Homologs in group_1773

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12335 FBDBKF_12335 100.0 Morganella morganii S1 cpxA envelope stress sensor histidine kinase CpxA
EHELCC_13970 EHELCC_13970 100.0 Morganella morganii S2 cpxA envelope stress sensor histidine kinase CpxA
NLDBIP_15065 NLDBIP_15065 100.0 Morganella morganii S4 cpxA envelope stress sensor histidine kinase CpxA
LHKJJB_15545 LHKJJB_15545 100.0 Morganella morganii S3 cpxA envelope stress sensor histidine kinase CpxA
F4V73_RS17165 F4V73_RS17165 98.2 Morganella psychrotolerans cpxA envelope stress sensor histidine kinase CpxA
PMI_RS15815 PMI_RS15815 80.9 Proteus mirabilis HI4320 cpxA envelope stress sensor histidine kinase CpxA

Distribution of the homologs in the orthogroup group_1773

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1773

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AE82 0.0 654 74 0 456 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 0.0 654 74 0 456 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 0.0 654 74 0 456 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
A0A0H3GPN8 0.0 649 74 0 452 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
A0A4P7TSF2 6.94e-35 138 32 5 266 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 6.94e-35 138 32 5 266 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 6.94e-35 138 32 5 266 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
P18392 3.17e-34 136 31 6 303 1 rstB Sensor protein RstB Escherichia coli (strain K12)
P08982 1.75e-33 134 31 5 266 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 1.75e-33 134 31 5 266 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
P41406 2.09e-33 134 31 5 266 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
P30847 4.2e-27 116 30 6 276 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
O69729 1.84e-26 114 29 10 320 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0QR01 8.81e-26 111 31 5 229 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q93CB7 2.59e-25 112 27 8 336 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q742C0 3.35e-25 111 30 9 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q9CCJ1 4.3e-25 111 28 7 334 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
P23545 4.46e-25 111 35 5 220 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
P77485 5e-25 110 27 8 331 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
Q8FK37 6.52e-25 110 27 8 331 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XBY4 6.68e-25 110 27 8 331 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
Q4L6C5 9.4e-25 109 27 7 296 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
A0QBR0 1.21e-24 110 30 9 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
A0QTK3 1.59e-24 109 29 7 289 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P45608 3.17e-24 107 29 4 230 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
P9WGK8 4.23e-24 108 27 7 328 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 4.23e-24 108 27 7 328 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P08400 4.51e-24 107 29 5 232 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
P9WGK9 6.77e-24 107 26 7 328 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK5 7.41e-24 106 32 5 232 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 7.41e-24 106 32 5 232 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 7.41e-24 106 32 5 232 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q45614 7.61e-24 108 31 4 234 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
A1TEL6 1.03e-23 107 29 9 286 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P45609 1.68e-23 105 28 5 232 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
Q9ZHD4 2.13e-23 105 27 6 299 3 silS Probable sensor kinase SilS Salmonella typhimurium
Q49XM6 2.64e-23 105 28 5 272 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8CU87 3.32e-23 106 30 4 223 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 3.32e-23 106 30 4 223 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CRA8 5.12e-23 104 30 9 261 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7A0W5 7.18e-23 103 26 9 356 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 7.18e-23 103 26 9 356 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 7.18e-23 103 26 9 356 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 7.18e-23 103 26 9 356 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 7.18e-23 103 26 9 356 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 7.18e-23 103 26 9 356 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 7.18e-23 103 26 9 356 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
A0PWB3 7.75e-23 104 30 8 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
P54883 1.39e-22 103 32 5 232 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
Q49ZT9 1.47e-22 103 26 6 280 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q6GGZ4 1.57e-22 103 26 7 310 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
Q2YY04 1.66e-22 103 26 7 310 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q4A159 1.76e-22 103 30 5 226 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5HLN1 1.98e-22 102 30 9 261 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P35164 2.6e-22 103 29 3 227 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
O34638 4.42e-22 101 26 6 307 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
P71380 4.56e-22 101 26 3 230 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4LAJ8 4.73e-22 102 30 5 228 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
Q9HZ47 7.54e-22 101 31 10 271 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9Z5G7 7.92e-22 101 29 9 286 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
Q9RDT3 9.9e-22 100 29 3 225 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q47457 1.13e-21 100 29 9 277 3 pcoS Probable sensor protein PcoS Escherichia coli
Q6GKS6 1.96e-21 100 29 4 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
Q7A215 2.12e-21 100 29 4 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 2.12e-21 100 29 4 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 2.12e-21 100 29 4 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 2.12e-21 100 29 4 226 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 2.12e-21 100 29 4 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 2.12e-21 100 29 4 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 2.12e-21 100 29 4 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 2.12e-21 100 29 4 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 2.12e-21 100 29 4 226 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 2.12e-21 100 29 4 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 2.12e-21 100 29 4 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 2.12e-21 100 29 4 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
A6QD58 2.28e-21 100 29 4 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q4L8M0 3.18e-21 99 26 8 298 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
A1KHB8 3.19e-21 99 30 9 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 3.19e-21 99 30 9 271 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0R3I7 3.39e-21 99 29 8 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A5A2P0 4.8e-21 98 29 5 232 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
Q55932 5.28e-21 98 32 5 219 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8CSL7 6.89e-21 98 27 11 305 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPC4 1.14e-20 97 27 11 305 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P9WGL1 6.73e-20 95 29 9 271 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 6.73e-20 95 29 9 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 6.73e-20 95 29 9 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A3Q5L8 7.51e-20 95 28 8 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
Q1B3X9 7.86e-20 95 28 8 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 7.86e-20 95 28 8 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
I1WSZ3 1.22e-19 94 30 10 293 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
Q04804 2.87e-19 93 30 13 288 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0DMK6 4.09e-19 93 30 10 293 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
A8Z553 4.64e-19 92 24 8 301 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 4.64e-19 92 24 8 301 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 4.64e-19 92 24 8 301 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 4.64e-19 92 24 8 301 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 4.64e-19 92 24 8 301 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
P9WGK7 5.78e-19 92 26 8 304 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 5.78e-19 92 26 8 304 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 5.78e-19 92 26 8 304 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P37461 1e-18 91 28 7 242 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O34206 1.23e-18 92 32 8 219 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
B2J946 1.64e-18 90 23 8 318 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q8Z332 1.72e-18 91 28 7 242 3 zraS Sensor histidine kinase ZraS Salmonella typhi
Q8X614 1.95e-18 90 30 7 228 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
Q7A3X0 2.51e-18 90 24 7 297 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 2.51e-18 90 24 7 297 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 2.51e-18 90 24 7 297 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 2.51e-18 90 24 7 297 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 2.51e-18 90 24 7 297 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NV46 3.15e-18 90 24 8 301 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 3.15e-18 90 24 8 301 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
P94414 5.01e-18 89 27 10 307 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
Q54SP4 5.08e-18 90 28 6 264 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
P0A4I8 6.53e-18 89 27 5 280 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 6.53e-18 89 27 5 280 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P72292 7e-18 89 26 9 313 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
Q03228 8.64e-18 89 30 6 232 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q2YZ23 9.36e-18 89 24 7 297 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GIT7 1.07e-17 87 23 3 282 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q7A1J2 1.16e-17 87 23 3 282 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 1.16e-17 87 23 3 282 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 1.16e-17 87 23 3 282 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 1.16e-17 87 23 3 282 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 1.16e-17 87 23 3 282 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q02541 1.32e-17 88 26 8 277 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
Q840P7 1.33e-17 87 23 3 282 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
P14377 1.61e-17 88 29 7 228 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
Q5HHW5 1.67e-17 87 23 3 282 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 1.67e-17 87 23 3 282 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 1.67e-17 87 23 3 282 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
Q6GE72 1.89e-17 87 24 7 291 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
O33071 2.77e-17 87 26 8 301 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
Q8DPL8 6.5e-17 86 31 6 221 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 6.5e-17 86 31 6 221 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q9APE0 7.84e-17 85 29 7 220 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
Q8X739 1.02e-16 85 26 7 286 3 phoQ Sensor protein PhoQ Escherichia coli O157:H7
Q9F8D7 1.58e-16 85 26 11 346 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q8YR50 1.7e-16 84 23 10 321 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q44007 2.37e-16 84 26 8 332 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q70FG9 2.44e-16 83 25 9 287 3 pmrB Sensor histidine kinase PmrB Pectobacterium parmentieri
P36557 2.71e-16 83 26 10 306 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8DMT2 3.12e-16 83 26 7 240 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q04943 3.41e-16 84 28 9 290 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q3M8A7 3.87e-16 83 23 9 320 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P23837 8.86e-16 82 26 7 286 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
Q83RR1 9.02e-16 82 26 7 286 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
Q8FIB8 1.04e-15 82 26 7 286 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q07737 1.33e-15 82 26 9 309 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
P44578 1.75e-15 80 26 8 268 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5W4E3 2.31e-15 82 26 6 241 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 3.6e-06 53 31 3 105 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P0DM80 2.66e-15 81 25 6 288 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP94 2.66e-15 81 25 6 288 2 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA0 2.66e-15 81 25 6 288 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain SL1344)
D0ZV89 2.66e-15 81 25 6 288 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ0 2.66e-15 81 25 6 288 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC4 2.66e-15 81 25 6 288 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella choleraesuis (strain SC-B67)
Q8Z7H3 2.86e-15 81 25 6 288 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhi
O32193 3.32e-15 80 20 7 306 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
P42245 3.43e-15 79 26 7 234 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
P30844 3.46e-15 80 27 7 233 1 basS Sensor protein BasS Escherichia coli (strain K12)
Q44930 4.9e-15 79 26 8 260 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
P08401 5e-15 80 25 8 296 1 creC Sensor protein CreC Escherichia coli (strain K12)
P20169 5.46e-15 80 29 7 217 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
E0X9C7 6.12e-15 81 27 7 241 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 3.6e-06 53 31 3 105 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
P76339 6.26e-15 80 24 8 287 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
A7HD43 6.6e-15 79 29 6 227 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
Q06240 8.18e-15 79 25 9 296 1 vanS Sensor protein VanS Enterococcus faecium
P0A4I6 9.09e-15 79 28 6 232 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 9.09e-15 79 28 6 232 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P39664 1.47e-14 79 31 7 235 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q7A5H7 1.47e-14 79 25 5 228 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 1.47e-14 79 25 5 228 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8NWF3 1.87e-14 79 25 5 228 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q9L523 1.87e-14 79 25 5 228 1 srrB Sensor protein SrrB Staphylococcus aureus
Q6G973 1.87e-14 79 25 5 228 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q6GGK7 1.87e-14 79 25 5 228 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q5HFT1 1.87e-14 79 25 5 228 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 1.87e-14 79 25 5 228 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q08408 3.37e-14 78 25 6 236 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
P48027 4.15e-14 78 29 7 228 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
P45336 5.21e-14 77 25 8 329 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8KIY1 7.79e-14 77 25 6 240 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 3.02e-06 53 31 6 122 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
P0DMC5 1.1e-13 77 26 8 260 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
Q4UMD4 1.42e-13 76 28 14 294 3 RF_0427 Putative sensor histidine kinase NtrY-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P0DMC6 1.48e-13 76 26 8 260 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P52101 1.61e-13 75 22 4 289 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
Q9I0I2 1.98e-13 75 23 7 257 3 carS Sensor protein kinase CarS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q92H24 2.17e-13 75 27 13 295 3 RC0948 Putative sensor histidine kinase NtrY-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q8E3C7 2.31e-13 75 26 7 232 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
Q8XA47 2.65e-13 75 22 4 289 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
Q8CTI3 3.17e-13 74 23 8 296 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 3.17e-13 74 23 8 296 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P21865 3.19e-13 75 28 7 242 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
Q2T0V9 4.26e-13 75 23 4 230 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
O31661 4.34e-13 75 27 8 219 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
P58662 4.9e-13 75 24 4 237 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q56128 5.26e-13 75 24 4 237 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q8DXQ8 5.4e-13 73 26 7 232 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8Z3P2 6.9e-13 73 28 4 236 3 qseC Sensor protein QseC Salmonella typhi
Q8ZLZ9 7.55e-13 73 28 4 236 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P40719 8.63e-13 73 28 7 245 1 qseC Sensor protein QseC Escherichia coli (strain K12)
P23621 9.84e-13 73 26 4 224 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P96368 1.07e-12 73 26 10 317 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P37894 1.35e-12 73 24 5 238 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8X524 1.42e-12 72 28 7 245 2 qseC Sensor protein QseC Escherichia coli O157:H7
Q9HV31 1.85e-12 72 29 7 209 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2FWH7 2e-12 73 26 9 236 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
P51392 2.23e-12 72 26 4 218 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
Q8D5Z6 2.41e-12 72 23 5 233 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q7MD16 2.56e-12 72 23 5 233 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
B7K3M6 3.1e-12 71 25 5 235 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
O34989 4.58e-12 71 22 9 314 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
Q55630 5.02e-12 70 21 5 237 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9ZCU7 5.87e-12 71 25 13 299 3 RP614 Putative sensor histidine kinase NtrY-like Rickettsia prowazekii (strain Madrid E)
P59342 6.81e-12 71 23 10 334 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P0AEC5 7.37e-12 71 23 11 334 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 7.37e-12 71 23 11 334 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 7.37e-12 71 23 11 334 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
T2KMF4 9.94e-12 71 27 6 233 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
P45675 1.18e-11 70 26 3 156 3 None Nitrogen regulation protein NtrY homolog Azospirillum brasilense
Q1XD95 1.81e-11 70 25 3 219 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
Q9KLK7 2.36e-11 69 25 5 233 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P33639 3.89e-11 68 27 8 232 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1RJB3 3.99e-11 68 27 11 290 3 RBE_0470 Putative sensor histidine kinase NtrY-like Rickettsia bellii (strain RML369-C)
P54302 4e-11 68 22 4 236 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
O31671 5.9e-11 68 26 8 239 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
Q8DKG0 8.01e-11 68 26 7 242 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9R6X3 8.21e-11 67 27 8 202 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O34971 9.58e-11 67 28 10 227 3 kdpD Sensor protein KdpD Rathayibacter rathayi
Q869S5 1.05e-10 67 25 8 233 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q9P896 1.3e-10 67 24 4 226 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q2JWK9 1.44e-10 66 21 5 242 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
B0JK50 1.49e-10 66 24 8 230 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q87GU5 1.76e-10 67 22 4 236 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8GP19 2.33e-10 66 25 9 270 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
Q2JKD9 2.75e-10 65 23 10 251 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
Q7BWI3 3.59e-10 65 25 6 226 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q3AYV8 4.11e-10 65 23 5 225 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
P49333 4.41e-10 65 26 6 235 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
B1WYT4 4.81e-10 64 21 6 244 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
P16497 4.83e-10 65 23 6 217 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
Q9KHI5 5.13e-10 65 25 5 224 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q55168 6.41e-10 65 24 6 236 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P73276 6.75e-10 64 26 5 234 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
E5KK10 7.38e-10 65 24 6 229 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
P9WGL3 8.61e-10 64 24 9 296 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL2 8.61e-10 64 24 9 296 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7U871 8.95e-10 63 24 5 224 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
Q86CZ2 1.42e-09 64 26 9 238 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q9RQQ9 1.7e-09 63 27 5 230 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9XH58 2.23e-09 63 23 5 229 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
Q52977 2.58e-09 62 28 8 217 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium meliloti (strain 1021)
Q54YZ9 2.62e-09 63 25 12 289 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
A2C884 2.69e-09 62 24 7 237 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
Q82EB2 3.37e-09 62 28 11 245 3 cseC Sensor protein CseC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P58363 3.65e-09 62 25 7 219 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P0AEC4 3.68e-09 62 25 7 219 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 3.68e-09 62 25 7 219 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
Q9I4F8 4.05e-09 62 24 4 262 3 phoQ Two-component sensor PhoQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q54U87 4.1e-09 62 24 6 242 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q06067 4.18e-09 62 24 9 262 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
P19906 4.43e-09 61 25 7 234 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
P06218 4.7e-09 61 25 7 245 3 ntrB Sensory histidine kinase/phosphatase NtrB Klebsiella oxytoca
Q9P7Q7 5.03e-09 62 23 7 234 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P30855 5.44e-09 62 24 11 253 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q9RZA4 6.4e-09 62 26 6 219 1 bphP Bacteriophytochrome Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P58402 6.47e-09 62 24 10 236 3 evgS Sensor protein EvgS Escherichia coli O157:H7
Q04850 6.81e-09 62 25 10 264 3 ntrY Nitrogen regulation protein NtrY Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q551X9 7.17e-09 62 26 7 222 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
B7KFU0 7.77e-09 60 19 9 345 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
Q06904 1.01e-08 60 22 7 234 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9HUI3 1.12e-08 61 26 5 210 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P58356 1.19e-08 61 25 8 235 3 torS Sensor protein TorS Escherichia coli O157:H7
Q47745 1.24e-08 60 22 9 316 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
Q7V113 1.36e-08 60 25 6 212 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q08430 1.6e-08 60 23 9 238 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
P39453 1.78e-08 60 25 7 234 1 torS Sensor protein TorS Escherichia coli (strain K12)
Q7V6P7 1.99e-08 59 23 7 237 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
P13633 2.06e-08 60 24 4 223 1 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium meliloti (strain 1021)
P0A2D9 2.18e-08 59 25 7 245 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 2.18e-08 59 25 7 245 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
O49230 2.22e-08 60 25 5 228 2 ETR1 Ethylene receptor 1 Brassica oleracea
P10047 2.46e-08 60 25 9 262 3 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium leguminosarum
P0AFB7 2.8e-08 58 25 7 245 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 2.8e-08 58 25 7 245 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 2.8e-08 58 25 7 245 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
Q95PI2 3.07e-08 60 25 11 246 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q9KM66 3.83e-08 59 25 7 226 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P94608 4.29e-08 59 22 4 223 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9M7M1 4.75e-08 59 23 6 229 2 ETR1 Ethylene receptor Prunus persica
P39764 5.06e-08 58 26 10 246 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
O81122 5.06e-08 58 23 6 237 2 ETR1 Ethylene receptor Malus domestica
Q8ZPP5 5.76e-08 58 22 7 344 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q31AE8 6.57e-08 58 24 7 214 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
A3PDI2 7e-08 57 23 6 213 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
A2BRQ6 7.06e-08 57 23 6 213 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
Q8DMC5 9.8e-08 57 26 5 201 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P0C0F7 1.04e-07 58 25 9 250 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
Q9LCC2 1.08e-07 58 26 9 230 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O49187 1.09e-07 58 23 4 229 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
P0C0F6 1.1e-07 58 25 9 250 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P33113 1.16e-07 57 22 8 296 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
P18540 1.21e-07 58 26 6 240 3 virA Wide host range VirA protein Agrobacterium fabrum (strain C58 / ATCC 33970)
P09431 1.66e-07 56 28 11 236 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P39928 1.93e-07 57 37 0 75 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q52969 2.01e-07 57 24 6 229 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
O06979 2.9e-07 55 23 7 236 3 yvcQ Sensor histidine kinase YvcQ Bacillus subtilis (strain 168)
Q0IBF4 2.98e-07 56 23 8 238 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
Q9I4N4 3.01e-07 56 22 6 231 3 fleS Sensor protein kinase FleS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q54YH4 3.47e-07 56 24 5 205 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q6GJ10 4.09e-07 55 19 11 315 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MRSA252)
Q9ZEP3 4.25e-07 55 28 11 245 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P41503 4.25e-07 55 25 7 217 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium leguminosarum bv. phaseoli
Q03069 4.75e-07 55 24 6 217 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
O48929 4.77e-07 55 24 6 237 2 ETR1 Ethylene receptor Nicotiana tabacum
A8G5E7 4.82e-07 55 22 6 213 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
O82436 5.58e-07 55 23 6 238 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
Q53RH0 8.9e-07 55 22 5 229 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 8.9e-07 55 22 5 229 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
Q41342 1.12e-06 54 23 7 238 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
Q5AHA0 1.16e-06 55 24 7 214 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9HWR3 1.38e-06 54 24 6 205 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8DN03 1.47e-06 53 25 7 206 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 1.47e-06 53 25 7 206 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q5A872 1.58e-06 54 37 0 74 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9ZWL6 1.85e-06 54 22 5 238 2 ETR1 Ethylene receptor Passiflora edulis
Q9HU20 1.98e-06 53 25 5 212 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O87939 2.1e-06 53 22 6 239 3 tdiS Sensor protein TdiS Thauera aromatica
Q9XH57 2.49e-06 53 23 6 229 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
P16575 3.13e-06 53 24 8 230 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q54RP6 3.88e-06 53 24 8 220 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q0DKM0 4.15e-06 52 21 7 229 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
B8AY75 4.37e-06 52 21 7 229 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
P45670 4.51e-06 52 26 9 219 3 None Sensory histidine kinase/phosphatase NtrB Azospirillum brasilense
Q9HWA7 4.67e-06 52 23 5 229 1 pprA Two-component sensor PprA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P07167 7.64e-06 52 24 6 231 3 virA Limited host range VirA protein Rhizobium radiobacter
Q9RC53 7.89e-06 52 28 2 105 3 citS Sensor protein CitS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P39215 9e-06 52 22 4 162 1 mcpB Methyl-accepting chemotaxis protein McpB Bacillus subtilis (strain 168)
O24972 9.06e-06 51 22 12 253 1 arsS Sensor histidine kinase ArsS Helicobacter pylori (strain ATCC 700392 / 26695)
P26762 9.7e-06 52 23 8 230 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P40330 1.05e-05 52 23 8 230 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P54444 1.05e-05 51 20 6 272 3 yrkQ Sensor histidine kinase YrkQ Bacillus subtilis (strain 168)
O14002 1.23e-05 51 22 6 217 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5A599 1.51e-05 51 23 11 294 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P10955 1.6e-05 50 25 3 123 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
P0DOA0 3.35e-05 50 24 8 251 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
P10799 4.27e-05 49 40 2 69 1 virA Wide host range VirA protein Agrobacterium tumefaciens (strain 15955)
P07168 4.34e-05 49 40 2 69 3 virA Wide host range VirA protein Rhizobium radiobacter
A5VRX4 4.54e-05 49 21 6 239 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8FZ86 5.59e-05 49 21 5 239 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
Q57BR6 5.84e-05 49 21 5 239 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 5.84e-05 49 21 5 239 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 5.84e-05 49 21 5 239 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
B0CI82 6.15e-05 49 21 5 239 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
Q8YIM6 6.2e-05 49 21 5 239 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M715 7.43e-05 49 21 5 239 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9SXL4 8.41e-05 48 20 7 254 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
A7N6S2 9.14e-05 48 32 2 83 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
Q49VK4 9.35e-05 48 19 10 258 3 graS Sensor histidine kinase GraS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9KM24 0.000148 47 22 8 234 1 vxrA Sensor histidine kinase VxrA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A6X5X4 0.000157 48 22 5 241 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P30663 0.000249 47 24 3 120 1 nifL Nitrogen fixation regulatory protein Azotobacter vinelandii
P28788 0.000254 46 24 8 228 3 ntrB Sensory histidine kinase/phosphatase NtrB Proteus hauseri
Q4L482 0.000492 45 21 8 240 3 graS Sensor histidine kinase GraS Staphylococcus haemolyticus (strain JCSC1435)
A1A699 0.000524 46 28 0 70 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
A1A698 0.000566 46 27 0 83 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
Q9P4U6 0.000715 45 34 0 70 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O34427 0.000733 45 25 6 171 1 citS Sensor protein CitS Bacillus subtilis (strain 168)
O22267 0.000741 45 25 2 102 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
Q9C5U1 0.000782 45 20 7 265 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
A1A697 0.000896 45 31 0 60 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
Q8ZPP6 0.001 45 23 7 232 1 ttrS Tetrathionate sensor histidine kinase TtrS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_14665
Feature type CDS
Gene cpxA
Product envelope stress sensor histidine kinase CpxA
Location 116808 - 118178 (strand: 1)
Length 1371 (nucleotides) / 456 (amino acids)

Contig

Accession ZDB_693
Length 123756 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1773
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF00672 HAMP domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase
PF16527 Two-component sensor protein CpxA, periplasmic domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG5002 Signal transduction mechanisms (T) T Sensor histidine kinase WalK

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07640 two-component system, OmpR family, sensor histidine kinase CpxA [EC:2.7.13.3] Cationic antimicrobial peptide (CAMP) resistance
Two-component system
-

Protein Sequence

MISSLTARIFAIFWFTLALVLLLVLMVPKLDSRQLMPLQEAEYRQGMMLQQHIESDLAQDPANDLLWWRRLTRALVKWTPPDKRLIIVTTEGRIIGPIRNDSQVIRNFMGQSDNTDNPKKKRYGRIELLGPFEVRDGEDRYQLYLIRPANTAQSDFINFLIDRPFLLLAATMLISTPLLLWLAWSLAKPARKLKNAADDVAKGNLRQHPELEAGPQEFLAAGNSFNQMISALERMVNAQQRLISDISHELRTPLTRLQLATALLRRRHGESKELERIETETHRLDGMINDLLVLSRSQHKNELLRQNIKANELWDDILDNAKFEAEQRHKTLEITSPPGPWTIYCNPSALGSAFENIVRNALRYSNQHIQVAFSADTKGISIVVDDDGPGVSPEDREHIFRPFYRTDEARDRESGGTGLGLAIVSTAISQHNGKVTANDSPLGGLRLEIWLPLHPR

Flanking regions ( +/- flanking 50bp)

CCGTGGTTTAAAACGTTACGCGGCCGTGGTTACTTAATGGTATCTGCAACATGATAAGCAGCCTGACGGCGCGGATTTTCGCCATCTTCTGGTTTACCCTGGCGCTGGTGCTGTTACTGGTGCTGATGGTGCCGAAGCTCGACTCCCGGCAGCTGATGCCGCTCCAGGAGGCTGAGTACCGGCAGGGTATGATGCTGCAGCAACATATTGAATCTGATCTCGCACAGGATCCGGCGAATGACCTGCTCTGGTGGCGGCGGCTGACCCGCGCCCTGGTAAAATGGACGCCGCCGGACAAGCGCCTGATTATTGTCACCACTGAAGGCCGGATCATCGGGCCTATCCGCAATGATTCCCAGGTCATCCGTAACTTTATGGGTCAGTCAGATAACACTGACAACCCGAAAAAGAAACGTTACGGCCGCATTGAGCTGCTCGGGCCGTTTGAAGTCAGGGACGGCGAAGACCGCTATCAGCTTTATCTTATCCGCCCGGCGAACACCGCACAGTCTGATTTTATCAACTTCCTGATTGACCGCCCGTTCCTGTTACTGGCCGCCACCATGCTGATCAGCACCCCGTTGCTGCTCTGGCTGGCGTGGAGCCTGGCAAAACCGGCACGAAAACTGAAAAACGCGGCGGATGATGTGGCCAAAGGTAATTTGCGCCAGCATCCGGAACTGGAAGCCGGCCCGCAGGAATTCCTTGCGGCGGGTAACAGCTTTAACCAGATGATCAGTGCCCTCGAACGCATGGTGAACGCACAACAGCGGCTGATATCCGATATCTCCCACGAACTGCGCACCCCGCTCACCCGGCTCCAGCTGGCTACGGCACTATTGCGCCGCCGCCACGGTGAAAGTAAAGAGCTGGAACGCATCGAGACAGAGACCCACCGCCTCGACGGCATGATCAATGATCTGCTTGTTCTCTCCCGCAGCCAGCACAAAAATGAGCTGCTGCGCCAGAACATCAAGGCCAATGAGCTGTGGGATGACATTCTCGACAATGCGAAGTTTGAGGCAGAGCAGCGCCATAAAACGCTGGAAATCACCTCACCGCCGGGCCCGTGGACAATTTACTGCAACCCGTCCGCACTCGGCAGCGCATTTGAGAATATTGTCCGCAACGCGCTGCGCTACTCAAATCAGCATATTCAGGTCGCATTCAGTGCTGACACCAAAGGTATCAGCATTGTGGTGGATGACGATGGCCCGGGTGTCAGCCCGGAAGATCGCGAACATATCTTCCGTCCGTTCTACCGCACGGATGAAGCCCGCGACCGCGAATCCGGTGGTACCGGCCTGGGACTCGCGATTGTCAGCACCGCTATCAGCCAGCACAACGGTAAAGTCACCGCCAACGACAGCCCGCTCGGCGGACTTCGCCTGGAAATCTGGCTACCGCTGCACCCGCGCTGAGGCTCTCTGTAGTTACCGGGGCAATCAGCCCCGGTAACTATTCCTTCTTA