 2.72e-34 138 33 3 258 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P09432 2.42e-29 124 33 6 236 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P55610 1.08e-26 117 30 9 326 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P54156 6.89e-25 108 33 5 217 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
P06184 5.61e-14 77 23 7 322 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZLR9 3.74e-13 76 32 6 183 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)
P23914 1.33e-11 71 28 9 265 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
A0QTU7 1.6e-05 51 21 13 320 4 mimR Propane 2-monooxygenase operon transcriptional activator MimR Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P56269 2.51e-05 47 27 4 142 3 nifA Nif-specific regulatory protein (Fragment) Azotobacter chroococcum mcd 1
Q55434 2.91e-05 50 25 5 179 1 cph2 Phytochrome-like protein cph2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
G3XGC1 0.000189 47 21 12 320 4 mimR Propane 2-monooxygenase operon transcriptional activator MimR Mycolicibacterium goodii

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS17810
Feature type CDS
Gene -
Product sigma 54-interacting transcriptional regulator
Location 3913195 - 3914808 (strand: -1)
Length 1614 (nucleotides) / 537 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_786
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00158 Sigma-54 interaction domain
PF01590 GAF domain
PF02954 Bacterial regulatory protein, Fis family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3829 Transcription (K)
Signal transduction mechanisms (T)		 KT RocR-type transcriptional regulator, contains PAS, AAA-type ATPase, and DNA-binding Fis domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15836 formate hydrogenlyase transcriptional activator - -

Protein Sequence

MKLSSNNAETMESLRSERNQYRILVDITNSVLAHLDMDGLISEVSKEIHRFFGLNHISLMLCRTSSQNSHEGILYSSRYQTGKSVIRQQRKFSSANNKAEEIIHQNKPVLIDINKEDQDDVLIKRLVKQNMQTALLLPLAFNRKPLGLLILAHEISSVFTEETCQLLQQIAARIGIAIENAAAYEEITHLKDSLKNENIWLNEQINRNGSFSEIIYQSDAMHNVLEQIELVAQSDSTVLILGETGTGKELIARAIHRLSHRKNKTMIKMNCAAVPSGLLESDLFGHDKGAFTGATHAHVGRFEMADKSTLFLDEIGDMPIELQPKLLRVLQEREIERLGGNKVIPVDVRLIAATNKDLCELTDEGEFREDLYYRLNVFPIIIPPLRERPEDIPLLAKYFTQKIARRMDRKIDCIPTHALEQLTHYPWPGNVRELENIIERAVILTRGSTLNLQLKELNINKPSRLKQVLSQPSAIEKKMQTSAPESDDEERERIIQALRETNGVVAGARGAALKLGLKRTTLLSRMQRLGISIPEIL

Flanking regions ( +/- flanking 50bp)

TAATAAAGCGATTACAATATAGTTAATTTTTTAGGGCAATCGGTGGTGTCATGAAATTAAGCAGTAACAATGCTGAAACTATGGAGAGCCTTCGCAGTGAGCGGAATCAATATCGTATACTTGTCGATATTACAAATTCTGTATTAGCGCATCTAGACATGGATGGCCTCATTTCTGAAGTATCTAAAGAAATACATCGTTTTTTCGGACTTAATCATATTAGTCTGATGTTATGTCGTACTTCATCACAAAATAGTCATGAAGGTATTCTTTATTCTAGTCGTTATCAGACAGGAAAATCTGTCATTCGTCAACAACGTAAGTTCAGTAGCGCCAATAACAAAGCCGAAGAAATTATTCATCAAAACAAACCCGTTTTAATCGATATCAATAAAGAAGATCAAGACGATGTTTTGATTAAACGTCTCGTAAAACAAAATATGCAGACGGCTTTGTTATTGCCACTGGCTTTTAACCGTAAACCGCTAGGTTTATTAATCCTAGCGCATGAAATAAGTAGTGTTTTTACTGAAGAAACTTGTCAATTATTGCAACAAATTGCCGCGCGCATCGGGATTGCAATTGAAAATGCCGCCGCTTATGAAGAGATAACTCACCTTAAAGATAGCCTTAAGAACGAAAATATTTGGCTTAATGAACAAATAAATAGAAATGGTAGTTTTAGCGAGATTATTTATCAAAGCGATGCCATGCATAATGTACTAGAACAAATTGAGTTAGTCGCTCAAAGTGACAGTACTGTACTTATCTTAGGCGAAACAGGTACTGGTAAAGAGTTAATTGCACGAGCGATCCATCGTTTAAGTCATCGTAAAAATAAGACGATGATAAAAATGAATTGTGCAGCAGTACCTTCCGGTCTGTTAGAAAGTGATCTTTTTGGACATGATAAAGGCGCTTTTACGGGTGCAACACATGCCCATGTGGGTCGATTTGAAATGGCAGATAAAAGTACGCTTTTTCTCGATGAAATTGGCGATATGCCCATTGAATTACAGCCAAAACTATTACGGGTTCTCCAAGAGCGTGAAATCGAAAGATTAGGTGGTAATAAAGTTATTCCTGTGGATGTACGCTTAATTGCAGCGACCAATAAAGATTTATGTGAACTGACGGATGAAGGGGAATTTCGAGAAGATCTCTATTATCGTCTGAATGTTTTTCCTATTATTATCCCGCCATTACGGGAGCGGCCTGAAGATATCCCCTTATTGGCAAAATATTTTACGCAAAAAATTGCCCGCCGCATGGATAGAAAAATAGACTGTATTCCAACACATGCTTTGGAGCAATTAACCCATTATCCTTGGCCGGGAAATGTACGAGAGCTTGAAAATATTATTGAGCGCGCGGTTATTTTAACTCGAGGCTCTACGCTAAATTTGCAACTAAAAGAGTTAAATATCAATAAACCATCTCGTTTAAAACAAGTGCTTTCGCAACCATCAGCCATAGAAAAAAAGATGCAAACTAGCGCACCTGAAAGTGATGATGAAGAGCGTGAGCGGATAATACAAGCCCTTAGAGAAACTAACGGTGTAGTGGCTGGTGCCAGAGGTGCGGCATTAAAATTAGGATTAAAAAGAACCACCTTATTATCACGTATGCAACGCTTAGGTATTTCCATTCCTGAAATTCTTTAGTTTTACGACCACTACAGCCGATATTGTAAAACGAGTGTAATTAATTTGTT