Homologs in group_1812

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12335 FBDBKF_12335 80.9 Morganella morganii S1 cpxA envelope stress sensor histidine kinase CpxA
EHELCC_13970 EHELCC_13970 80.9 Morganella morganii S2 cpxA envelope stress sensor histidine kinase CpxA
NLDBIP_15065 NLDBIP_15065 80.9 Morganella morganii S4 cpxA envelope stress sensor histidine kinase CpxA
LHKJJB_15545 LHKJJB_15545 80.9 Morganella morganii S3 cpxA envelope stress sensor histidine kinase CpxA
HKOGLL_14665 HKOGLL_14665 80.9 Morganella morganii S5 cpxA envelope stress sensor histidine kinase CpxA
F4V73_RS17165 F4V73_RS17165 80.9 Morganella psychrotolerans cpxA envelope stress sensor histidine kinase CpxA

Distribution of the homologs in the orthogroup group_1812

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1812

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AE82 0.0 697 78 0 455 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 0.0 697 78 0 455 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 0.0 697 78 0 455 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
A0A0H3GPN8 0.0 692 78 0 451 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
P18392 5.79e-38 146 32 6 314 1 rstB Sensor protein RstB Escherichia coli (strain K12)
P41406 5.88e-35 138 32 5 265 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
P08982 6.76e-35 138 32 5 265 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 6.76e-35 138 32 5 265 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
A0A4P7TSF2 3.14e-34 136 31 6 266 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 3.14e-34 136 31 6 266 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 3.14e-34 136 31 6 266 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
A1TEL6 1.87e-26 114 30 10 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q9CCJ1 3.36e-26 114 28 8 330 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
A0QR01 4.24e-26 112 32 5 227 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q742C0 1.09e-25 113 30 8 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P77485 1.31e-25 112 29 10 336 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
P9WGK9 1.56e-25 112 27 6 330 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P23545 1.71e-25 112 33 4 219 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
Q8XBY4 1.98e-25 112 29 10 337 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
P9WGK8 2.24e-25 112 27 6 327 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 2.24e-25 112 27 6 327 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8FK37 3.32e-25 111 28 10 336 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P45608 3.94e-25 110 30 3 231 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
A0QBR0 4.77e-25 111 30 8 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
P30847 7.99e-25 110 28 6 275 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
Q4L6C5 1.77e-24 108 28 6 279 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
Q45614 1.91e-24 109 30 4 234 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
Q49XM6 2.21e-24 108 26 4 290 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8CU87 2.36e-24 109 31 6 240 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 2.36e-24 109 31 6 240 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P08400 4.55e-24 107 30 5 232 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
A0QTK3 5.87e-24 108 28 5 285 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q4A159 6.91e-24 108 32 7 242 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q93CB7 7.22e-24 107 27 6 327 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8CRA8 1.21e-23 106 30 10 266 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q9RDT3 1.39e-23 105 30 6 240 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q7A215 2.18e-23 106 30 6 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 2.18e-23 106 30 6 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 2.18e-23 106 30 6 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 2.18e-23 106 30 6 240 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 2.18e-23 106 30 6 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD58 2.18e-23 106 30 6 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q5HJX6 2.18e-23 106 30 6 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 2.18e-23 106 30 6 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 2.18e-23 106 30 6 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 2.18e-23 106 30 6 240 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 2.18e-23 106 30 6 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 2.18e-23 106 30 6 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 2.18e-23 106 30 6 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
A3Q5L8 2.52e-23 105 30 9 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
Q6GKS6 2.53e-23 106 30 6 240 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
Q1B3X9 2.64e-23 105 30 9 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 2.64e-23 105 30 9 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
A5A2P0 2.79e-23 104 30 6 232 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
Q5HLN1 3.19e-23 105 30 10 266 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4LAJ8 3.49e-23 105 31 6 240 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
Q9Z5G7 3.95e-23 105 29 9 283 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
Q55932 4.63e-23 104 32 5 219 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A0PWB3 4.95e-23 105 30 9 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
Q9ZHD4 5.16e-23 104 27 5 275 3 silS Probable sensor kinase SilS Salmonella typhimurium
Q4L8M0 7.26e-23 103 26 7 296 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
P45609 1.14e-22 103 29 5 232 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
Q49ZT9 1.59e-22 103 26 7 277 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P9WGK5 1.73e-22 102 31 4 226 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 1.73e-22 102 31 4 226 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 1.73e-22 102 31 4 226 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0R3I7 2.7e-22 102 30 9 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9HZ47 2.81e-22 102 30 8 268 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
I1WSZ3 3.72e-22 102 30 9 286 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
Q8CSL7 4.48e-22 101 23 10 403 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P0DMK6 4.97e-22 101 30 9 286 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
O34638 1.15e-21 100 26 6 301 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
Q5HPC4 1.28e-21 100 23 11 417 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P71380 1.85e-21 99 26 3 231 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O69729 2.35e-21 99 26 9 311 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A8Z553 2.61e-21 99 25 5 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 2.61e-21 99 25 5 286 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 2.61e-21 99 25 5 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 2.61e-21 99 25 5 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 2.61e-21 99 25 5 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
Q7A0W5 4.3e-21 99 24 7 342 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 4.3e-21 99 24 7 342 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 4.3e-21 99 24 7 342 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 4.3e-21 99 24 7 342 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 4.3e-21 99 24 7 342 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 4.3e-21 99 24 7 342 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 4.3e-21 99 24 7 342 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
Q2YY04 5.63e-21 98 24 5 286 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GGZ4 5.79e-21 98 24 5 286 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
Q7A3X0 1.3e-20 97 24 5 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 1.3e-20 97 24 5 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 1.3e-20 97 24 5 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 1.3e-20 97 24 5 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 1.3e-20 97 24 5 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NV46 1.53e-20 97 24 5 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 1.53e-20 97 24 5 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
P35164 1.83e-20 97 28 3 227 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
P54883 2.73e-20 96 30 4 226 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
A1KHB8 4.46e-20 96 29 9 272 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 4.46e-20 96 29 9 272 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q2YZ23 4.68e-20 95 24 5 286 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
P9WGL1 9.11e-20 95 29 9 272 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 9.11e-20 95 29 9 272 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 9.11e-20 95 29 9 272 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q6GE72 4.05e-19 92 24 5 280 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
Q47457 5.5e-19 92 29 9 280 3 pcoS Probable sensor protein PcoS Escherichia coli
Q04804 7.09e-19 92 31 12 289 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02541 3.26e-18 90 26 8 275 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
Q8DPL8 3.57e-18 90 31 5 225 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 3.57e-18 90 31 5 225 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P94414 7.42e-18 89 27 10 307 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
P72292 1.53e-17 88 27 11 305 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
P37461 1.62e-17 88 28 6 238 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A4I8 1.85e-17 87 27 5 279 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 1.85e-17 87 27 5 279 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8X614 3.11e-17 87 29 6 226 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
Q8DMT2 3.38e-17 86 27 5 236 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9APE0 8e-17 85 29 6 218 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
Q8Z332 8.88e-17 85 27 6 238 3 zraS Sensor histidine kinase ZraS Salmonella typhi
O32193 9.46e-17 85 22 7 312 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
Q9F8D7 9.49e-17 86 27 11 346 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q08408 1.09e-16 85 24 4 231 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
P9WGK7 1.16e-16 85 25 9 328 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 1.16e-16 85 25 9 328 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 1.16e-16 85 25 9 328 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O34206 1.29e-16 85 31 8 218 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
P48027 1.53e-16 85 26 10 346 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
P44578 1.59e-16 84 27 7 257 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q04943 1.82e-16 85 26 6 290 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P14377 2.54e-16 84 28 6 226 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
Q03228 3.15e-16 84 29 5 231 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
O33071 3.67e-16 84 27 13 336 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
Q92H24 8.82e-16 83 28 13 306 3 RC0948 Putative sensor histidine kinase NtrY-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q7A5H7 1.16e-15 82 27 7 231 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 1.16e-15 82 27 7 231 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7A1J2 1.28e-15 81 25 10 306 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 1.28e-15 81 25 10 306 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 1.28e-15 81 25 10 306 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 1.28e-15 81 25 10 306 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 1.28e-15 81 25 10 306 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q4UMD4 1.28e-15 82 28 14 306 3 RF_0427 Putative sensor histidine kinase NtrY-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A7HD43 1.37e-15 81 29 6 227 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
Q8NWF3 1.38e-15 82 27 7 231 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 1.38e-15 82 27 7 231 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 1.38e-15 82 27 7 231 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 1.38e-15 82 27 7 231 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GIT7 1.4e-15 81 25 10 306 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q9L523 1.4e-15 82 27 7 231 1 srrB Sensor protein SrrB Staphylococcus aureus
Q6GGK7 1.49e-15 82 27 7 231 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q68WC5 1.9e-15 82 26 12 305 3 RT0603 Putative sensor histidine kinase NtrY-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q5HHW5 2.01e-15 80 25 10 306 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 2.01e-15 80 25 10 306 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 2.01e-15 80 25 10 306 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
Q07737 2.3e-15 82 26 9 307 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
Q840P7 2.35e-15 80 25 10 306 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
Q44007 4.26e-15 80 27 5 272 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q9I0I2 4.53e-15 80 26 7 258 3 carS Sensor protein kinase CarS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A5W4E3 5.51e-15 81 26 6 239 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 0.000713 45 29 2 87 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P39664 6.21e-15 80 31 6 232 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9ZCU7 6.98e-15 80 26 12 305 3 RP614 Putative sensor histidine kinase NtrY-like Rickettsia prowazekii (strain Madrid E)
B2J946 8.12e-15 79 24 6 238 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q9HV31 9e-15 79 29 8 230 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A4I6 1.21e-14 79 28 9 238 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 1.21e-14 79 28 9 238 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
E0X9C7 1.35e-14 80 26 6 239 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 0.000689 45 29 2 87 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
P76339 1.74e-14 79 26 9 284 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
Q54SP4 1.85e-14 79 26 4 235 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q8KIY1 2.61e-14 79 26 7 239 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 0.000135 48 36 3 77 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q44930 5.46e-14 76 25 7 260 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
Q2T0V9 5.47e-14 77 25 3 210 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q06240 7.38e-14 76 26 7 242 1 vanS Sensor protein VanS Enterococcus faecium
Q55630 7.89e-14 76 24 6 235 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8CTI3 8.13e-14 75 27 11 283 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 8.13e-14 75 27 11 283 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9KLK7 8.57e-14 77 28 6 235 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P23621 9.01e-14 76 27 4 224 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7K3M6 1.49e-13 75 25 6 234 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
P20169 1.87e-13 76 28 7 218 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P23837 3.14e-13 75 25 11 299 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
Q8X739 3.14e-13 75 25 11 299 3 phoQ Sensor protein PhoQ Escherichia coli O157:H7
Q83RR1 3.2e-13 75 25 11 299 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
Q8E3C7 3.33e-13 74 25 6 230 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
Q8FIB8 3.52e-13 75 25 11 299 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P96368 5.28e-13 74 25 11 394 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q869S5 5.67e-13 75 26 6 227 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q70FG9 6.26e-13 73 24 9 288 3 pmrB Sensor histidine kinase PmrB Pectobacterium parmentieri
Q8YR50 6.63e-13 73 25 8 241 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3M8A7 6.81e-13 73 25 8 241 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
O31661 6.82e-13 74 27 5 216 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
Q8D5Z6 1.53e-12 73 23 5 235 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q7MD16 1.6e-12 73 23 5 235 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q2FWH7 1.68e-12 73 24 7 231 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8DXQ8 1.8e-12 72 25 6 230 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
B1WYT4 2.57e-12 71 24 6 243 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
P40719 2.89e-12 72 27 9 295 1 qseC Sensor protein QseC Escherichia coli (strain K12)
P37894 3.07e-12 72 26 5 233 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P52101 3.29e-12 72 21 5 297 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
Q8Z3P2 5.21e-12 71 27 4 240 3 qseC Sensor protein QseC Salmonella typhi
Q8ZLZ9 5.36e-12 71 27 4 236 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9KHI5 5.87e-12 71 26 5 225 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P0DM80 6.15e-12 70 24 9 294 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP94 6.15e-12 70 24 9 294 2 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA0 6.15e-12 70 24 9 294 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain SL1344)
D0ZV89 6.15e-12 70 24 9 294 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ0 6.15e-12 70 24 9 294 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC4 6.15e-12 70 24 9 294 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella choleraesuis (strain SC-B67)
Q8X524 6.23e-12 70 27 9 295 2 qseC Sensor protein QseC Escherichia coli O157:H7
Q8Z7H3 6.26e-12 70 24 9 294 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhi
P54302 6.82e-12 71 24 7 239 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
P0DMC6 6.86e-12 71 26 9 258 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P45336 7.04e-12 70 27 8 280 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0DMC5 7.11e-12 71 24 5 237 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
Q8GP19 7.41e-12 70 25 8 291 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
Q1RJB3 8.34e-12 70 27 12 300 3 RBE_0470 Putative sensor histidine kinase NtrY-like Rickettsia bellii (strain RML369-C)
Q8XA47 8.37e-12 70 21 5 297 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
P16497 1.21e-11 70 24 6 218 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
Q9RQQ9 1.6e-11 70 27 5 233 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P30844 1.78e-11 68 26 10 258 1 basS Sensor protein BasS Escherichia coli (strain K12)
Q87GU5 1.85e-11 70 24 7 239 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8DKG0 2.14e-11 69 25 4 240 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q56128 2.58e-11 69 24 5 237 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P58662 2.65e-11 69 24 5 237 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O34971 3.05e-11 69 29 9 224 3 kdpD Sensor protein KdpD Rathayibacter rathayi
Q9P896 3.08e-11 69 25 5 226 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P08401 3.14e-11 68 23 7 287 1 creC Sensor protein CreC Escherichia coli (strain K12)
E5KK10 3.53e-11 69 25 7 247 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
P59342 4.54e-11 68 23 13 367 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
Q9XH58 4.96e-11 68 24 6 242 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
P42245 5.03e-11 67 25 7 231 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
T2KMF4 7.83e-11 68 25 6 231 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
Q2JKD9 8.13e-11 67 25 10 250 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
P9WGL3 8.53e-11 68 26 6 244 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL2 1.03e-10 67 26 6 244 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0AEC5 1.06e-10 67 23 13 367 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 1.06e-10 67 23 13 367 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 1.06e-10 67 23 13 367 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
P21865 1.14e-10 67 26 5 220 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
Q2JWK9 1.22e-10 66 24 8 228 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
O81122 1.29e-10 67 26 7 239 2 ETR1 Ethylene receptor Malus domestica
Q1XD95 1.4e-10 67 25 4 220 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
Q55168 1.67e-10 67 25 6 235 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q08430 1.71e-10 66 25 10 239 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
P49333 1.72e-10 67 26 4 233 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
Q7BWI3 4.64e-10 64 24 7 248 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
P33639 4.83e-10 65 27 7 219 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q551X9 5.67e-10 65 28 7 211 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
O34989 6.34e-10 65 20 10 329 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
P45675 6.9e-10 65 23 7 241 3 None Nitrogen regulation protein NtrY homolog Azospirillum brasilense
Q9R6X3 7.88e-10 64 27 8 202 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q54U87 1.07e-09 64 25 7 240 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q3AYV8 1.41e-09 63 23 6 226 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
P58402 1.56e-09 64 24 9 235 3 evgS Sensor protein EvgS Escherichia coli O157:H7
P30855 1.67e-09 63 24 11 252 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
P51392 2.36e-09 63 25 4 220 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
B0JK50 2.39e-09 62 23 7 236 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
P18540 2.54e-09 63 27 7 248 3 virA Wide host range VirA protein Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9ZWL6 3.42e-09 62 24 5 247 2 ETR1 Ethylene receptor Passiflora edulis
Q9M7M1 3.58e-09 62 25 7 231 2 ETR1 Ethylene receptor Prunus persica
P36557 4.19e-09 61 24 10 261 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7U871 4.22e-09 61 24 5 225 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
Q86CZ2 4.33e-09 62 25 7 225 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
O31671 4.51e-09 62 25 8 220 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
O49187 4.73e-09 62 24 6 247 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
O49230 4.81e-09 62 25 5 234 2 ETR1 Ethylene receptor 1 Brassica oleracea
Q9HWR3 5.31e-09 62 24 4 204 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7V113 5.73e-09 61 24 6 210 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q41342 5.74e-09 62 24 7 249 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
O48929 5.78e-09 62 25 5 247 2 ETR1 Ethylene receptor Nicotiana tabacum
O82436 6.1e-09 62 27 7 238 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
Q47745 7.4e-09 61 22 7 283 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
A3PDI2 9.53e-09 60 24 6 212 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
A2BRQ6 1.27e-08 60 24 6 212 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
Q9RZA4 1.54e-08 60 27 6 219 1 bphP Bacteriophytochrome Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q82EB2 1.67e-08 60 30 8 203 3 cseC Sensor protein CseC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P07167 1.75e-08 60 24 6 242 3 virA Limited host range VirA protein Rhizobium radiobacter
A6X5X4 1.93e-08 60 23 4 242 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P41503 2.08e-08 59 26 7 220 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium leguminosarum bv. phaseoli
Q06067 3.28e-08 59 23 9 259 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
Q9HUI3 3.37e-08 59 25 5 212 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8FZ86 3.59e-08 59 23 5 242 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
B0CI82 3.84e-08 59 23 5 242 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRX4 3.98e-08 59 23 5 242 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q9ZEP3 4.18e-08 58 28 8 201 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q57BR6 4.19e-08 59 23 5 242 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 4.19e-08 59 23 5 242 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 4.19e-08 59 23 5 242 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
Q8YIM6 4.23e-08 59 23 5 242 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q9I4F8 4.3e-08 58 25 4 234 3 phoQ Two-component sensor PhoQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A8G5E7 4.67e-08 58 23 6 212 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
Q9XH57 4.91e-08 59 24 6 232 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
P94608 5e-08 59 22 5 263 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A9M715 5.44e-08 59 23 5 242 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q04850 6.82e-08 58 24 7 223 3 ntrY Nitrogen regulation protein NtrY Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q52977 7.02e-08 58 26 9 224 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium meliloti (strain 1021)
P0AFB7 8.04e-08 57 25 7 247 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 8.04e-08 57 25 7 247 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 8.04e-08 57 25 7 247 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
Q8ZPP5 8.93e-08 58 23 10 316 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P58363 1.05e-07 58 25 6 202 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
Q9P7Q7 1.06e-07 58 25 9 221 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0AEC4 1.06e-07 58 25 6 202 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 1.06e-07 58 25 6 202 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
Q31AE8 1.09e-07 57 23 6 212 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
P06218 1.14e-07 57 25 7 247 3 ntrB Sensory histidine kinase/phosphatase NtrB Klebsiella oxytoca
Q06904 2.22e-07 56 23 6 214 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9HU20 2.23e-07 57 26 5 219 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10047 2.46e-07 57 24 10 231 3 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium leguminosarum
P10799 2.51e-07 57 26 7 238 1 virA Wide host range VirA protein Agrobacterium tumefaciens (strain 15955)
P0A2D9 2.52e-07 56 25 7 247 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 2.52e-07 56 25 7 247 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
P13633 2.65e-07 56 24 7 216 1 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium meliloti (strain 1021)
P07168 2.96e-07 56 26 7 238 3 virA Wide host range VirA protein Rhizobium radiobacter
P39928 3.06e-07 57 36 0 73 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q0IBF4 3.61e-07 55 24 7 231 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
P19906 3.65e-07 55 25 8 236 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
B7KFU0 4.93e-07 55 21 6 243 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
Q8DMC5 6.35e-07 55 26 6 203 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q54YZ9 6.8e-07 55 26 8 220 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q9LCC2 6.93e-07 55 27 8 222 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q53RH0 7.13e-07 55 22 5 237 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 7.13e-07 55 22 5 237 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
P73276 8.36e-07 54 25 8 234 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P39764 1.1e-06 54 23 7 246 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
Q8DN03 1.7e-06 53 25 8 208 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 1.7e-06 53 25 8 208 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q54YH4 1.94e-06 54 25 6 219 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q7V6P7 1.99e-06 53 24 9 239 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
Q9RC53 2.2e-06 53 28 2 104 3 citS Sensor protein CitS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P09431 2.33e-06 53 26 8 217 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
O06979 2.72e-06 52 24 5 185 3 yvcQ Sensor histidine kinase YvcQ Bacillus subtilis (strain 168)
Q9KM66 3.41e-06 53 24 8 231 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B8AY75 3.41e-06 53 22 6 237 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
Q0DKM0 4.51e-06 52 22 6 237 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
Q9I4N4 4.59e-06 52 21 5 218 3 fleS Sensor protein kinase FleS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P58356 6.02e-06 52 25 6 228 3 torS Sensor protein TorS Escherichia coli O157:H7
P33113 6.09e-06 52 22 8 273 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
P39453 7.41e-06 52 25 7 229 1 torS Sensor protein TorS Escherichia coli (strain K12)
Q54RP6 7.5e-06 52 24 6 203 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
P42422 7.74e-06 51 23 8 229 3 yxdK Sensor histidine kinase YxdK Bacillus subtilis (strain 168)
Q9KM24 8.07e-06 52 25 9 233 1 vxrA Sensor histidine kinase VxrA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A2C884 8.16e-06 51 22 8 235 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
Q52969 8.54e-06 51 23 5 232 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
Q9HWA7 8.61e-06 52 23 4 223 1 pprA Two-component sensor PprA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5AHA0 1.07e-05 52 24 6 210 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P0C0F6 1.09e-05 51 24 8 232 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P0C0F7 1.14e-05 51 24 8 232 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
Q5A872 1.59e-05 51 35 0 73 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P45670 2.05e-05 50 25 8 220 3 None Sensory histidine kinase/phosphatase NtrB Azospirillum brasilense
Q5A599 2.45e-05 50 23 8 251 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q49VK4 2.94e-05 49 20 7 263 3 graS Sensor histidine kinase GraS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P30663 3.17e-05 50 26 3 119 1 nifL Nitrogen fixation regulatory protein Azotobacter vinelandii
Q4L482 3.2e-05 49 21 7 257 3 graS Sensor histidine kinase GraS Staphylococcus haemolyticus (strain JCSC1435)
O24972 3.98e-05 49 21 9 246 1 arsS Sensor histidine kinase ArsS Helicobacter pylori (strain ATCC 700392 / 26695)
P74111 4.31e-05 49 23 5 228 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9SXL4 4.83e-05 49 38 0 54 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q8ZPP6 6.15e-05 49 23 7 232 1 ttrS Tetrathionate sensor histidine kinase TtrS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O22267 0.000114 48 26 2 102 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
O14002 0.000118 48 22 6 206 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O35044 0.000156 47 22 10 289 1 bceS Sensor protein BceS Bacillus subtilis (strain 168)
Q95PI2 0.000219 47 26 9 209 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q7D9K1 0.000233 47 28 6 214 3 MT0630 Probable sensor histidine kinase HK Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O87939 0.000406 46 24 3 150 3 tdiS Sensor protein TdiS Thauera aromatica
P26762 0.000411 46 24 9 229 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P0DOA0 0.000411 46 37 1 70 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
P40330 0.000509 46 24 9 227 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P42707 0.000652 45 22 10 313 3 nisK Nisin biosynthesis sensor protein NisK Lactococcus lactis subsp. lactis
P54444 0.000723 45 20 4 191 3 yrkQ Sensor histidine kinase YrkQ Bacillus subtilis (strain 168)
Q3S4A7 0.001 45 24 11 250 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
A1A698 0.001 45 28 1 85 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS15815
Feature type CDS
Gene cpxA
Product envelope stress sensor histidine kinase CpxA
Location 3512374 - 3513741 (strand: -1)
Length 1368 (nucleotides) / 455 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1812
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF00672 HAMP domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase
PF16527 Two-component sensor protein CpxA, periplasmic domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG5002 Signal transduction mechanisms (T) T Sensor histidine kinase WalK

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07640 two-component system, OmpR family, sensor histidine kinase CpxA [EC:2.7.13.3] Cationic antimicrobial peptide (CAMP) resistance
Two-component system
-

Protein Sequence

MINSLSARIFAIFWLTLALVLVLVMMVPKLDSRQLTTLLESEYRQGVMLEQHIEAELAQDPANDLLWWRRLIRAIDKWAPPGQRLIIVTSEGRIIGAQRNEIQVVRNFMGQSDNADHPKKKKYGRSEMLGPFSIRDGEDHYQLYLVRPSSSPQSDFINLLFDKPLLLLIFTMLISTPLLVWLSWSLAKPARKLKNAADDVAKGNLRPHPELETGPQEFLAAGTSFNQMISALERMVEAQQRLISDISHELRTPLTRLQLASALLRRRSGESKELERIETETQRLDGMINDLLVLSRNQYKNELLRETVKANELWNDILDNAKFEAEQSNKTLTVTAPPGPWTIYCNPYSLASAFENIVRNALRYSHSRIEVAFTEQNQGITIIVDDDGPGVSPEDREHIFRPFYRTDEARDRESGGTGLGLAIVETAISQHRGHVKADDSPLGGLRVEIWLPKTK

Flanking regions ( +/- flanking 50bp)

TACGTGGCCGTGGTTATCTTATGGTTTCAATAACTTAATAAAAAATCTTTATGATAAACAGTTTGTCAGCGCGTATATTCGCCATATTCTGGCTGACACTAGCATTAGTTCTAGTGCTAGTTATGATGGTACCCAAGCTGGACTCGCGCCAGCTTACCACTTTACTTGAAAGTGAATACCGTCAAGGTGTTATGCTAGAGCAACATATAGAAGCCGAACTAGCGCAAGATCCGGCTAACGATCTGCTATGGTGGCGGCGATTAATCCGCGCCATTGATAAATGGGCGCCACCTGGTCAACGTCTTATTATTGTCACCAGTGAAGGTCGTATTATTGGTGCTCAACGTAATGAAATACAAGTTGTCAGAAACTTTATGGGACAGTCTGATAATGCAGACCATCCAAAAAAGAAAAAATACGGTCGCTCTGAGATGTTAGGCCCCTTTTCCATTAGAGATGGTGAAGATCACTACCAACTTTACTTAGTGCGCCCATCAAGTAGCCCGCAATCTGATTTTATCAATTTATTATTTGATAAACCGCTTTTATTACTGATATTCACCATGCTTATCAGTACACCGCTACTGGTTTGGCTCTCTTGGAGCTTGGCAAAACCGGCCCGAAAACTCAAAAATGCGGCGGATGATGTGGCAAAAGGTAATCTGCGCCCTCACCCTGAACTGGAAACCGGCCCGCAAGAATTTTTAGCGGCAGGCACCAGTTTTAATCAGATGATCAGCGCCTTAGAGCGTATGGTTGAAGCGCAACAGCGATTGATTTCTGATATCTCCCATGAGTTGCGCACCCCGTTAACTCGTTTACAGCTTGCCAGTGCATTACTACGTCGTCGTAGCGGTGAAAGTAAAGAGCTAGAGCGTATTGAAACAGAAACACAGCGGCTAGATGGCATGATCAATGACTTATTAGTGCTTTCCCGCAATCAGTATAAAAATGAGTTATTACGTGAAACCGTAAAAGCGAATGAGCTTTGGAACGATATTTTAGATAATGCGAAATTTGAGGCAGAACAAAGCAATAAAACCCTAACAGTAACCGCCCCGCCAGGCCCATGGACGATTTATTGCAATCCTTATTCATTAGCGAGTGCCTTTGAAAATATCGTTCGCAATGCCTTGCGTTATTCACATTCTCGTATTGAAGTGGCTTTTACCGAACAAAATCAGGGTATCACTATTATTGTTGATGATGATGGCCCAGGGGTTAGCCCAGAAGATCGCGAGCATATTTTCCGACCTTTTTATCGTACGGACGAAGCACGTGATAGAGAATCCGGCGGTACAGGACTAGGACTGGCAATTGTTGAAACCGCAATTAGTCAACATCGAGGCCATGTTAAAGCTGACGATAGCCCATTAGGGGGGTTAAGAGTGGAGATTTGGTTGCCGAAAACAAAATAAACATAAGCTATCTAAAAGCCGCCTTTAGATTTAAAATACAAAAATACTAA