Homologs in group_456

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04605 FBDBKF_04605 28.9 Morganella morganii S1 emrA Multidrug resistance efflux pump EmrA
EHELCC_05895 EHELCC_05895 28.9 Morganella morganii S2 emrA Multidrug resistance efflux pump EmrA
NLDBIP_06215 NLDBIP_06215 28.9 Morganella morganii S4 emrA Multidrug resistance efflux pump EmrA
LHKJJB_03095 LHKJJB_03095 28.9 Morganella morganii S3 emrA Multidrug resistance efflux pump EmrA
HKOGLL_06570 HKOGLL_06570 28.9 Morganella morganii S5 emrA Multidrug resistance efflux pump EmrA
F4V73_RS09055 F4V73_RS09055 29.8 Morganella psychrotolerans - EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit

Distribution of the homologs in the orthogroup group_456

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_456

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0DPR6 4.59e-37 140 31 8 321 2 emrA Colistin resistance protein EmrA Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q9RQ30 9.16e-30 121 27 5 320 1 farA Fatty acid resistance protein FarA Neisseria gonorrhoeae
P44928 2.59e-25 108 25 5 310 3 emrA Multidrug export protein EmrA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P52599 2.98e-25 108 26 8 362 2 emrK Probable multidrug resistance protein EmrK Escherichia coli (strain K12)
P27303 2.41e-24 106 27 8 332 1 emrA Multidrug export protein EmrA Escherichia coli (strain K12)
Q8X5R2 2e-16 82 24 9 315 3 mdtN Multidrug resistance protein MdtN Escherichia coli O157:H7
P32716 5.02e-16 81 24 9 315 2 mdtN Multidrug resistance protein MdtN Escherichia coli (strain K12)
Q8FAX1 1.13e-15 80 26 12 325 3 mdtN Multidrug resistance protein MdtN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q83P86 1.37e-15 80 24 9 315 3 mdtN Multidrug resistance protein MdtN Shigella flexneri
B5XSP8 2.16e-12 70 25 11 329 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Klebsiella pneumoniae (strain 342)
A8A550 2.68e-12 70 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O9:H4 (strain HS)
B7NDL9 3.35e-12 70 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q32B98 4.08e-12 69 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Shigella dysenteriae serotype 1 (strain Sd197)
Q1R698 4.08e-12 69 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain UTI89 / UPEC)
B1LGK7 4.08e-12 69 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain SMS-3-5 / SECEC)
B6I1V9 4.08e-12 69 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain SE11)
B1IQN8 4.08e-12 69 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8FD50 4.08e-12 69 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCM4 4.08e-12 69 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGD4 4.08e-12 69 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O1:K1 / APEC
B7N0M6 4.08e-12 69 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O81 (strain ED1a)
B7MC02 4.08e-12 69 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UJX3 4.08e-12 69 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7M0V3 4.39e-12 69 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O8 (strain IAI1)
O31593 4.47e-12 68 35 1 127 3 yhbJ Putative efflux system component YhbJ Bacillus subtilis (strain 168)
Q0T047 7.34e-12 68 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Shigella flexneri serotype 5b (strain 8401)
P46482 7.34e-12 68 24 11 324 2 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain K12)
B1XHL3 7.34e-12 68 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain K12 / DH10B)
C4ZSX9 7.34e-12 68 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain K12 / MC4100 / BW2952)
B7LHU9 7.34e-12 68 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli (strain 55989 / EAEC)
A7ZSD5 7.34e-12 68 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83Q03 9e-12 68 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Shigella flexneri
B7NLF9 9.7e-12 68 24 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q3YX06 4.32e-11 66 23 11 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Shigella sonnei (strain Ss046)
B7LRL6 2.72e-10 64 23 10 326 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5YSW7 3.43e-10 63 24 12 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9E5 3.43e-10 63 24 12 324 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Escherichia coli O157:H7
A7MJB1 1.01e-09 62 23 12 337 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Cronobacter sakazakii (strain ATCC BAA-894)
B4TX73 2.99e-09 61 23 10 326 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella schwarzengrund (strain CVM19633)
B5F7M5 2.99e-09 61 23 10 326 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella agona (strain SL483)
Q7CPM8 3.49e-09 60 23 10 326 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XF83 3.49e-09 60 23 10 326 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella typhi
B5BGR9 3.49e-09 60 23 10 326 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella paratyphi A (strain AKU_12601)
C0PZR0 3.49e-09 60 23 10 326 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella paratyphi C (strain RKS4594)
A9N863 3.49e-09 60 23 10 326 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJT8 3.49e-09 60 23 10 326 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T775 3.49e-09 60 23 10 326 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella newport (strain SL254)
B4TJT9 3.49e-09 60 23 10 326 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella heidelberg (strain SL476)
B5R1A8 3.49e-09 60 23 10 326 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella enteritidis PT4 (strain P125109)
B5FIU3 3.49e-09 60 23 10 326 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella dublin (strain CT_02021853)
Q57JA3 3.49e-09 60 23 10 326 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella choleraesuis (strain SC-B67)
A4WF55 8.11e-09 59 23 12 329 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Enterobacter sp. (strain 638)
A9MNW9 1.11e-08 59 22 10 326 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5REW3 1.64e-08 58 22 10 326 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Salmonella gallinarum (strain 287/91 / NCTC 13346)
A8AQD5 3.19e-08 58 22 11 344 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A8AIZ1 5.89e-08 57 28 4 156 3 CKO_02332 UPF0194 membrane protein CKO_02332 Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B2VGW1 9.68e-08 56 23 8 290 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A1JRH9 2.11e-07 55 24 4 196 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A7FDT5 2.69e-07 55 25 3 170 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q665H1 3.22e-07 55 24 3 174 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pseudotuberculosis serotype I (strain IP32953)
A4THE9 3.22e-07 55 24 3 174 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pestis (strain Pestoides F)
Q1CDW6 3.22e-07 55 24 3 174 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pestis bv. Antiqua (strain Nepal516)
A9R1V9 3.22e-07 55 24 3 174 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAU9 3.22e-07 55 24 3 174 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pestis
B2K437 3.22e-07 55 24 3 174 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C1L2 3.22e-07 55 24 3 174 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pestis bv. Antiqua (strain Antiqua)
B1JKI2 3.53e-07 55 24 3 174 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
P76185 8.81e-07 53 24 13 318 3 ydhJ Uncharacterized protein YdhJ Escherichia coli (strain K12)
B5R785 9.42e-07 53 22 9 335 3 ybhG UPF0194 membrane protein YbhG Salmonella gallinarum (strain 287/91 / NCTC 13346)
A9MIT3 1.01e-06 53 22 10 357 3 ybhG UPF0194 membrane protein YbhG Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8ZQP0 1.31e-06 53 22 9 338 3 ybhG UPF0194 membrane protein YbhG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z879 1.31e-06 53 22 9 338 3 ybhG UPF0194 membrane protein YbhG Salmonella typhi
C0PX06 1.31e-06 53 22 9 338 3 ybhG UPF0194 membrane protein YbhG Salmonella paratyphi C (strain RKS4594)
B5QXS4 1.31e-06 53 22 9 338 3 ybhG UPF0194 membrane protein YbhG Salmonella enteritidis PT4 (strain P125109)
B5FP83 1.31e-06 53 22 9 338 3 ybhG UPF0194 membrane protein YbhG Salmonella dublin (strain CT_02021853)
Q57RE0 1.31e-06 53 22 9 338 3 ybhG UPF0194 membrane protein YbhG Salmonella choleraesuis (strain SC-B67)
B5F095 1.31e-06 53 22 9 338 3 ybhG UPF0194 membrane protein YbhG Salmonella agona (strain SL483)
B5BC09 1.37e-06 53 22 9 335 3 ybhG UPF0194 membrane protein YbhG Salmonella paratyphi A (strain AKU_12601)
Q5PG34 1.37e-06 53 22 9 335 3 ybhG UPF0194 membrane protein YbhG Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TQW1 1.45e-06 53 22 9 338 3 ybhG UPF0194 membrane protein YbhG Salmonella schwarzengrund (strain CVM19633)
A9MSW1 1.45e-06 53 22 9 338 3 ybhG UPF0194 membrane protein YbhG Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T074 1.45e-06 53 22 9 338 3 ybhG UPF0194 membrane protein YbhG Salmonella newport (strain SL254)
B4TC72 1.45e-06 53 22 9 338 3 ybhG UPF0194 membrane protein YbhG Salmonella heidelberg (strain SL476)
A4W8D7 1.66e-06 52 27 9 211 3 Ent638_1286 UPF0194 membrane protein Ent638_1286 Enterobacter sp. (strain 638)
P37683 2.62e-06 52 20 8 250 1 yiaV Inner membrane protein YiaV Escherichia coli (strain K12)
A8GK45 4.02e-06 51 22 10 339 3 aaeA p-hydroxybenzoic acid efflux pump subunit AaeA Serratia proteamaculans (strain 568)
P25196 4.16e-06 52 24 5 210 3 nolF Nodulation protein NolF Rhizobium meliloti (strain 1021)
Q83S36 1.29e-05 50 22 10 334 3 ybhG UPF0194 membrane protein YbhG Shigella flexneri
Q0TJQ3 1.66e-05 49 22 10 334 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8FJN6 1.69e-05 49 22 10 334 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1A936 1.93e-05 49 22 10 334 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O1:K1 / APEC
B7MQP9 1.93e-05 49 22 10 334 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O81 (strain ED1a)
B7MGQ3 1.93e-05 49 22 10 334 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZJK6 2e-05 49 22 10 338 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O139:H28 (strain E24377A / ETEC)
B6I7V1 2.23e-05 49 22 10 338 3 ybhG UPF0194 membrane protein YbhG Escherichia coli (strain SE11)
B7M768 2.23e-05 49 22 10 338 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O8 (strain IAI1)
B7LC78 2.23e-05 49 22 10 338 3 ybhG UPF0194 membrane protein YbhG Escherichia coli (strain 55989 / EAEC)
Q9L9D4 2.36e-05 49 29 8 184 3 None UPF0194 membrane protein in asrC 5'region (Fragment) Acidithiobacillus ferridurans
Q0T6G6 2.37e-05 49 22 10 334 3 ybhG UPF0194 membrane protein YbhG Shigella flexneri serotype 5b (strain 8401)
B1LM86 2.37e-05 49 22 10 334 3 ybhG UPF0194 membrane protein YbhG Escherichia coli (strain SMS-3-5 / SECEC)
B1IXH3 2.37e-05 49 22 10 334 3 ybhG UPF0194 membrane protein YbhG Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZY51 2.37e-05 49 22 10 334 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O9:H4 (strain HS)
B5YS86 2.37e-05 49 22 10 334 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O157:H7 (strain EC4115 / EHEC)
B7LJW4 2.4e-05 49 22 10 334 3 ybhG UPF0194 membrane protein YbhG Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NA95 2.4e-05 49 22 10 334 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7NNM5 2.4e-05 49 22 10 334 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q8X7Y9 2.4e-05 49 22 10 334 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O157:H7
B7ULZ2 2.4e-05 49 22 10 334 3 ybhG UPF0194 membrane protein YbhG Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q32I67 2.65e-05 49 22 10 334 3 ybhG UPF0194 membrane protein YbhG Shigella dysenteriae serotype 1 (strain Sd197)
Q3Z3Z0 2.69e-05 49 22 10 338 3 ybhG UPF0194 membrane protein YbhG Shigella sonnei (strain Ss046)
Q57500 3.59e-05 48 23 9 302 3 HI_0894 Uncharacterized protein HI_0894 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P75777 4.73e-05 48 22 10 334 2 ybhG UPF0194 membrane protein YbhG Escherichia coli (strain K12)
B1X7C5 4.73e-05 48 22 10 334 3 ybhG UPF0194 membrane protein YbhG Escherichia coli (strain K12 / DH10B)
C4ZXW7 4.73e-05 48 22 10 334 3 ybhG UPF0194 membrane protein YbhG Escherichia coli (strain K12 / MC4100 / BW2952)
Q1RED2 6.77e-05 48 22 10 334 3 ybhG UPF0194 membrane protein YbhG Escherichia coli (strain UTI89 / UPEC)
Q323Z9 0.0001 47 21 10 338 3 ybhG UPF0194 membrane protein YbhG Shigella boydii serotype 4 (strain Sb227)
A1JKX1 0.000158 47 23 6 240 3 mdtA Multidrug resistance protein MdtA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P94851 0.000296 45 22 8 306 3 HP_1488 36 kDa antigen Helicobacter pylori (strain ATCC 700392 / 26695)
P37626 0.000367 45 23 5 256 3 yhiI Uncharacterized protein YhiI Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS15260
Feature type CDS
Gene -
Product HlyD family secretion protein
Location 3385691 - 3386791 (strand: 1)
Length 1101 (nucleotides) / 366 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_456
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00529 Cation efflux system protein CusB domain 1
PF16576 Barrel-sandwich domain of CusB or HlyD membrane-fusion

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1566 Defense mechanisms (V) V Multidrug resistance efflux pump EmrA

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03543 membrane fusion protein, multidrug efflux system - -

Protein Sequence

MENIQSKKEKIMQLVMVYTPWITVICVVAFIGIATADWDRWWSDARYQTTDNAYIKADSTILKSRMTGFISQINKEDYQVVKRGEVIAEINKKEQILNRQAALAEYQKAQLALDNLTEEIKEYQLNIEKLANRYQASVIDVTQAKRSPMLRKDLINSGAITQQNYLDAQSDLQRLMKLQSAAKNEWDQAKQALVLLKSQEKIRLAQKDIAQTQYQQAETELSYATIKAPFDAQLNKIKVNIGSLVTAGSEIVTLTPINDVYIIANLKETQIKKVQPEQSVAIKVDAFPTDVFSGKVRYIGAQSSGESALIPADNASGNFTKVVQRIPVYITLNSDNRHLAKLRAGMSVQVKIDTDSLPIEEGERSD

Flanking regions ( +/- flanking 50bp)

AGATTAAAGCGAAAGTTAAATATCACTAAGCTTCGCTTAGGAGTAGAAAGATGGAAAATATTCAATCAAAAAAAGAAAAAATCATGCAGTTAGTGATGGTTTATACACCTTGGATCACTGTGATATGTGTTGTTGCGTTTATTGGTATAGCGACTGCAGATTGGGATCGCTGGTGGAGTGATGCTCGTTATCAAACAACAGATAACGCTTACATAAAAGCGGACTCAACGATATTGAAATCACGAATGACTGGGTTTATTTCTCAGATTAATAAAGAGGATTACCAAGTAGTAAAACGTGGTGAGGTCATTGCTGAAATTAATAAGAAAGAACAAATATTAAATCGGCAAGCGGCATTAGCAGAGTATCAAAAAGCCCAATTAGCTTTAGATAATCTCACTGAAGAAATTAAAGAATATCAATTAAATATTGAGAAATTAGCTAATCGTTATCAAGCATCAGTTATTGATGTTACCCAAGCTAAGCGCAGTCCAATGTTGCGTAAAGATTTAATTAATAGTGGGGCTATCACACAACAAAATTATTTAGATGCTCAATCTGATTTGCAACGTTTAATGAAATTACAAAGTGCTGCGAAAAATGAGTGGGATCAGGCTAAACAAGCACTGGTATTACTAAAATCTCAAGAAAAAATACGTCTGGCACAAAAAGATATCGCTCAAACACAGTATCAGCAGGCTGAAACGGAGCTTTCATACGCGACTATTAAGGCTCCTTTCGATGCGCAATTAAATAAAATAAAAGTCAATATCGGTAGCCTTGTGACTGCGGGTAGCGAAATTGTGACTTTAACACCGATTAACGATGTATACATTATTGCCAATTTAAAAGAGACACAAATAAAAAAAGTACAGCCAGAACAATCTGTTGCTATCAAAGTTGATGCTTTTCCTACCGATGTTTTTTCAGGAAAAGTGAGATATATCGGCGCACAAAGTAGTGGTGAATCAGCACTTATTCCTGCTGATAATGCCAGTGGTAATTTTACTAAAGTAGTACAACGTATTCCGGTTTATATCACGCTCAATAGTGATAACCGACACTTAGCTAAATTAAGAGCGGGTATGTCTGTGCAAGTGAAAATTGACACAGATAGCCTTCCTATAGAGGAGGGGGAGCGCAGTGATTAAATTATTATCAGCAGCACAAAATCATCGTCCTATTTTTGTTGTTATGGCTG