Homologs in group_1781

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12140 FBDBKF_12140 90.2 Morganella morganii S1 fabR HTH-type transcriptional repressor FabR
EHELCC_14165 EHELCC_14165 90.2 Morganella morganii S2 fabR HTH-type transcriptional repressor FabR
NLDBIP_15260 NLDBIP_15260 90.2 Morganella morganii S4 fabR HTH-type transcriptional repressor FabR
LHKJJB_15350 LHKJJB_15350 90.2 Morganella morganii S3 fabR HTH-type transcriptional repressor FabR
HKOGLL_14470 HKOGLL_14470 90.2 Morganella morganii S5 fabR HTH-type transcriptional repressor FabR
F4V73_RS16935 F4V73_RS16935 88.8 Morganella psychrotolerans fabR HTH-type transcriptional repressor FabR

Distribution of the homologs in the orthogroup group_1781

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1781

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B5BJN7 6.16e-133 375 88 0 209 3 fabR HTH-type transcriptional repressor FabR Salmonella paratyphi A (strain AKU_12601)
Q5PK70 6.16e-133 375 88 0 209 3 fabR HTH-type transcriptional repressor FabR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B1JQ48 1.42e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G60 1.42e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRG3 1.42e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Yersinia pestis (strain Pestoides F)
Q1CNP3 1.42e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Yersinia pestis bv. Antiqua (strain Nepal516)
A9R6N6 1.42e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Yersinia pestis bv. Antiqua (strain Angola)
Q7CL09 1.42e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Yersinia pestis
B2JZF5 1.42e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBU4 1.42e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD11 1.42e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q3YV13 1.57e-132 374 90 0 203 3 fabR HTH-type transcriptional repressor FabR Shigella sonnei (strain Ss046)
Q31U25 1.57e-132 374 90 0 203 3 fabR HTH-type transcriptional repressor FabR Shigella boydii serotype 4 (strain Sb227)
B2TWF8 1.57e-132 374 90 0 203 3 fabR HTH-type transcriptional repressor FabR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A8A771 1.57e-132 374 90 0 203 3 fabR HTH-type transcriptional repressor FabR Escherichia coli O9:H4 (strain HS)
Q7CPB8 1.97e-132 374 90 0 203 3 fabR HTH-type transcriptional repressor FabR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XGD6 1.97e-132 374 90 0 203 3 fabR HTH-type transcriptional repressor FabR Salmonella typhi
C0Q479 1.97e-132 374 90 0 203 3 fabR HTH-type transcriptional repressor FabR Salmonella paratyphi C (strain RKS4594)
Q57H90 1.97e-132 374 90 0 203 3 fabR HTH-type transcriptional repressor FabR Salmonella choleraesuis (strain SC-B67)
Q1R3U4 2.35e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Escherichia coli (strain UTI89 / UPEC)
Q8FB90 2.35e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TA93 2.35e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AIE5 2.35e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Escherichia coli O1:K1 / APEC
A8AKV8 2.43e-132 374 90 0 203 3 fabR HTH-type transcriptional repressor FabR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P0ACU6 2.48e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Shigella flexneri
Q0SY28 2.48e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Shigella flexneri serotype 5b (strain 8401)
Q32AE3 2.48e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Shigella dysenteriae serotype 1 (strain Sd197)
B1XBX4 2.48e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Escherichia coli (strain K12 / DH10B)
Q7A964 2.48e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Escherichia coli O157:H7
A7ZUI3 2.48e-132 374 89 0 203 3 fabR HTH-type transcriptional repressor FabR Escherichia coli O139:H28 (strain E24377A / ETEC)
A9MHG9 3.05e-132 373 90 0 203 3 fabR HTH-type transcriptional repressor FabR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A7ML90 4.03e-132 373 87 0 209 3 fabR HTH-type transcriptional repressor FabR Cronobacter sakazakii (strain ATCC BAA-894)
P0ACU5 7.73e-132 373 89 0 203 1 fabR HTH-type transcriptional repressor FabR Escherichia coli (strain K12)
A1JI38 9.66e-132 372 89 0 203 3 fabR HTH-type transcriptional repressor FabR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A6TGE7 1.19e-131 372 89 0 203 3 fabR HTH-type transcriptional repressor FabR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
C5A0R2 6.04e-131 370 89 0 203 3 fabR HTH-type transcriptional repressor FabR Escherichia coli (strain K12 / MC4100 / BW2952)
P44757 1.14e-91 270 67 0 195 4 HI_0570 Uncharacterized HTH-type transcriptional regulator HI_0570 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q99R60 2.87e-05 46 22 3 166 4 SAV2578 HTH-type transcriptional regulator SAV2578 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q79ZX9 2.87e-05 46 22 3 166 4 MW2498 HTH-type transcriptional regulator MW2498 Staphylococcus aureus (strain MW2)
Q6G696 2.87e-05 46 22 3 166 4 SAS2464 HTH-type transcriptional regulator SAS2464 Staphylococcus aureus (strain MSSA476)
Q7A3C7 2.87e-05 46 22 3 166 4 SA2364 HTH-type transcriptional regulator SA2364 Staphylococcus aureus (strain N315)
Q2FV42 2.98e-05 46 22 3 166 4 SAOUHSC_02897 HTH-type transcriptional regulator SAOUHSC_02897 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q5HCX3 2.98e-05 46 22 3 166 4 SACOL2593 HTH-type transcriptional regulator SACOL2593 Staphylococcus aureus (strain COL)
Q2FDS9 2.98e-05 46 22 3 166 4 SAUSA300_2515 HTH-type transcriptional regulator SAUSA300_2515 Staphylococcus aureus (strain USA300)
Q6GDM3 3.58e-05 46 22 3 166 4 SAR2658 HTH-type transcriptional regulator SAR2658 Staphylococcus aureus (strain MRSA252)
Q2YWD0 0.000125 45 22 3 163 4 SAB2452 HTH-type transcriptional regulator SAB2452 Staphylococcus aureus (strain bovine RF122 / ET3-1)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS16035
Feature type CDS
Gene fabR
Product HTH-type transcriptional repressor FabR
Location 3564239 - 3564919 (strand: 1)
Length 681 (nucleotides) / 226 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1781
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00440 Bacterial regulatory proteins, tetR family
PF21943 Tetracyclin repressor-like, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1309 Transcription (K) K DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K22105 TetR/AcrR family transcriptional regulator, fatty acid biosynthesis regulator - -

Protein Sequence

MSNNIGIRAKQKEKTRRSLIEAAFSQLSAERSFTSLSLREVAREAGIAPTSFYRHFKDVDELGLTMVDESGLMLRQLMRQARQRIAKGGSVIRTSVSTFMEFIGNNPNAFRLLLRERSGTSAEFRAAVAREIQHFIAELADYLEQESNMPRYFTEMQAEAMVTIVFSAGAEALDIDIEKRQQLEERLVIQLRMIAKGAYYWYRRDLETPLQNNPEIKKKMHQKGDK

Flanking regions ( +/- flanking 50bp)

AAAAATTTGATATATTGGTTATAAACCACATTTGGATTATCAGGATTGCTGTGAGTAATAATATTGGCATCAGAGCGAAACAAAAAGAAAAAACCCGCCGTTCTTTGATTGAAGCAGCTTTTAGCCAACTCAGTGCAGAACGTAGTTTTACTAGCCTAAGCTTACGAGAAGTGGCGCGAGAAGCGGGTATTGCACCTACCTCATTTTATCGTCATTTTAAAGATGTTGATGAGTTGGGGTTAACTATGGTCGATGAAAGTGGACTGATGCTACGTCAATTGATGCGACAAGCACGACAGCGTATTGCTAAAGGTGGAAGTGTGATCCGTACATCGGTTTCTACCTTTATGGAATTTATTGGTAATAATCCGAATGCTTTTCGATTATTGTTACGTGAACGCTCTGGCACATCTGCTGAATTTCGTGCCGCTGTCGCACGAGAGATCCAACATTTTATTGCAGAACTGGCAGACTACCTTGAGCAAGAAAGTAATATGCCACGTTATTTTACTGAAATGCAGGCTGAAGCGATGGTGACTATCGTATTTAGTGCAGGGGCAGAAGCATTAGATATTGATATTGAAAAACGCCAACAATTAGAAGAAAGATTAGTAATACAACTACGGATGATTGCCAAAGGCGCTTACTATTGGTATCGACGTGATTTAGAAACACCTCTACAAAATAACCCCGAAATAAAGAAAAAAATGCATCAGAAAGGAGATAAATGATGGAACAAAATCGCTGTGAAAAAAGCACACTATTACTTTCCGTAGTTATC