Homologs in group_1781

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12140 FBDBKF_12140 100.0 Morganella morganii S1 fabR HTH-type transcriptional repressor FabR
EHELCC_14165 EHELCC_14165 100.0 Morganella morganii S2 fabR HTH-type transcriptional repressor FabR
LHKJJB_15350 LHKJJB_15350 100.0 Morganella morganii S3 fabR HTH-type transcriptional repressor FabR
HKOGLL_14470 HKOGLL_14470 100.0 Morganella morganii S5 fabR HTH-type transcriptional repressor FabR
F4V73_RS16935 F4V73_RS16935 95.0 Morganella psychrotolerans fabR HTH-type transcriptional repressor FabR
PMI_RS16035 PMI_RS16035 90.2 Proteus mirabilis HI4320 fabR HTH-type transcriptional repressor FabR

Distribution of the homologs in the orthogroup group_1781

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1781

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A8AKV8 6.86e-134 377 89 1 210 3 fabR HTH-type transcriptional repressor FabR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q7CPB8 2.47e-133 375 89 1 210 3 fabR HTH-type transcriptional repressor FabR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XGD6 2.47e-133 375 89 1 210 3 fabR HTH-type transcriptional repressor FabR Salmonella typhi
C0Q479 2.47e-133 375 89 1 210 3 fabR HTH-type transcriptional repressor FabR Salmonella paratyphi C (strain RKS4594)
Q57H90 2.47e-133 375 89 1 210 3 fabR HTH-type transcriptional repressor FabR Salmonella choleraesuis (strain SC-B67)
A9MHG9 2.98e-133 375 88 1 210 3 fabR HTH-type transcriptional repressor FabR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A7ML90 3.26e-133 375 88 1 210 3 fabR HTH-type transcriptional repressor FabR Cronobacter sakazakii (strain ATCC BAA-894)
B1JQ48 4.24e-133 375 87 0 208 3 fabR HTH-type transcriptional repressor FabR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G60 4.24e-133 375 87 0 208 3 fabR HTH-type transcriptional repressor FabR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRG3 4.24e-133 375 87 0 208 3 fabR HTH-type transcriptional repressor FabR Yersinia pestis (strain Pestoides F)
Q1CNP3 4.24e-133 375 87 0 208 3 fabR HTH-type transcriptional repressor FabR Yersinia pestis bv. Antiqua (strain Nepal516)
A9R6N6 4.24e-133 375 87 0 208 3 fabR HTH-type transcriptional repressor FabR Yersinia pestis bv. Antiqua (strain Angola)
Q7CL09 4.24e-133 375 87 0 208 3 fabR HTH-type transcriptional repressor FabR Yersinia pestis
B2JZF5 4.24e-133 375 87 0 208 3 fabR HTH-type transcriptional repressor FabR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBU4 4.24e-133 375 87 0 208 3 fabR HTH-type transcriptional repressor FabR Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD11 4.24e-133 375 87 0 208 3 fabR HTH-type transcriptional repressor FabR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A6TGE7 4.67e-133 375 88 1 210 3 fabR HTH-type transcriptional repressor FabR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5BJN7 4.88e-133 375 90 0 205 3 fabR HTH-type transcriptional repressor FabR Salmonella paratyphi A (strain AKU_12601)
Q5PK70 4.88e-133 375 90 0 205 3 fabR HTH-type transcriptional repressor FabR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P0ACU5 6.84e-133 375 89 0 205 1 fabR HTH-type transcriptional repressor FabR Escherichia coli (strain K12)
A8A771 1.04e-132 374 90 0 204 3 fabR HTH-type transcriptional repressor FabR Escherichia coli O9:H4 (strain HS)
Q1R3U4 1.51e-132 374 89 0 204 3 fabR HTH-type transcriptional repressor FabR Escherichia coli (strain UTI89 / UPEC)
Q8FB90 1.51e-132 374 89 0 204 3 fabR HTH-type transcriptional repressor FabR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TA93 1.51e-132 374 89 0 204 3 fabR HTH-type transcriptional repressor FabR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AIE5 1.51e-132 374 89 0 204 3 fabR HTH-type transcriptional repressor FabR Escherichia coli O1:K1 / APEC
A1JI38 1.58e-132 374 88 0 205 3 fabR HTH-type transcriptional repressor FabR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P0ACU6 1.67e-132 374 89 0 204 3 fabR HTH-type transcriptional repressor FabR Shigella flexneri
Q0SY28 1.67e-132 374 89 0 204 3 fabR HTH-type transcriptional repressor FabR Shigella flexneri serotype 5b (strain 8401)
Q32AE3 1.67e-132 374 89 0 204 3 fabR HTH-type transcriptional repressor FabR Shigella dysenteriae serotype 1 (strain Sd197)
B1XBX4 1.67e-132 374 89 0 204 3 fabR HTH-type transcriptional repressor FabR Escherichia coli (strain K12 / DH10B)
Q7A964 1.67e-132 374 89 0 204 3 fabR HTH-type transcriptional repressor FabR Escherichia coli O157:H7
A7ZUI3 1.67e-132 374 89 0 204 3 fabR HTH-type transcriptional repressor FabR Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3YV13 2.96e-132 373 89 0 204 3 fabR HTH-type transcriptional repressor FabR Shigella sonnei (strain Ss046)
Q31U25 2.96e-132 373 89 0 204 3 fabR HTH-type transcriptional repressor FabR Shigella boydii serotype 4 (strain Sb227)
B2TWF8 2.96e-132 373 89 0 204 3 fabR HTH-type transcriptional repressor FabR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
C5A0R2 5.11e-131 370 89 0 204 3 fabR HTH-type transcriptional repressor FabR Escherichia coli (strain K12 / MC4100 / BW2952)
P44757 1.34e-90 267 65 0 203 4 HI_0570 Uncharacterized HTH-type transcriptional regulator HI_0570 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_15260
Feature type CDS
Gene fabR
Product HTH-type transcriptional repressor FabR
Location 54801 - 55457 (strand: 1)
Length 657 (nucleotides) / 218 (amino acids)
In genomic island -

Contig

Accession ZDB_531
Length 138641 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1781
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00440 Bacterial regulatory proteins, tetR family
PF21943 Tetracyclin repressor-like, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1309 Transcription (K) K DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K22105 TetR/AcrR family transcriptional regulator, fatty acid biosynthesis regulator - -

Protein Sequence

MSNVIGVRAKQKEKTRRALIEAAFSQLSAERSFTSLSLREVAREAGIAPTSFYRHFKDVDELGLTMVDESGLMLRQLMRQARQRIAKGGSVIRTSVATFMEFIGNNPNAFRLLLRERSGTSAEFRAAVAREIQHFIAELADYLELESKMPRQFTELQAESMVTIVFSAGAEALDIDLEKRAHLEERLVLQLRMIARGAYYWYRREQEKMHDSDYTPLI

Flanking regions ( +/- flanking 50bp)

ATTAAGTTTGTTATATTGATCCGTCTGAATAAATTGAGAGTCTGAATTCCGTGAGTAACGTGATTGGTGTAAGAGCAAAACAGAAAGAAAAAACCCGCCGGGCCCTGATTGAAGCTGCCTTCAGTCAGCTCAGCGCCGAGCGCAGCTTCACCAGTCTGAGCCTGCGCGAGGTTGCCCGTGAAGCCGGGATCGCCCCGACCTCTTTTTATCGCCATTTCAAAGATGTGGATGAACTGGGGCTGACGATGGTGGATGAGAGCGGGCTGATGCTGCGCCAGCTGATGCGTCAGGCGCGTCAGCGTATCGCCAAAGGCGGGAGTGTGATCCGGACATCAGTTGCGACATTTATGGAGTTTATCGGTAATAACCCCAACGCTTTCAGGTTATTATTGCGTGAGCGCTCCGGTACATCCGCGGAATTCCGTGCGGCGGTCGCACGGGAAATCCAGCATTTTATTGCAGAACTGGCAGACTATCTGGAACTGGAAAGTAAAATGCCGCGTCAGTTTACTGAATTGCAGGCAGAATCGATGGTGACCATCGTTTTCAGCGCCGGTGCGGAAGCACTGGATATTGATTTGGAAAAGCGGGCGCACCTGGAAGAGCGGCTGGTATTACAGCTGCGGATGATCGCCAGAGGCGCGTATTACTGGTACCGCCGCGAACAAGAGAAAATGCATGACTCCGATTACACCCCATTAATCTGACACTTATCACCAAGGAGAACGTTATGACGGAACAACATCGCCGTGACAAA