Homologs in group_2338

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17710 FBDBKF_17710 84.1 Morganella morganii S1 purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
EHELCC_18195 EHELCC_18195 84.1 Morganella morganii S2 purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
NLDBIP_17955 NLDBIP_17955 84.1 Morganella morganii S4 purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
LHKJJB_18150 LHKJJB_18150 84.1 Morganella morganii S3 purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
HKOGLL_18050 HKOGLL_18050 84.1 Morganella morganii S5 purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
F4V73_RS15090 F4V73_RS15090 83.9 Morganella psychrotolerans purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase

Distribution of the homologs in the orthogroup group_2338

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2338

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EYT2 0.0 1099 100 0 529 3 purH Bifunctional purine biosynthesis protein PurH Proteus mirabilis (strain HI4320)
Q7N954 0.0 936 83 0 529 3 purH Bifunctional purine biosynthesis protein PurH Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JIJ7 0.0 927 83 0 529 3 purH Bifunctional purine biosynthesis protein PurH Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8G8G3 0.0 918 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Serratia proteamaculans (strain 568)
A4TS14 0.0 918 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Yersinia pestis (strain Pestoides F)
Q1CN60 0.0 918 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8E1 0.0 918 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAR3 0.0 918 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Yersinia pestis
Q1C1V9 0.0 918 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Yersinia pestis bv. Antiqua (strain Antiqua)
A7FNG6 0.0 918 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JJL6 0.0 916 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66FN5 0.0 916 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K130 0.0 916 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7ZUM3 0.0 914 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli O139:H28 (strain E24377A / ETEC)
B5BJS5 0.0 913 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Salmonella paratyphi A (strain AKU_12601)
Q5PKA9 0.0 913 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q3YUX8 0.0 911 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Shigella sonnei (strain Ss046)
Q83IR9 0.0 911 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Shigella flexneri
Q0SXZ4 0.0 911 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Shigella flexneri serotype 5b (strain 8401)
Q31TZ1 0.0 911 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Shigella boydii serotype 4 (strain Sb227)
B2TWJ3 0.0 911 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P26978 0.0 911 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B1LPG6 0.0 911 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli (strain SMS-3-5 / SECEC)
B6I5L8 0.0 911 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli (strain SE11)
B7M7R5 0.0 911 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli O8 (strain IAI1)
A9N0L8 0.0 911 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q1R5X1 0.0 911 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli (strain UTI89 / UPEC)
A1AIH7 0.0 911 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli O1:K1 / APEC
B7MIZ2 0.0 911 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli O45:K1 (strain S88 / ExPEC)
A8AKS0 0.0 911 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B4TDF3 0.0 910 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Salmonella heidelberg (strain SL476)
A8A7A6 0.0 910 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli O9:H4 (strain HS)
B5Z0A3 0.0 910 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X611 0.0 910 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli O157:H7
B5FQM1 0.0 909 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Salmonella dublin (strain CT_02021853)
Q32AH9 0.0 909 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Shigella dysenteriae serotype 1 (strain Sd197)
B7LUJ6 0.0 909 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NFU7 0.0 909 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B4TQL6 0.0 909 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Salmonella schwarzengrund (strain CVM19633)
B5F1I9 0.0 909 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Salmonella agona (strain SL483)
B7NRT9 0.0 909 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P15639 0.0 907 82 0 529 1 purH Bifunctional purine biosynthesis protein PurH Escherichia coli (strain K12)
B1IUP1 0.0 907 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XC09 0.0 907 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli (strain K12 / DH10B)
C5A0U7 0.0 907 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli (strain K12 / MC4100 / BW2952)
B7LAV3 0.0 907 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli (strain 55989 / EAEC)
Q8Z335 0.0 907 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Salmonella typhi
B4T108 0.0 907 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Salmonella newport (strain SL254)
B5RFH8 0.0 907 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QYG1 0.0 907 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Salmonella enteritidis PT4 (strain P125109)
B7MRD0 0.0 907 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli O81 (strain ED1a)
A7MJ89 0.0 907 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Cronobacter sakazakii (strain ATCC BAA-894)
A9MHC3 0.0 906 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q0TA59 0.0 905 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli O6:K15:H31 (strain 536 / UPEC)
C0Q2T8 0.0 905 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Salmonella paratyphi C (strain RKS4594)
Q8FB68 0.0 905 82 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q6DAL2 0.0 903 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B7UPG1 0.0 900 81 0 529 3 purH Bifunctional purine biosynthesis protein PurH Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B5XYD2 0.0 900 80 0 529 3 purH Bifunctional purine biosynthesis protein PurH Klebsiella pneumoniae (strain 342)
A6TGR3 0.0 897 80 0 529 3 purH Bifunctional purine biosynthesis protein PurH Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
C6DHT5 0.0 896 80 0 529 3 purH Bifunctional purine biosynthesis protein PurH Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B2VG81 0.0 879 79 0 529 3 purH Bifunctional purine biosynthesis protein PurH Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2NWQ7 0.0 872 79 0 529 3 purH Bifunctional purine biosynthesis protein PurH Sodalis glossinidius (strain morsitans)
C3LQN2 0.0 865 78 2 531 3 purH Bifunctional purine biosynthesis protein PurH Vibrio cholerae serotype O1 (strain M66-2)
Q9KV80 0.0 865 78 2 531 3 purH Bifunctional purine biosynthesis protein PurH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3U8 0.0 863 78 2 531 3 purH Bifunctional purine biosynthesis protein PurH Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B7VM57 0.0 850 75 2 531 3 purH Bifunctional purine biosynthesis protein PurH Vibrio atlanticus (strain LGP32)
B5FC70 0.0 849 75 2 531 3 purH Bifunctional purine biosynthesis protein PurH Aliivibrio fischeri (strain MJ11)
Q7MGT5 0.0 848 75 2 531 3 purH Bifunctional purine biosynthesis protein PurH Vibrio vulnificus (strain YJ016)
Q8DD06 0.0 848 75 2 531 3 purH Bifunctional purine biosynthesis protein PurH Vibrio vulnificus (strain CMCP6)
Q5E257 0.0 848 75 2 531 3 purH Bifunctional purine biosynthesis protein PurH Aliivibrio fischeri (strain ATCC 700601 / ES114)
C4LA41 0.0 846 75 2 531 3 purH Bifunctional purine biosynthesis protein PurH Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q87KT0 0.0 845 75 2 531 3 purH Bifunctional purine biosynthesis protein PurH Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MXG0 0.0 844 75 2 531 3 purH Bifunctional purine biosynthesis protein PurH Vibrio campbellii (strain ATCC BAA-1116)
P43852 0.0 843 74 1 529 3 purH Bifunctional purine biosynthesis protein PurH Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P57828 0.0 838 74 1 533 3 purH Bifunctional purine biosynthesis protein PurH Pasteurella multocida (strain Pm70)
B6ENA8 0.0 838 75 2 531 3 purH Bifunctional purine biosynthesis protein PurH Aliivibrio salmonicida (strain LFI1238)
Q0I557 0.0 830 73 1 532 3 purH Bifunctional purine biosynthesis protein PurH Histophilus somni (strain 129Pt)
B0UWT1 0.0 830 73 1 532 3 purH Bifunctional purine biosynthesis protein PurH Histophilus somni (strain 2336)
A1SZJ2 0.0 823 73 2 531 3 purH Bifunctional purine biosynthesis protein PurH Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A8GZM3 0.0 819 72 0 529 3 purH Bifunctional purine biosynthesis protein PurH Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TR91 0.0 819 72 0 529 3 purH Bifunctional purine biosynthesis protein PurH Shewanella halifaxensis (strain HAW-EB4)
B8CTW4 0.0 812 72 0 529 3 purH Bifunctional purine biosynthesis protein PurH Shewanella piezotolerans (strain WP3 / JCM 13877)
Q489F4 0.0 805 71 2 534 3 purH Bifunctional purine biosynthesis protein PurH Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A4SR98 0.0 805 74 2 531 3 purH Bifunctional purine biosynthesis protein PurH Aeromonas salmonicida (strain A449)
A3QII0 0.0 803 73 0 529 3 purH Bifunctional purine biosynthesis protein PurH Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B4S133 0.0 799 71 2 532 3 purH Bifunctional purine biosynthesis protein PurH Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A0KGJ2 0.0 798 74 2 531 3 purH Bifunctional purine biosynthesis protein PurH Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B1KNA0 0.0 794 72 1 535 3 purH Bifunctional purine biosynthesis protein PurH Shewanella woodyi (strain ATCC 51908 / MS32)
Q088G0 0.0 788 71 0 529 3 purH Bifunctional purine biosynthesis protein PurH Shewanella frigidimarina (strain NCIMB 400)
Q12IP4 0.0 785 72 2 535 3 purH Bifunctional purine biosynthesis protein PurH Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A1S2J9 0.0 785 72 0 529 3 purH Bifunctional purine biosynthesis protein PurH Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A8FQD4 0.0 780 71 1 534 3 purH Bifunctional purine biosynthesis protein PurH Shewanella sediminis (strain HAW-EB3)
Q31II8 0.0 773 69 1 526 3 purH Bifunctional purine biosynthesis protein PurH Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q3IIC3 0.0 771 70 1 529 3 purH Bifunctional purine biosynthesis protein PurH Pseudoalteromonas translucida (strain TAC 125)
Q8EJM1 0.0 766 70 2 538 3 purH Bifunctional purine biosynthesis protein PurH Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0VMY5 0.0 751 70 3 525 3 purH Bifunctional purine biosynthesis protein PurH Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
C1DLJ1 0.0 736 67 3 529 3 purH Bifunctional purine biosynthesis protein PurH Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A4XQ60 0.0 735 67 3 529 3 purH Bifunctional purine biosynthesis protein PurH Pseudomonas mendocina (strain ymp)
Q46480 0.0 728 66 5 528 3 purH Bifunctional purine biosynthesis protein PurH Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
C3K6E0 0.0 728 67 3 529 3 purH Bifunctional purine biosynthesis protein PurH Pseudomonas fluorescens (strain SBW25)
Q4KIX5 0.0 726 66 3 529 3 purH Bifunctional purine biosynthesis protein PurH Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A4VPK9 0.0 726 66 4 529 3 purH Bifunctional purine biosynthesis protein PurH Stutzerimonas stutzeri (strain A1501)
Q1LU51 0.0 726 65 1 529 3 purH Bifunctional purine biosynthesis protein PurH Baumannia cicadellinicola subsp. Homalodisca coagulata
Q87VR9 0.0 723 66 2 528 3 purH Bifunctional purine biosynthesis protein PurH Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q1I4C1 0.0 715 65 3 529 3 purH Bifunctional purine biosynthesis protein PurH Pseudomonas entomophila (strain L48)
Q9HUV9 0.0 711 66 3 529 3 purH Bifunctional purine biosynthesis protein PurH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7V1R6 0.0 711 66 3 529 3 purH Bifunctional purine biosynthesis protein PurH Pseudomonas aeruginosa (strain LESB58)
B1J5T3 0.0 711 65 3 529 3 purH Bifunctional purine biosynthesis protein PurH Pseudomonas putida (strain W619)
A6VCW0 0.0 710 66 3 529 3 purH Bifunctional purine biosynthesis protein PurH Pseudomonas aeruginosa (strain PA7)
Q88DK3 0.0 709 65 3 529 3 purH Bifunctional purine biosynthesis protein PurH Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W9K7 0.0 709 65 3 529 3 purH Bifunctional purine biosynthesis protein PurH Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q02FG6 0.0 709 66 3 529 3 purH Bifunctional purine biosynthesis protein PurH Pseudomonas aeruginosa (strain UCBPP-PA14)
B0KJZ6 0.0 707 65 3 529 3 purH Bifunctional purine biosynthesis protein PurH Pseudomonas putida (strain GB-1)
A5G879 0.0 702 65 5 527 3 purH Bifunctional purine biosynthesis protein PurH Geotalea uraniireducens (strain Rf4)
B9M4Q6 0.0 699 64 5 530 3 purH Bifunctional purine biosynthesis protein PurH Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q74FJ9 0.0 698 64 5 527 3 purH Bifunctional purine biosynthesis protein PurH Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A5WFX4 0.0 689 64 4 524 3 purH Bifunctional purine biosynthesis protein PurH Psychrobacter sp. (strain PRwf-1)
Q39RK1 0.0 688 64 6 528 3 purH Bifunctional purine biosynthesis protein PurH Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B5EBF9 0.0 684 62 4 526 3 purH Bifunctional purine biosynthesis protein PurH Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
C6E5Z3 0.0 684 62 4 526 3 purH Bifunctional purine biosynthesis protein PurH Geobacter sp. (strain M21)
Q4FRN8 0.0 681 64 4 526 3 purH Bifunctional purine biosynthesis protein PurH Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1QA75 0.0 675 63 4 526 3 purH Bifunctional purine biosynthesis protein PurH Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q3A2D6 0.0 674 64 5 527 3 purH Bifunctional purine biosynthesis protein PurH Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q3JC90 0.0 667 60 5 528 3 purH Bifunctional purine biosynthesis protein PurH Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A1AS76 0.0 655 61 6 527 3 purH Bifunctional purine biosynthesis protein PurH Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A3NDF2 0.0 644 61 6 529 3 purH Bifunctional purine biosynthesis protein PurH Burkholderia pseudomallei (strain 668)
A3NZ64 0.0 644 61 6 529 3 purH Bifunctional purine biosynthesis protein PurH Burkholderia pseudomallei (strain 1106a)
A1V068 0.0 644 61 6 529 3 purH Bifunctional purine biosynthesis protein PurH Burkholderia mallei (strain SAVP1)
Q62HA6 0.0 644 61 6 529 3 purH Bifunctional purine biosynthesis protein PurH Burkholderia mallei (strain ATCC 23344)
A2S597 0.0 644 61 6 529 3 purH Bifunctional purine biosynthesis protein PurH Burkholderia mallei (strain NCTC 10229)
A3MP76 0.0 644 61 6 529 3 purH Bifunctional purine biosynthesis protein PurH Burkholderia mallei (strain NCTC 10247)
A4JBL5 0.0 643 61 6 529 3 purH Bifunctional purine biosynthesis protein PurH Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q2SZ52 0.0 643 61 6 529 3 purH Bifunctional purine biosynthesis protein PurH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A9AH70 0.0 643 61 5 527 3 purH Bifunctional purine biosynthesis protein PurH Burkholderia multivorans (strain ATCC 17616 / 249)
Q63QX8 0.0 642 61 6 529 3 purH Bifunctional purine biosynthesis protein PurH Burkholderia pseudomallei (strain K96243)
Q3JNS8 0.0 642 61 6 529 3 purH Bifunctional purine biosynthesis protein PurH Burkholderia pseudomallei (strain 1710b)
B1YTE2 0.0 642 61 6 529 3 purH Bifunctional purine biosynthesis protein PurH Burkholderia ambifaria (strain MC40-6)
B2JGU1 0.0 642 60 5 527 3 purH Bifunctional purine biosynthesis protein PurH Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q39JI8 0.0 642 61 6 527 3 purH Bifunctional purine biosynthesis protein PurH Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0BI80 0.0 642 61 6 529 3 purH Bifunctional purine biosynthesis protein PurH Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1JVV6 0.0 640 61 6 529 3 purH Bifunctional purine biosynthesis protein PurH Burkholderia orbicola (strain MC0-3)
B2SYJ7 0.0 639 60 6 529 3 purH Bifunctional purine biosynthesis protein PurH Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A0K4L7 0.0 639 60 5 527 3 purH Bifunctional purine biosynthesis protein PurH Burkholderia cenocepacia (strain HI2424)
Q1BZ33 0.0 639 60 5 527 3 purH Bifunctional purine biosynthesis protein PurH Burkholderia orbicola (strain AU 1054)
Q13UC4 0.0 638 60 6 529 3 purH Bifunctional purine biosynthesis protein PurH Paraburkholderia xenovorans (strain LB400)
B4EES4 0.0 637 60 6 527 3 purH Bifunctional purine biosynthesis protein PurH Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
B2UFL5 0.0 635 61 6 529 3 purH Bifunctional purine biosynthesis protein PurH Ralstonia pickettii (strain 12J)
Q8Y232 0.0 625 60 7 532 3 purH Bifunctional purine biosynthesis protein PurH Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q0KEC0 0.0 625 60 5 528 3 purH Bifunctional purine biosynthesis protein PurH Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q475R4 0.0 624 60 5 527 3 purH Bifunctional purine biosynthesis protein PurH Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q87D58 0.0 622 58 4 525 3 purH Bifunctional purine biosynthesis protein PurH Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I4L7 0.0 622 58 4 525 3 purH Bifunctional purine biosynthesis protein PurH Xylella fastidiosa (strain M23)
Q1LRB3 0.0 620 60 5 528 3 purH Bifunctional purine biosynthesis protein PurH Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A6SUQ1 0.0 619 58 4 525 3 purH Bifunctional purine biosynthesis protein PurH Janthinobacterium sp. (strain Marseille)
B2AH76 0.0 618 60 5 528 3 purH Bifunctional purine biosynthesis protein PurH Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A4G1U6 0.0 618 58 4 525 3 purH Bifunctional purine biosynthesis protein PurH Herminiimonas arsenicoxydans
Q1H4G7 0.0 615 57 5 532 3 purH Bifunctional purine biosynthesis protein PurH Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
B8D6U7 0.0 614 53 3 524 3 purH Bifunctional purine biosynthesis protein PurH Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57143 0.0 614 53 3 524 3 purH Bifunctional purine biosynthesis protein PurH Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9PC10 0.0 614 57 5 528 3 purH Bifunctional purine biosynthesis protein PurH Xylella fastidiosa (strain 9a5c)
B8D8J3 0.0 613 53 3 524 3 purH Bifunctional purine biosynthesis protein PurH Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A9M4I2 0.0 613 58 5 526 3 purH Bifunctional purine biosynthesis protein PurH Neisseria meningitidis serogroup C (strain 053442)
B0U7A0 0.0 612 57 4 527 3 purH Bifunctional purine biosynthesis protein PurH Xylella fastidiosa (strain M12)
B2SRB2 0.0 612 58 2 524 3 purH Bifunctional purine biosynthesis protein PurH Xanthomonas oryzae pv. oryzae (strain PXO99A)
B4RP71 0.0 612 58 6 527 3 purH Bifunctional purine biosynthesis protein PurH Neisseria gonorrhoeae (strain NCCP11945)
Q5F6T1 0.0 612 58 6 527 3 purH Bifunctional purine biosynthesis protein PurH Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5H5H7 0.0 610 58 2 524 3 purH Bifunctional purine biosynthesis protein PurH Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q9JZM7 0.0 610 57 3 528 3 purH Bifunctional purine biosynthesis protein PurH Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1KTP9 0.0 608 58 6 527 3 purH Bifunctional purine biosynthesis protein PurH Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q7P0M1 0.0 608 60 4 525 3 purH Bifunctional purine biosynthesis protein PurH Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q2P866 0.0 608 57 2 524 3 purH Bifunctional purine biosynthesis protein PurH Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A4T025 0.0 605 58 6 532 3 purH Bifunctional purine biosynthesis protein PurH Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
C1D6F1 0.0 604 59 5 526 3 purH Bifunctional purine biosynthesis protein PurH Laribacter hongkongensis (strain HLHK9)
Q8KA70 0.0 603 54 5 525 3 purH Bifunctional purine biosynthesis protein PurH Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B1XS23 0.0 600 57 6 532 3 purH Bifunctional purine biosynthesis protein PurH Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q9JUQ8 0.0 600 57 5 529 3 purH Bifunctional purine biosynthesis protein PurH Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
B3E7F6 0.0 597 56 7 530 3 purH Bifunctional purine biosynthesis protein PurH Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
B4SL92 0.0 592 58 5 528 3 purH Bifunctional purine biosynthesis protein PurH Stenotrophomonas maltophilia (strain R551-3)
B2FJP9 0.0 591 58 5 528 3 purH Bifunctional purine biosynthesis protein PurH Stenotrophomonas maltophilia (strain K279a)
Q3BY85 0.0 590 58 3 527 3 purH Bifunctional purine biosynthesis protein PurH Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PQ19 0.0 590 57 3 527 3 purH Bifunctional purine biosynthesis protein PurH Xanthomonas axonopodis pv. citri (strain 306)
Q8PD47 0.0 588 57 3 527 3 purH Bifunctional purine biosynthesis protein PurH Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RN27 0.0 588 57 3 527 3 purH Bifunctional purine biosynthesis protein PurH Xanthomonas campestris pv. campestris (strain B100)
Q4UZD2 0.0 588 57 3 527 3 purH Bifunctional purine biosynthesis protein PurH Xanthomonas campestris pv. campestris (strain 8004)
C5CL84 0.0 577 54 6 535 3 purH Bifunctional purine biosynthesis protein PurH Variovorax paradoxus (strain S110)
A0LDB0 0.0 575 57 8 536 3 purH Bifunctional purine biosynthesis protein PurH Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B7J5P7 0.0 572 54 8 536 3 purH Bifunctional purine biosynthesis protein PurH Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
B5EL42 0.0 571 55 8 530 3 purH Bifunctional purine biosynthesis protein PurH Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
Q9KF53 0.0 560 53 6 524 3 purH Bifunctional purine biosynthesis protein PurH Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B7GFU2 0.0 557 53 6 525 3 purH Bifunctional purine biosynthesis protein PurH Anoxybacillus flavithermus (strain DSM 21510 / WK1)
B7HS36 0.0 555 52 6 524 3 purH Bifunctional purine biosynthesis protein PurH Bacillus cereus (strain AH187)
Q73EN1 0.0 554 52 6 524 3 purH Bifunctional purine biosynthesis protein PurH Bacillus cereus (strain ATCC 10987 / NRS 248)
B7H4U0 0.0 553 52 6 524 3 purH Bifunctional purine biosynthesis protein PurH Bacillus cereus (strain B4264)
B7JM89 0.0 552 52 6 524 3 purH Bifunctional purine biosynthesis protein PurH Bacillus cereus (strain AH820)
Q81ZG8 0.0 552 52 6 524 3 purH Bifunctional purine biosynthesis protein PurH Bacillus anthracis
C3L536 0.0 552 52 6 524 3 purH Bifunctional purine biosynthesis protein PurH Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PBN4 0.0 552 52 6 524 3 purH Bifunctional purine biosynthesis protein PurH Bacillus anthracis (strain A0248)
C1EV67 0.0 551 52 6 524 3 purH Bifunctional purine biosynthesis protein PurH Bacillus cereus (strain 03BB102)
Q81IP9 0.0 551 52 6 524 3 purH Bifunctional purine biosynthesis protein PurH Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B9J1K9 0.0 551 52 6 524 3 purH Bifunctional purine biosynthesis protein PurH Bacillus cereus (strain Q1)
A0R900 0.0 550 52 5 524 3 purH Bifunctional purine biosynthesis protein PurH Bacillus thuringiensis (strain Al Hakam)
B7IUV7 0.0 550 52 7 525 3 purH Bifunctional purine biosynthesis protein PurH Bacillus cereus (strain G9842)
Q6HPA0 0.0 549 52 6 524 3 purH Bifunctional purine biosynthesis protein PurH Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63GS9 0.0 548 52 6 524 3 purH Bifunctional purine biosynthesis protein PurH Bacillus cereus (strain ZK / E33L)
A9VRF5 0.0 545 51 5 524 3 purH Bifunctional purine biosynthesis protein PurH Bacillus mycoides (strain KBAB4)
A7GKI2 0.0 542 51 6 524 3 purH Bifunctional purine biosynthesis protein PurH Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q5LN38 0.0 536 53 8 542 3 purH Bifunctional purine biosynthesis protein PurH Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5WJ82 0.0 533 53 10 527 3 purH Bifunctional purine biosynthesis protein PurH Shouchella clausii (strain KSM-K16)
P12048 0.0 530 49 5 525 3 purH Bifunctional purine biosynthesis protein PurH Bacillus subtilis (strain 168)
B5YLE5 0.0 529 51 12 540 3 purH Bifunctional purine biosynthesis protein PurH Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B0KBQ1 0.0 527 51 8 524 3 purH Bifunctional purine biosynthesis protein PurH Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0K3Q8 0.0 527 51 8 524 3 purH Bifunctional purine biosynthesis protein PurH Thermoanaerobacter sp. (strain X514)
C0QRH2 0.0 526 51 9 526 3 purH Bifunctional purine biosynthesis protein PurH Persephonella marina (strain DSM 14350 / EX-H1)
Q1GKJ2 0.0 526 52 9 542 3 purH Bifunctional purine biosynthesis protein PurH Ruegeria sp. (strain TM1040)
Q16CE0 0.0 525 53 9 542 3 purH Bifunctional purine biosynthesis protein PurH Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A8LMD0 0.0 525 53 9 542 3 purH Bifunctional purine biosynthesis protein PurH Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q89WU7 0.0 524 53 10 543 3 purH Bifunctional purine biosynthesis protein PurH Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q2RN46 0.0 523 53 9 540 3 purH Bifunctional purine biosynthesis protein PurH Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q8CXK7 0.0 521 51 5 524 3 purH Bifunctional purine biosynthesis protein PurH Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
C1KW64 0.0 521 50 6 525 3 purH Bifunctional purine biosynthesis protein PurH Listeria monocytogenes serotype 4b (strain CLIP80459)
Q71YQ3 1.47e-180 520 50 7 525 3 purH Bifunctional purine biosynthesis protein PurH Listeria monocytogenes serotype 4b (strain F2365)
A4WWQ0 5.85e-180 519 53 10 542 3 purH Bifunctional purine biosynthesis protein PurH Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
B3ELV3 2.01e-179 518 52 9 536 3 purH Bifunctional purine biosynthesis protein PurH Chlorobium phaeobacteroides (strain BS1)
A4XKZ2 3.03e-179 517 49 8 526 3 purH Bifunctional purine biosynthesis protein PurH Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A6WXV3 7.81e-179 516 52 11 542 3 purH Bifunctional purine biosynthesis protein PurH Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B9KP36 1.07e-178 516 53 9 542 3 purH Bifunctional purine biosynthesis protein PurH Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q3IYU8 1.07e-178 516 53 9 542 3 purH Bifunctional purine biosynthesis protein PurH Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PNE9 1.07e-178 516 53 9 542 3 purH Bifunctional purine biosynthesis protein PurH Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q8RC55 1.77e-178 514 50 9 526 3 purH Bifunctional purine biosynthesis protein PurH Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B8I490 2.98e-178 514 51 9 527 3 purH Bifunctional purine biosynthesis protein PurH Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A7HSQ6 5.02e-178 514 53 11 540 3 purH Bifunctional purine biosynthesis protein PurH Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
B0SQ10 8.12e-178 513 48 5 525 3 purH Bifunctional purine biosynthesis protein PurH Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SGW3 8.12e-178 513 48 5 525 3 purH Bifunctional purine biosynthesis protein PurH Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
B4S3H9 8.53e-178 513 52 7 529 3 purH Bifunctional purine biosynthesis protein PurH Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q8Y6C5 9.5e-178 513 49 6 525 3 purH Bifunctional purine biosynthesis protein PurH Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q92AP3 2.76e-177 511 49 6 525 3 purH Bifunctional purine biosynthesis protein PurH Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A6TLS7 3.95e-177 511 48 8 526 3 purH Bifunctional purine biosynthesis protein PurH Alkaliphilus metalliredigens (strain QYMF)
A3DEU9 5.01e-177 511 50 7 527 3 purH Bifunctional purine biosynthesis protein PurH Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
C3MAR5 6.55e-177 512 53 11 536 3 purH Bifunctional purine biosynthesis protein PurH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B0TEC5 1.36e-176 511 51 9 536 3 purH Bifunctional purine biosynthesis protein PurH Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q8F3W6 1.95e-176 509 48 6 525 3 purH Bifunctional purine biosynthesis protein PurH Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
B3QS62 2.75e-176 509 52 9 535 3 purH Bifunctional purine biosynthesis protein PurH Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q833Z3 2.92e-176 509 50 7 525 3 purH Bifunctional purine biosynthesis protein PurH Enterococcus faecalis (strain ATCC 700802 / V583)
Q57B71 3.11e-176 510 52 10 539 3 purH Bifunctional purine biosynthesis protein PurH Brucella abortus biovar 1 (strain 9-941)
Q2YLH0 3.11e-176 510 52 10 539 3 purH Bifunctional purine biosynthesis protein PurH Brucella abortus (strain 2308)
B2S7P0 3.11e-176 510 52 10 539 3 purH Bifunctional purine biosynthesis protein PurH Brucella abortus (strain S19)
P67540 3.55e-176 510 52 10 542 3 purH Bifunctional purine biosynthesis protein PurH Brucella suis biovar 1 (strain 1330)
A9WWU1 3.55e-176 510 52 10 542 3 purH Bifunctional purine biosynthesis protein PurH Brucella suis (strain ATCC 23445 / NCTC 10510)
P67539 3.55e-176 510 52 10 542 3 purH Bifunctional purine biosynthesis protein PurH Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RF67 3.55e-176 510 52 10 542 3 purH Bifunctional purine biosynthesis protein PurH Brucella melitensis biotype 2 (strain ATCC 23457)
A9M854 3.55e-176 510 52 10 542 3 purH Bifunctional purine biosynthesis protein PurH Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
B9MS89 3.84e-176 509 48 7 526 3 purH Bifunctional purine biosynthesis protein PurH Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
B4SDT6 1.29e-175 508 50 8 536 3 purH Bifunctional purine biosynthesis protein PurH Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A5VSF8 1.41e-175 508 52 10 542 3 purH Bifunctional purine biosynthesis protein PurH Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A5FUH4 1.45e-175 507 53 8 526 3 purH Bifunctional purine biosynthesis protein PurH Acidiphilium cryptum (strain JF-5)
Q72RT5 3.45e-175 506 48 6 525 3 purH Bifunctional purine biosynthesis protein PurH Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q2IKQ7 4.13e-175 506 52 10 533 3 purH Bifunctional purine biosynthesis protein PurH Anaeromyxobacter dehalogenans (strain 2CP-C)
A1B5K8 6.71e-175 506 52 10 537 3 purH Bifunctional purine biosynthesis protein PurH Paracoccus denitrificans (strain Pd 1222)
B4UJ61 1.15e-174 506 52 9 533 3 purH Bifunctional purine biosynthesis protein PurH Anaeromyxobacter sp. (strain K)
B8JHC9 1.46e-174 505 52 9 533 3 purH Bifunctional purine biosynthesis protein PurH Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
A0AJL9 1.78e-174 504 50 6 525 3 purH Bifunctional purine biosynthesis protein PurH Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A1BE85 2.68e-174 504 50 8 535 3 purH Bifunctional purine biosynthesis protein PurH Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q28K03 3.48e-174 504 52 10 540 3 purH Bifunctional purine biosynthesis protein PurH Jannaschia sp. (strain CCS1)
Q3ATZ1 5.64e-174 504 50 7 531 3 purH Bifunctional purine biosynthesis protein PurH Chlorobium chlorochromatii (strain CaD3)
B1HTV8 1.05e-173 503 50 5 524 3 purH Bifunctional purine biosynthesis protein PurH Lysinibacillus sphaericus (strain C3-41)
Q92KX6 3.02e-173 502 52 10 536 3 purH Bifunctional purine biosynthesis protein PurH Rhizobium meliloti (strain 1021)
B8DDZ2 1.08e-172 500 49 6 525 3 purH Bifunctional purine biosynthesis protein PurH Listeria monocytogenes serotype 4a (strain HCC23)
A6UED3 5.28e-172 499 52 10 536 3 purH Bifunctional purine biosynthesis protein PurH Sinorhizobium medicae (strain WSM419)
Q8D244 2.71e-171 497 48 4 532 3 purH Bifunctional purine biosynthesis protein PurH Wigglesworthia glossinidia brevipalpis
Q11CT4 3.08e-171 497 53 8 538 3 purH Bifunctional purine biosynthesis protein PurH Chelativorans sp. (strain BNC1)
A7HA60 3.74e-171 496 50 8 534 3 purH Bifunctional purine biosynthesis protein PurH Anaeromyxobacter sp. (strain Fw109-5)
Q24QH6 4.83e-171 496 50 8 526 3 purH Bifunctional purine biosynthesis protein PurH Desulfitobacterium hafniense (strain Y51)
B8FP05 4.83e-171 496 50 8 526 3 purH Bifunctional purine biosynthesis protein PurH Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q0AW31 5.25e-171 496 49 10 528 3 purH Bifunctional purine biosynthesis protein PurH Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q051H8 2.7e-170 494 47 5 525 3 purH Bifunctional purine biosynthesis protein PurH Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04T56 2.7e-170 494 47 5 525 3 purH Bifunctional purine biosynthesis protein PurH Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q049M1 4.52e-170 493 48 10 537 3 purH Bifunctional purine biosynthesis protein PurH Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G9G2 4.52e-170 493 48 10 537 3 purH Bifunctional purine biosynthesis protein PurH Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q9ABY4 6.09e-170 494 52 8 528 3 purH Bifunctional purine biosynthesis protein PurH Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B3EEI0 8.41e-170 493 50 6 529 3 purH Bifunctional purine biosynthesis protein PurH Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
B3WF93 1e-169 492 49 6 526 3 purH Bifunctional purine biosynthesis protein PurH Lacticaseibacillus casei (strain BL23)
A4SDE6 1.01e-169 493 50 7 532 3 purH Bifunctional purine biosynthesis protein PurH Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q6FYG4 2.08e-169 493 50 9 540 3 purH Bifunctional purine biosynthesis protein PurH Bartonella quintana (strain Toulouse)
B7K3N8 2.73e-169 491 48 9 527 3 purH Bifunctional purine biosynthesis protein PurH Rippkaea orientalis (strain PCC 8801 / RF-1)
Q2K2T6 2.82e-169 492 52 10 536 3 purH Bifunctional purine biosynthesis protein PurH Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B5ZV31 2.91e-169 492 52 11 538 3 purH Bifunctional purine biosynthesis protein PurH Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q8UBM8 3.17e-169 492 52 12 541 3 purH Bifunctional purine biosynthesis protein PurH Agrobacterium fabrum (strain C58 / ATCC 33970)
B9JEU9 3.46e-169 492 51 10 537 3 purH Bifunctional purine biosynthesis protein PurH Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q037V3 5.6e-169 490 49 7 527 3 purH Bifunctional purine biosynthesis protein PurH Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q3B5R1 5.64e-169 491 50 7 531 3 purH Bifunctional purine biosynthesis protein PurH Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A8MLI9 6.15e-169 490 48 9 526 3 purH Bifunctional purine biosynthesis protein PurH Alkaliphilus oremlandii (strain OhILAs)
B3PS36 7.41e-169 491 52 10 538 3 purH Bifunctional purine biosynthesis protein PurH Rhizobium etli (strain CIAT 652)
A9GIT1 2.67e-168 489 52 8 528 3 purH Bifunctional purine biosynthesis protein PurH Sorangium cellulosum (strain So ce56)
A8AUA2 2.83e-168 489 49 9 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B9DSR6 5.93e-168 488 50 9 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus uberis (strain ATCC BAA-854 / 0140J)
B2G5C2 1.04e-167 487 47 9 528 3 purH Bifunctional purine biosynthesis protein PurH Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VHU2 1.04e-167 487 47 9 528 3 purH Bifunctional purine biosynthesis protein PurH Limosilactobacillus reuteri (strain DSM 20016)
Q6G5S5 2.68e-167 487 51 11 543 3 purH Bifunctional purine biosynthesis protein PurH Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
B5E5J9 1.08e-166 485 48 9 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pneumoniae serotype 19F (strain G54)
Q38XW3 1.7e-166 484 48 8 527 3 purH Bifunctional purine biosynthesis protein PurH Latilactobacillus sakei subsp. sakei (strain 23K)
Q8DRM1 2.08e-166 484 49 9 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04N19 2.08e-166 484 49 9 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q98ES7 2.72e-166 484 51 11 540 3 purH Bifunctional purine biosynthesis protein PurH Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1MA35 2.78e-166 484 51 11 538 3 purH Bifunctional purine biosynthesis protein PurH Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P74741 4.79e-166 483 49 10 527 3 purH Bifunctional purine biosynthesis protein PurH Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
C1C9V4 6.96e-166 483 48 9 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pneumoniae (strain 70585)
Q8KFK6 9.5e-166 483 50 8 533 3 purH Bifunctional purine biosynthesis protein PurH Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
C1CNS9 9.97e-166 483 48 9 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pneumoniae (strain Taiwan19F-14)
Q97T99 9.97e-166 483 48 9 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
C1CBM7 1.06e-165 482 48 9 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pneumoniae (strain JJA)
B8ZJN3 1.06e-165 482 48 9 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1KZ55 1.88e-165 481 47 9 525 3 purH Bifunctional purine biosynthesis protein PurH Clostridium botulinum (strain Loch Maree / Type A3)
B1I7V8 1.98e-165 482 48 9 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pneumoniae (strain Hungary19A-6)
C3L2U9 2.67e-165 481 47 9 525 3 purH Bifunctional purine biosynthesis protein PurH Clostridium botulinum (strain 657 / Type Ba4)
Q1J934 2.74e-165 481 48 9 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q8P310 2.74e-165 481 48 9 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q7UKJ8 2.98e-165 481 47 7 536 3 purH Bifunctional purine biosynthesis protein PurH Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
C1CHW2 4.14e-165 481 48 9 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pneumoniae (strain P1031)
C1FV76 4.35e-165 480 47 9 525 3 purH Bifunctional purine biosynthesis protein PurH Clostridium botulinum (strain Kyoto / Type A2)
Q2RGU9 5.61e-165 480 52 7 524 3 purH Bifunctional purine biosynthesis protein PurH Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q8DWK8 6.69e-165 480 49 9 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q5XEF2 8.13e-165 480 49 9 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q03MZ6 1.03e-164 480 48 10 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
A5I5V9 1.35e-164 479 47 9 525 3 purH Bifunctional purine biosynthesis protein PurH Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXD3 1.35e-164 479 47 9 525 3 purH Bifunctional purine biosynthesis protein PurH Clostridium botulinum (strain ATCC 19397 / Type A)
Q67KG3 1.81e-164 480 48 9 545 3 purH Bifunctional purine biosynthesis protein PurH Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
P67546 2.1e-163 476 49 8 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P67545 2.1e-163 476 49 8 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus agalactiae serotype III (strain NEM316)
Q5FIV5 2.39e-163 476 46 9 529 3 purH Bifunctional purine biosynthesis protein PurH Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
A2RJY0 3.75e-163 476 48 8 528 3 purH Bifunctional purine biosynthesis protein PurH Lactococcus lactis subsp. cremoris (strain MG1363)
Q8CT27 4.08e-163 475 47 8 526 3 purH Bifunctional purine biosynthesis protein PurH Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQ97 4.08e-163 475 47 8 526 3 purH Bifunctional purine biosynthesis protein PurH Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A4VSB5 4.31e-163 476 49 10 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus suis (strain 05ZYH33)
A4VYK5 4.31e-163 476 49 10 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus suis (strain 98HAH33)
Q9F1T4 8.01e-163 475 49 10 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus suis
B3QQA5 8.41e-163 475 49 6 529 3 purH Bifunctional purine biosynthesis protein PurH Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B1IL57 1.04e-162 474 47 9 525 3 purH Bifunctional purine biosynthesis protein PurH Clostridium botulinum (strain Okra / Type B1)
Q02Y66 1.44e-162 474 47 8 528 3 purH Bifunctional purine biosynthesis protein PurH Lactococcus lactis subsp. cremoris (strain SK11)
Q89B23 1.75e-162 474 42 2 530 3 purH Bifunctional purine biosynthesis protein PurH Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q6GI11 2.25e-162 473 48 7 526 3 purH Bifunctional purine biosynthesis protein PurH Staphylococcus aureus (strain MRSA252)
Q1D898 2.37e-162 474 49 11 529 3 purH Bifunctional purine biosynthesis protein PurH Myxococcus xanthus (strain DK1622)
Q3K3Z7 2.77e-162 474 49 9 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q03E83 4.96e-162 473 46 7 527 3 purH Bifunctional purine biosynthesis protein PurH Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q2YX50 7.7e-162 472 48 7 526 3 purH Bifunctional purine biosynthesis protein PurH Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NX88 8.86e-162 471 48 7 526 3 purH Bifunctional purine biosynthesis protein PurH Staphylococcus aureus (strain MW2)
Q6GAE0 8.86e-162 471 48 7 526 3 purH Bifunctional purine biosynthesis protein PurH Staphylococcus aureus (strain MSSA476)
Q5HH11 8.86e-162 471 48 7 526 3 purH Bifunctional purine biosynthesis protein PurH Staphylococcus aureus (strain COL)
Q2FZI6 8.86e-162 471 48 7 526 3 purH Bifunctional purine biosynthesis protein PurH Staphylococcus aureus (strain NCTC 8325 / PS 47)
B7KGS0 1.11e-161 472 47 11 527 3 purH Bifunctional purine biosynthesis protein PurH Gloeothece citriformis (strain PCC 7424)
A7GH96 1.21e-161 471 47 9 525 3 purH Bifunctional purine biosynthesis protein PurH Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
P67544 1.37e-161 471 48 7 526 1 purH Bifunctional purine biosynthesis protein PurH Staphylococcus aureus (strain N315)
P67543 1.37e-161 471 48 7 526 3 purH Bifunctional purine biosynthesis protein PurH Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRW0 1.37e-161 471 48 7 526 3 purH Bifunctional purine biosynthesis protein PurH Staphylococcus aureus (strain JH9)
A6U0P1 1.37e-161 471 48 7 526 3 purH Bifunctional purine biosynthesis protein PurH Staphylococcus aureus (strain JH1)
A6QFT1 1.59e-161 471 48 7 526 3 purH Bifunctional purine biosynthesis protein PurH Staphylococcus aureus (strain Newman)
B2TN76 1.61e-161 471 47 10 524 3 purH Bifunctional purine biosynthesis protein PurH Clostridium botulinum (strain Eklund 17B / Type B)
Q3M6G3 1.63e-161 471 47 9 526 3 purH Bifunctional purine biosynthesis protein PurH Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q48VY9 1.92e-161 471 48 8 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JP34 1.92e-161 471 48 8 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JE78 1.92e-161 471 48 8 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q31R91 2.13e-161 471 47 9 528 3 purH Bifunctional purine biosynthesis protein PurH Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q1JJ80 2.33e-161 471 48 8 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q9CFG0 2.93e-161 471 47 9 528 3 purH Bifunctional purine biosynthesis protein PurH Lactococcus lactis subsp. lactis (strain IL1403)
Q8YSJ2 4.03e-161 470 46 9 526 3 purH Bifunctional purine biosynthesis protein PurH Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B9EAZ2 4.25e-161 470 48 8 527 3 purH Bifunctional purine biosynthesis protein PurH Macrococcus caseolyticus (strain JCSC5402)
P0DD61 4.43e-161 471 48 8 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DD60 4.43e-161 471 48 8 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
B5XJ20 5.68e-161 470 48 8 528 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus pyogenes serotype M49 (strain NZ131)
Q2FI05 7.08e-161 469 48 7 526 3 purH Bifunctional purine biosynthesis protein PurH Staphylococcus aureus (strain USA300)
O67775 1.3e-160 469 49 10 524 3 purH Bifunctional purine biosynthesis protein PurH Aquifex aeolicus (strain VF5)
B2V3C3 1.31e-160 469 47 10 524 3 purH Bifunctional purine biosynthesis protein PurH Clostridium botulinum (strain Alaska E43 / Type E3)
A1UR09 1.36e-160 470 50 10 544 3 purH Bifunctional purine biosynthesis protein PurH Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q88U29 8.77e-160 467 48 8 527 3 purH Bifunctional purine biosynthesis protein PurH Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q116T4 1.08e-159 467 45 8 526 3 purH Bifunctional purine biosynthesis protein PurH Trichodesmium erythraeum (strain IMS101)
Q49WJ7 4.32e-159 464 47 8 527 3 purH Bifunctional purine biosynthesis protein PurH Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8DIN5 6.3e-159 465 49 12 528 3 purH Bifunctional purine biosynthesis protein PurH Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B9DQ42 1.52e-158 463 46 8 526 3 purH Bifunctional purine biosynthesis protein PurH Staphylococcus carnosus (strain TM300)
B8HPG4 2.56e-158 463 47 9 525 3 purH Bifunctional purine biosynthesis protein PurH Cyanothece sp. (strain PCC 7425 / ATCC 29141)
B2IX54 7.42e-158 462 46 8 526 3 purH Bifunctional purine biosynthesis protein PurH Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q8REV6 7.95e-158 462 45 9 524 3 purH Bifunctional purine biosynthesis protein PurH Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
B2KCF7 1.05e-157 462 46 7 535 3 purH Bifunctional purine biosynthesis protein PurH Elusimicrobium minutum (strain Pei191)
C0MB61 1.01e-156 459 48 9 530 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus equi subsp. equi (strain 4047)
B1MY42 1.39e-156 459 47 6 526 3 purH Bifunctional purine biosynthesis protein PurH Leuconostoc citreum (strain KM20)
Q1WU55 1.89e-156 459 46 7 526 3 purH Bifunctional purine biosynthesis protein PurH Ligilactobacillus salivarius (strain UCC118)
Q8XMK2 1.06e-155 456 46 10 524 3 purH Bifunctional purine biosynthesis protein PurH Clostridium perfringens (strain 13 / Type A)
Q4L582 1.47e-155 456 46 9 526 3 purH Bifunctional purine biosynthesis protein PurH Staphylococcus haemolyticus (strain JCSC1435)
Q0TTB0 5.69e-155 454 46 10 524 3 purH Bifunctional purine biosynthesis protein PurH Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
C0MC89 1.12e-154 454 47 9 530 3 purH Bifunctional purine biosynthesis protein PurH Streptococcus equi subsp. zooepidemicus (strain H70)
Q03Y85 1.62e-154 454 46 5 525 3 purH Bifunctional purine biosynthesis protein PurH Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q0SV48 4.44e-154 452 46 10 526 3 purH Bifunctional purine biosynthesis protein PurH Clostridium perfringens (strain SM101 / Type A)
A9IZD0 5.22e-154 453 49 13 548 3 purH Bifunctional purine biosynthesis protein PurH Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q86L14 5.82e-154 453 44 12 549 1 purH Bifunctional purine biosynthesis protein purH Dictyostelium discoideum
A0Q1J0 1.26e-153 451 45 12 529 3 purH Bifunctional purine biosynthesis protein PurH Clostridium novyi (strain NT)
A6LSB3 4.21e-153 450 45 9 524 3 purH Bifunctional purine biosynthesis protein PurH Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
C0QXU6 1.89e-152 448 45 10 530 3 purH Bifunctional purine biosynthesis protein PurH Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
A9WEK8 8.47e-152 447 49 8 526 3 purH Bifunctional purine biosynthesis protein PurH Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
B0JL55 1.77e-151 446 45 10 532 3 purH Bifunctional purine biosynthesis protein PurH Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A9BIX9 3.51e-151 445 44 9 527 3 purH Bifunctional purine biosynthesis protein PurH Petrotoga mobilis (strain DSM 10674 / SJ95)
A5N0Q0 5.89e-151 444 46 11 528 3 purH Bifunctional purine biosynthesis protein PurH Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E4K6 5.89e-151 444 46 11 528 3 purH Bifunctional purine biosynthesis protein PurH Clostridium kluyveri (strain NBRC 12016)
B0BZH9 1.07e-150 444 46 9 537 3 purH Bifunctional purine biosynthesis protein PurH Acaryochloris marina (strain MBIC 11017)
A1VZU4 1.11e-149 441 46 12 534 3 purH Bifunctional purine biosynthesis protein PurH Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9PNY2 1.11e-149 441 46 12 534 1 purH Bifunctional purine biosynthesis protein PurH Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A2C098 1.16e-149 441 45 13 540 3 purH Bifunctional purine biosynthesis protein PurH Prochlorococcus marinus (strain NATL1A)
Q46HA8 2.09e-149 441 44 13 540 3 purH Bifunctional purine biosynthesis protein PurH Prochlorococcus marinus (strain NATL2A)
A7ZCZ7 4.08e-149 440 47 11 529 3 purH Bifunctional purine biosynthesis protein PurH Campylobacter concisus (strain 13826)
A8FM07 1.73e-148 438 45 11 532 3 purH Bifunctional purine biosynthesis protein PurH Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q97J91 3.17e-148 437 45 12 528 3 purH Bifunctional purine biosynthesis protein PurH Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q7TUG1 3.18e-148 438 45 11 534 3 purH Bifunctional purine biosynthesis protein PurH Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q7VDS0 7.57e-148 437 44 11 536 3 purH Bifunctional purine biosynthesis protein PurH Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q892X3 1.2e-147 436 44 12 528 3 purH Bifunctional purine biosynthesis protein PurH Clostridium tetani (strain Massachusetts / E88)
A7H375 1.22e-147 436 45 12 534 3 purH Bifunctional purine biosynthesis protein PurH Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q5HUK6 1.45e-147 436 45 12 533 3 purH Bifunctional purine biosynthesis protein PurH Campylobacter jejuni (strain RM1221)
A2BUP7 2.67e-147 436 46 13 536 3 purH Bifunctional purine biosynthesis protein PurH Prochlorococcus marinus (strain MIT 9515)
A9BDN8 4.44e-147 435 44 11 538 3 purH Bifunctional purine biosynthesis protein PurH Prochlorococcus marinus (strain MIT 9211)
Q3B083 1.08e-146 434 45 11 542 3 purH Bifunctional purine biosynthesis protein PurH Synechococcus sp. (strain CC9902)
A5GIF4 7.77e-146 432 45 12 540 3 purH Bifunctional purine biosynthesis protein PurH Synechococcus sp. (strain WH7803)
A8G2S6 3.64e-145 430 45 12 534 3 purH Bifunctional purine biosynthesis protein PurH Prochlorococcus marinus (strain MIT 9215)
Q9RW01 4.1e-145 430 45 12 534 3 purH Bifunctional purine biosynthesis protein PurH Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A2BP65 1.32e-144 429 46 12 534 3 purH Bifunctional purine biosynthesis protein PurH Prochlorococcus marinus (strain AS9601)
C1CWJ7 5.54e-144 427 44 11 530 3 purH Bifunctional purine biosynthesis protein PurH Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
Q3AN13 2.61e-143 426 44 12 541 3 purH Bifunctional purine biosynthesis protein PurH Synechococcus sp. (strain CC9605)
Q0IDE8 2.13e-142 423 44 9 534 3 purH Bifunctional purine biosynthesis protein PurH Synechococcus sp. (strain CC9311)
A4QCK4 2.14e-142 423 44 11 531 3 purH Bifunctional purine biosynthesis protein PurH Corynebacterium glutamicum (strain R)
Q31CR6 2.16e-142 423 45 12 534 3 purH Bifunctional purine biosynthesis protein PurH Prochlorococcus marinus (strain MIT 9312)
A3PAY7 3.8e-142 422 45 12 534 3 purH Bifunctional purine biosynthesis protein PurH Prochlorococcus marinus (strain MIT 9301)
A7GYY6 4.11e-142 422 44 10 527 3 purH Bifunctional purine biosynthesis protein PurH Campylobacter curvus (strain 525.92)
Q1J119 4.72e-142 422 45 11 534 3 purH Bifunctional purine biosynthesis protein PurH Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q8NS21 4.82e-142 422 44 10 531 3 purH Bifunctional purine biosynthesis protein PurH Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8FR29 1.15e-141 421 43 11 531 3 purH Bifunctional purine biosynthesis protein PurH Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q04EU6 1.69e-140 418 43 6 526 3 purH Bifunctional purine biosynthesis protein PurH Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
A2CCK6 7.66e-139 414 43 10 534 3 purH Bifunctional purine biosynthesis protein PurH Prochlorococcus marinus (strain MIT 9303)
Q6NID8 2.86e-138 413 43 11 534 3 purH Bifunctional purine biosynthesis protein PurH Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q9RAJ5 1.12e-137 411 43 10 531 3 purH Bifunctional purine biosynthesis protein PurH Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A1SMP8 1.6e-137 411 43 11 536 3 purH Bifunctional purine biosynthesis protein PurH Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q7TUM7 1.68e-137 410 43 12 539 3 purH Bifunctional purine biosynthesis protein PurH Prochlorococcus marinus (strain MIT 9313)
Q9KY50 6.1e-136 407 44 11 533 3 purH Bifunctional purine biosynthesis protein PurH Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q18CW0 1.02e-135 405 41 11 528 3 purH Bifunctional purine biosynthesis protein PurH Clostridioides difficile (strain 630)
B2HEC3 2.47e-135 405 42 11 531 3 purH Bifunctional purine biosynthesis protein PurH Mycobacterium marinum (strain ATCC BAA-535 / M)
B2A5W1 3.88e-135 404 41 6 526 3 purH Bifunctional purine biosynthesis protein PurH Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q7TTX6 2.6e-134 402 43 10 532 3 purH Bifunctional purine biosynthesis protein PurH Parasynechococcus marenigrum (strain WH8102)
A0PWC5 5.95e-134 402 42 11 531 3 purH Bifunctional purine biosynthesis protein PurH Mycobacterium ulcerans (strain Agy99)
Q1B3W0 3.18e-132 397 41 10 531 3 purH Bifunctional purine biosynthesis protein PurH Mycobacterium sp. (strain MCS)
A1UL88 3.18e-132 397 41 10 531 3 purH Bifunctional purine biosynthesis protein PurH Mycobacterium sp. (strain KMS)
P9WHM7 4.42e-132 397 41 10 531 1 purH Bifunctional purine biosynthesis protein PurH Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHM6 4.42e-132 397 41 10 531 3 purH Bifunctional purine biosynthesis protein PurH Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U0Z7 4.42e-132 397 41 10 531 3 purH Bifunctional purine biosynthesis protein PurH Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1ALU3 4.42e-132 397 41 10 531 3 purH Bifunctional purine biosynthesis protein PurH Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KH91 4.42e-132 397 41 10 531 3 purH Bifunctional purine biosynthesis protein PurH Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P67542 4.42e-132 397 41 10 531 3 purH Bifunctional purine biosynthesis protein PurH Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A3Q5N7 5.01e-132 397 41 10 531 3 purH Bifunctional purine biosynthesis protein PurH Mycobacterium sp. (strain JLS)
Q6AD62 3.03e-128 387 44 10 527 3 purH Bifunctional purine biosynthesis protein PurH Leifsonia xyli subsp. xyli (strain CTCB07)
Q9Z5H5 3.05e-127 384 40 11 531 3 purH Bifunctional purine biosynthesis protein PurH Mycobacterium leprae (strain TN)
B8ZU05 3.05e-127 384 40 11 531 3 purH Bifunctional purine biosynthesis protein PurH Mycobacterium leprae (strain Br4923)
Q8A155 6.13e-127 383 42 10 532 3 purH Bifunctional purine biosynthesis protein PurH Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q6A6Y8 4.05e-123 374 40 10 541 3 purH Bifunctional purine biosynthesis protein PurH Cutibacterium acnes (strain DSM 16379 / KPA171202)
B3DRY6 6.66e-123 374 44 12 547 3 purH Bifunctional purine biosynthesis protein PurH Bifidobacterium longum (strain DJO10A)
C3PF03 1.45e-122 372 42 11 534 3 purH Bifunctional purine biosynthesis protein PurH Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
Q8G6B1 3.91e-122 372 44 13 548 3 purH Bifunctional purine biosynthesis protein PurH Bifidobacterium longum (strain NCC 2705)
Q9RHX6 7.8e-122 370 43 11 534 3 purH Bifunctional purine biosynthesis protein PurH Corynebacterium ammoniagenes
P31335 1.13e-90 292 33 15 611 1 ATIC Bifunctional purine biosynthesis protein ATIC Gallus gallus
Q9CWJ9 2.93e-90 291 33 14 618 1 Atic Bifunctional purine biosynthesis protein ATIC Mus musculus
O35567 1.07e-88 287 34 15 612 1 Atic Bifunctional purine biosynthesis protein ATIC Rattus norvegicus
P54113 1.05e-84 276 32 14 615 1 ADE16 Bifunctional purine biosynthesis protein ADE16 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P31939 2.35e-84 276 33 15 618 1 ATIC Bifunctional purine biosynthesis protein ATIC Homo sapiens
Q5R5C2 1.01e-83 274 33 14 618 2 ATIC Bifunctional purine biosynthesis protein ATIC Pongo abelii
Q9X0X6 7e-81 262 34 13 525 1 purH Bifunctional purine biosynthesis protein PurH Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q0VCK0 2.43e-80 265 37 12 488 2 ATIC Bifunctional purine biosynthesis protein ATIC Bos taurus
Q0VCK0 9.89e-08 58 46 0 58 2 ATIC Bifunctional purine biosynthesis protein ATIC Bos taurus
P38009 1.77e-78 260 35 12 485 1 ADE17 Bifunctional purine biosynthesis protein ADE17 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P38009 0.00011 48 33 0 63 1 ADE17 Bifunctional purine biosynthesis protein ADE17 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
J9VJP1 1.82e-77 258 35 12 480 1 ADE16 Bifunctional purine biosynthesis protein ADE16 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
J9VJP1 2.74e-09 63 47 0 63 1 ADE16 Bifunctional purine biosynthesis protein ADE16 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
O74928 2.2e-70 239 34 11 479 2 ade10 Bifunctional purine biosynthesis protein ade10 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O74928 1.29e-05 51 48 0 56 2 ade10 Bifunctional purine biosynthesis protein ade10 Schizosaccharomyces pombe (strain 972 / ATCC 24843)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS13670
Feature type CDS
Gene purH
Product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
Location 3038234 - 3039823 (strand: 1)
Length 1590 (nucleotides) / 529 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2338
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01808 AICARFT/IMPCHase bienzyme
PF02142 MGS-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0138 Nucleotide transport and metabolism (F) F AICAR transformylase/IMP cyclohydrolase PurH

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00602 phosphoribosylaminoimidazolecarboxamide formyltransferase / IMP cyclohydrolase [EC:2.1.2.3 3.5.4.10] Purine metabolism
One carbon pool by folate
Metabolic pathways
Biosynthesis of secondary metabolites
Antifolate resistance
De novo purine biosynthesis, PRPP + glutamine => IMP

Protein Sequence

MQHLRPIRRALLSVSDKAGILEFAKALVERNVELLSTGGTARLLAEAGLPVIEVSDYTGFPEMMDGRVKTLHPKVHGGILGRRGQDDTIMEEHDIRPIDMVVVNLYPFAKTVAHPDCSLADAVENIDIGGPTMVRSAAKNHKDVTIVVNSNDYEKVIEEMDNHQNSLTLDTRFDLAIKAFEHTAAYDSMIANYFGQKVAPYYGDTSQPSGTFPRTLNLNYIKKQDMRYGENAHQQAAFYIEENIEEASIATANQLQGKALSYNNIADTDAALECVKSFSEPACVIVKHANPCGVAIADTLTQAYDNAFKTDPTSAFGGIIAFNRSLDAKTASAVIERQFVEVIIAPSINEDALPILATKPNVRVLACGEWQEAKPALDFKRVNGGLLVQDRDLGMVKEENLRVVTQRQPSEREWKDALFCWKVAKFVKSNAIVYAKNDMTIGIGAGQMSRVYSAKIAGIKAADEGLEVAGCAMASDAFFPFRDGIDAAAMAGVTCVIQPGGSIRDDEVIAAANEHNIAMIFTNMRHFRH

Flanking regions ( +/- flanking 50bp)

CTTTTCATCACAATGACTACTGTTATACAAAAACCCAAGGGATAAAACTCATGCAACACCTTCGTCCTATCCGCCGTGCTCTTTTAAGTGTGTCTGATAAAGCAGGTATTTTAGAATTTGCGAAAGCGCTTGTAGAAAGAAATGTAGAACTTTTATCAACAGGAGGGACAGCGCGTCTATTAGCAGAAGCTGGCTTACCCGTTATAGAAGTCTCTGACTACACCGGTTTTCCAGAAATGATGGATGGTCGTGTAAAAACACTTCACCCTAAAGTACATGGTGGTATTTTAGGACGTCGTGGACAAGATGATACCATTATGGAGGAACATGATATTCGTCCTATCGACATGGTTGTTGTCAATCTTTATCCCTTCGCTAAAACAGTAGCCCATCCCGATTGCTCATTAGCAGATGCTGTTGAGAATATTGATATTGGTGGTCCTACCATGGTTCGTTCCGCAGCAAAGAACCATAAAGACGTCACCATTGTGGTTAATAGCAATGACTATGAAAAAGTGATTGAAGAAATGGACAATCACCAAAACAGTCTGACTTTAGATACACGTTTTGATTTAGCCATTAAAGCCTTTGAGCATACCGCAGCTTATGACAGTATGATTGCGAACTACTTTGGCCAAAAAGTTGCACCTTATTATGGTGATACTTCACAACCATCAGGAACCTTCCCTCGTACCTTAAATCTTAACTATATAAAGAAACAAGATATGCGTTATGGTGAGAATGCTCATCAGCAAGCGGCTTTCTATATAGAAGAGAATATTGAAGAAGCCTCTATCGCAACAGCAAATCAATTACAAGGTAAGGCACTCTCTTATAACAATATTGCCGATACTGATGCTGCATTGGAATGCGTGAAATCATTTTCCGAACCAGCTTGTGTTATCGTGAAACATGCAAACCCTTGTGGCGTTGCTATTGCGGACACTCTCACACAAGCATATGACAATGCATTTAAAACTGATCCAACTTCTGCATTTGGCGGTATTATCGCTTTCAATAGAAGCTTAGATGCAAAAACAGCAAGTGCCGTTATAGAGCGTCAATTTGTCGAAGTCATTATCGCGCCTTCTATTAATGAAGATGCTCTACCTATTTTAGCAACCAAACCTAATGTTCGTGTATTAGCCTGTGGTGAATGGCAAGAAGCTAAACCTGCACTTGATTTCAAACGGGTTAACGGAGGCTTATTAGTACAAGATCGTGATTTAGGTATGGTTAAAGAAGAAAACCTAAGGGTTGTCACGCAACGCCAGCCTAGTGAACGAGAATGGAAAGATGCGCTATTTTGCTGGAAAGTTGCAAAATTTGTGAAATCCAACGCAATTGTGTATGCCAAAAATGACATGACGATTGGCATTGGTGCGGGCCAAATGAGCCGAGTCTATTCTGCTAAAATAGCAGGGATTAAAGCGGCTGATGAAGGTTTAGAAGTGGCAGGTTGCGCCATGGCATCTGATGCATTCTTTCCCTTTAGAGATGGTATTGATGCGGCAGCTATGGCCGGTGTAACTTGTGTTATTCAGCCAGGTGGTTCTATTCGTGATGATGAAGTAATTGCAGCAGCTAATGAACACAATATCGCGATGATTTTTACTAACATGCGTCATTTTCGCCATTAATAAGGGATTGCTATGAAAATTTTAATTATTGGTAATGGTGGTCGTGAACA