Homologs in group_1781

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12140 FBDBKF_12140 95.0 Morganella morganii S1 fabR HTH-type transcriptional repressor FabR
EHELCC_14165 EHELCC_14165 95.0 Morganella morganii S2 fabR HTH-type transcriptional repressor FabR
NLDBIP_15260 NLDBIP_15260 95.0 Morganella morganii S4 fabR HTH-type transcriptional repressor FabR
LHKJJB_15350 LHKJJB_15350 95.0 Morganella morganii S3 fabR HTH-type transcriptional repressor FabR
HKOGLL_14470 HKOGLL_14470 95.0 Morganella morganii S5 fabR HTH-type transcriptional repressor FabR
PMI_RS16035 PMI_RS16035 88.8 Proteus mirabilis HI4320 fabR HTH-type transcriptional repressor FabR

Distribution of the homologs in the orthogroup group_1781

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1781

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ACU5 5.55e-131 370 87 0 206 1 fabR HTH-type transcriptional repressor FabR Escherichia coli (strain K12)
A8A771 6.16e-131 370 88 0 205 3 fabR HTH-type transcriptional repressor FabR Escherichia coli O9:H4 (strain HS)
P0ACU6 1.1e-130 369 87 0 205 3 fabR HTH-type transcriptional repressor FabR Shigella flexneri
Q0SY28 1.1e-130 369 87 0 205 3 fabR HTH-type transcriptional repressor FabR Shigella flexneri serotype 5b (strain 8401)
Q32AE3 1.1e-130 369 87 0 205 3 fabR HTH-type transcriptional repressor FabR Shigella dysenteriae serotype 1 (strain Sd197)
B1XBX4 1.1e-130 369 87 0 205 3 fabR HTH-type transcriptional repressor FabR Escherichia coli (strain K12 / DH10B)
Q7A964 1.1e-130 369 87 0 205 3 fabR HTH-type transcriptional repressor FabR Escherichia coli O157:H7
A7ZUI3 1.1e-130 369 87 0 205 3 fabR HTH-type transcriptional repressor FabR Escherichia coli O139:H28 (strain E24377A / ETEC)
Q1R3U4 1.36e-130 369 87 0 205 3 fabR HTH-type transcriptional repressor FabR Escherichia coli (strain UTI89 / UPEC)
Q8FB90 1.36e-130 369 87 0 205 3 fabR HTH-type transcriptional repressor FabR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TA93 1.36e-130 369 87 0 205 3 fabR HTH-type transcriptional repressor FabR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AIE5 1.36e-130 369 87 0 205 3 fabR HTH-type transcriptional repressor FabR Escherichia coli O1:K1 / APEC
B5BJN7 1.43e-130 369 88 0 204 3 fabR HTH-type transcriptional repressor FabR Salmonella paratyphi A (strain AKU_12601)
Q5PK70 1.43e-130 369 88 0 204 3 fabR HTH-type transcriptional repressor FabR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q7CPB8 1.54e-130 369 88 0 204 3 fabR HTH-type transcriptional repressor FabR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XGD6 1.54e-130 369 88 0 204 3 fabR HTH-type transcriptional repressor FabR Salmonella typhi
C0Q479 1.54e-130 369 88 0 204 3 fabR HTH-type transcriptional repressor FabR Salmonella paratyphi C (strain RKS4594)
Q57H90 1.54e-130 369 88 0 204 3 fabR HTH-type transcriptional repressor FabR Salmonella choleraesuis (strain SC-B67)
Q3YV13 1.77e-130 369 87 0 205 3 fabR HTH-type transcriptional repressor FabR Shigella sonnei (strain Ss046)
Q31U25 1.77e-130 369 87 0 205 3 fabR HTH-type transcriptional repressor FabR Shigella boydii serotype 4 (strain Sb227)
B2TWF8 1.77e-130 369 87 0 205 3 fabR HTH-type transcriptional repressor FabR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A8AKV8 1.82e-130 369 88 0 204 3 fabR HTH-type transcriptional repressor FabR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A7ML90 1.95e-130 369 85 0 210 3 fabR HTH-type transcriptional repressor FabR Cronobacter sakazakii (strain ATCC BAA-894)
A9MHG9 2.15e-130 368 88 0 204 3 fabR HTH-type transcriptional repressor FabR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B1JQ48 4.39e-130 367 87 0 204 3 fabR HTH-type transcriptional repressor FabR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G60 4.39e-130 367 87 0 204 3 fabR HTH-type transcriptional repressor FabR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRG3 4.39e-130 367 87 0 204 3 fabR HTH-type transcriptional repressor FabR Yersinia pestis (strain Pestoides F)
Q1CNP3 4.39e-130 367 87 0 204 3 fabR HTH-type transcriptional repressor FabR Yersinia pestis bv. Antiqua (strain Nepal516)
A9R6N6 4.39e-130 367 87 0 204 3 fabR HTH-type transcriptional repressor FabR Yersinia pestis bv. Antiqua (strain Angola)
Q7CL09 4.39e-130 367 87 0 204 3 fabR HTH-type transcriptional repressor FabR Yersinia pestis
B2JZF5 4.39e-130 367 87 0 204 3 fabR HTH-type transcriptional repressor FabR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBU4 4.39e-130 367 87 0 204 3 fabR HTH-type transcriptional repressor FabR Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD11 4.39e-130 367 87 0 204 3 fabR HTH-type transcriptional repressor FabR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1JI38 1.12e-129 366 87 0 204 3 fabR HTH-type transcriptional repressor FabR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A6TGE7 1.34e-129 366 85 0 210 3 fabR HTH-type transcriptional repressor FabR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
C5A0R2 3.56e-129 365 87 0 205 3 fabR HTH-type transcriptional repressor FabR Escherichia coli (strain K12 / MC4100 / BW2952)
P44757 1.02e-89 265 65 0 203 4 HI_0570 Uncharacterized HTH-type transcriptional regulator HI_0570 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS16935
Feature type CDS
Gene fabR
Product HTH-type transcriptional repressor FabR
Location 8442 - 9098 (strand: -1)
Length 657 (nucleotides) / 218 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000007
Length 196482 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1781
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00440 Bacterial regulatory proteins, tetR family
PF21943 Tetracyclin repressor-like, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1309 Transcription (K) K DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K22105 TetR/AcrR family transcriptional regulator, fatty acid biosynthesis regulator - -

Protein Sequence

MSNVIGVRAKQKEKTRRALIEAAFSQLSAERSFTSLSLREVAREAGIAPTSFYRHFKDVDELGLTMVDESGLMLRQLMRQARQRIAKGGSVIRTSVATFMEFIGNNPNAFRLLLRERSGTSAEFRAAVAREIQHFIAELADYLEMESKMPRQFTELQAESMVTIVFSAGAEALDIDFDKRAHLEVRLVLQLRMIARGAYYWYRRQQEKTDDTDDSPLT

Flanking regions ( +/- flanking 50bp)

ACTAAGTTTGCTATATTGATCTGTCTGAATTAATTGAGAGCCAAAATTCTGTGAGTAACGTGATTGGTGTAAGAGCAAAACAAAAAGAAAAAACCCGCCGGGCTCTGATTGAAGCTGCCTTCAGTCAGCTCAGCGCAGAACGCAGCTTCACCAGTCTGAGCTTACGCGAAGTCGCCCGTGAGGCCGGGATCGCACCGACCTCATTTTACCGCCATTTCAAAGATGTGGATGAACTGGGTCTGACGATGGTCGATGAAAGCGGGCTGATGCTGCGCCAACTGATGCGCCAGGCACGTCAGCGTATCGCAAAAGGCGGTAGTGTGATCCGGACATCAGTTGCAACATTTATGGAGTTTATCGGTAATAACCCCAACGCTTTCAGGTTACTATTACGTGAGCGCTCCGGTACATCTGCGGAGTTTCGTGCGGCTGTTGCACGGGAAATCCAGCATTTTATTGCTGAACTGGCAGACTATCTGGAAATGGAAAGCAAAATGCCACGCCAGTTTACGGAACTACAGGCGGAGTCGATGGTAACCATCGTCTTCAGTGCCGGTGCGGAAGCACTGGATATTGATTTTGACAAGCGTGCGCATCTGGAAGTACGGCTGGTATTACAACTGCGGATGATTGCCCGTGGTGCGTATTACTGGTATCGCCGCCAACAAGAGAAAACAGATGACACTGATGACAGCCCTTTAACTTAACACTACCAGGGAGAATGCTATGACGGAACAGTACCGCCGTGACAAAGGAA