Homologs in group_1459

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09330 FBDBKF_09330 51.3 Morganella morganii S1 sctN type III secretion system ATPase SctN
EHELCC_10080 EHELCC_10080 51.3 Morganella morganii S2 sctN type III secretion system ATPase SctN
NLDBIP_10425 NLDBIP_10425 51.3 Morganella morganii S4 sctN type III secretion system ATPase SctN
LHKJJB_10930 LHKJJB_10930 51.3 Morganella morganii S3 sctN type III secretion system ATPase SctN
HKOGLL_13990 HKOGLL_13990 51.3 Morganella morganii S5 sctN type III secretion system ATPase SctN
F4V73_RS10635 F4V73_RS10635 49.2 Morganella psychrotolerans sctN type III secretion system ATPase SctN

Distribution of the homologs in the orthogroup group_1459

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1459

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A1B9 1.01e-156 452 52 1 416 1 sctN1 SPI-1 type 3 secretion system ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1C0 1.01e-156 452 52 1 416 3 sctN1 SPI-1 type 3 secretion system ATPase Salmonella typhi
P0A1C2 1.54e-143 419 49 3 423 3 sctN Type 3 secretion system ATPase Shigella sonnei
P0A1C1 1.54e-143 419 49 3 423 1 sctN Type 3 secretion system ATPase Shigella flexneri
P40291 4.49e-113 342 44 3 416 1 sctN Type 3 secretion system ATPase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q7ARI8 4.49e-113 342 44 3 416 1 sctN Type 3 secretion system ATPase Yersinia pestis
P40290 1.02e-112 341 44 3 416 1 sctN Type 3 secretion system ATPase Yersinia enterocolitica
P55717 6.76e-110 334 43 2 417 3 sctN Type 3 secretion system ATPase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P80153 2.09e-109 332 42 2 415 3 sctN Type 3 secretion system ATPase Xanthomonas euvesicatoria
P74857 4.83e-96 298 42 6 420 1 sctN2 SPI-2 type 3 secretion system ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P57178 2.71e-95 297 39 5 435 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9I4N1 1.67e-94 294 39 2 420 3 fliI Flagellum-specific ATP synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q52371 2.57e-92 289 39 7 424 1 sctN Type 3 secretion system ATPase Pseudomonas syringae pv. syringae
O83417 1.17e-90 284 37 4 428 3 fliI Flagellum-specific ATP synthase Treponema pallidum (strain Nichols)
Q887B5 3.33e-90 283 39 8 428 3 sctN Type 3 secretion system ATPase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8RK01 8.23e-90 282 39 8 428 1 sctN Type 3 secretion system ATPase Pseudomonas savastanoi pv. phaseolicola
P26465 8.74e-89 280 37 6 428 1 fliI Flagellum-specific ATP synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q89AZ7 1.37e-88 279 38 7 424 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8KA42 3.09e-88 279 39 8 425 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P52612 5.17e-87 275 38 4 424 1 fliI Flagellum-specific ATP synthase Escherichia coli (strain K12)
P23445 5.2e-87 275 38 3 417 3 fliI Flagellum-specific ATP synthase Bacillus subtilis (strain 168)
P52607 4.92e-84 267 36 6 422 3 fliI Flagellum-specific ATP synthase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q9ZJJ3 7.34e-79 253 41 3 339 3 fliI Flagellum-specific ATP synthase Helicobacter pylori (strain J99 / ATCC 700824)
O07025 4.63e-78 251 41 3 339 1 fliI Flagellum-specific ATP synthase Helicobacter pylori (strain ATCC 700392 / 26695)
O67531 1.47e-76 248 37 5 414 3 fliI Flagellum-specific ATP synthase Aquifex aeolicus (strain VF5)
O34171 7.8e-72 236 40 5 328 3 fliI Flagellum-specific ATP synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
O54249 9.03e-69 228 40 2 285 3 fliI Flagellum-specific ATP synthase Rhizobium meliloti (strain 1021)
B8H363 3.45e-62 210 37 1 296 3 fliI Flagellum-specific ATP synthase Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAT8 3.45e-62 210 37 1 296 3 fliI Flagellum-specific ATP synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B5YI24 1.03e-45 167 31 6 366 3 atpD ATP synthase subunit beta Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A5UQN3 3.16e-45 166 31 7 361 3 atpD ATP synthase subunit beta Roseiflexus sp. (strain RS-1)
Q3SF66 4.23e-45 166 30 4 354 3 atpD ATP synthase subunit beta Thiobacillus denitrificans (strain ATCC 25259)
A7NIQ9 4.92e-45 166 30 6 360 3 atpD ATP synthase subunit beta Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B8DWS2 1.13e-44 165 30 10 423 3 atpD ATP synthase subunit beta Bifidobacterium animalis subsp. lactis (strain AD011)
B8GRB8 1.84e-44 164 31 5 357 3 atpD ATP synthase subunit beta Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q8G7B3 3.67e-44 164 32 10 406 3 atpD ATP synthase subunit beta Bifidobacterium longum (strain NCC 2705)
B3DTV0 3.67e-44 164 32 10 406 3 atpD ATP synthase subunit beta Bifidobacterium longum (strain DJO10A)
B7GTZ3 4.78e-44 163 31 11 426 3 atpD ATP synthase subunit beta Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
A9AVV4 6.02e-44 162 29 10 407 3 atpD ATP synthase subunit beta Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
B8G6G6 7.32e-44 162 29 6 371 3 atpD ATP synthase subunit beta Chloroflexus aggregans (strain MD-66 / DSM 9485)
A1U7H4 7.37e-44 162 31 6 357 3 atpD ATP synthase subunit beta Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B0U598 1.09e-43 162 31 8 363 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain M12)
A1A3C5 1.38e-43 162 31 11 425 3 atpD ATP synthase subunit beta Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
A6W7G9 2.07e-43 161 33 8 343 3 atpD ATP synthase subunit beta Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q9PE85 2.11e-43 161 31 8 363 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain 9a5c)
Q4A604 2.85e-43 160 32 6 358 3 atpD ATP synthase subunit beta Mycoplasmopsis synoviae (strain 53)
Q6LKZ6 3.42e-43 160 31 6 357 3 atpD2 ATP synthase subunit beta 2 Photobacterium profundum (strain SS9)
A9NBD0 4.12e-43 160 31 5 357 3 atpD ATP synthase subunit beta Coxiella burnetii (strain RSA 331 / Henzerling II)
P42466 4.53e-43 160 29 10 407 3 atpD ATP synthase subunit beta Herpetosiphon aurantiacus
Q6FFK0 4.62e-43 160 31 7 363 3 atpD ATP synthase subunit beta Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q83AF5 5.26e-43 160 31 5 357 3 atpD ATP synthase subunit beta Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KBF7 5.26e-43 160 31 5 357 3 atpD ATP synthase subunit beta Coxiella burnetii (strain Dugway 5J108-111)
Q87E90 5.47e-43 160 30 8 363 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I877 5.47e-43 160 30 8 363 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain M23)
B1KSS8 7.42e-43 159 31 5 342 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Loch Maree / Type A3)
B9LBM0 8.46e-43 159 29 6 371 3 atpD ATP synthase subunit beta Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WGS4 8.46e-43 159 29 6 371 3 atpD ATP synthase subunit beta Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
A5EXL4 9.1e-43 159 30 5 357 3 atpD ATP synthase subunit beta Dichelobacter nodosus (strain VCS1703A)
A5HY52 1.02e-42 159 31 5 342 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
C3KYJ3 1.02e-42 159 31 5 342 3 atpD ATP synthase subunit beta Clostridium botulinum (strain 657 / Type Ba4)
A7FQH9 1.02e-42 159 31 5 342 3 atpD ATP synthase subunit beta Clostridium botulinum (strain ATCC 19397 / Type A)
B4SJR9 1.05e-42 159 30 7 363 3 atpD ATP synthase subunit beta Stenotrophomonas maltophilia (strain R551-3)
B2FHY8 1.08e-42 159 30 7 363 3 atpD ATP synthase subunit beta Stenotrophomonas maltophilia (strain K279a)
C1FQP5 1.18e-42 159 31 5 342 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Kyoto / Type A2)
Q2S6P1 1.25e-42 159 31 7 357 3 atpD ATP synthase subunit beta Hahella chejuensis (strain KCTC 2396)
A7N6Q5 2.01e-42 158 31 6 357 3 atpD2 ATP synthase subunit beta 2 Vibrio campbellii (strain ATCC BAA-1116)
A6VL57 2.52e-42 158 30 5 357 3 atpD ATP synthase subunit beta Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A4XKX0 3.27e-42 158 28 7 423 3 atpD ATP synthase subunit beta Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q4K3A9 3.32e-42 157 30 5 357 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q6A8C7 4.06e-42 158 31 7 345 3 atpD ATP synthase subunit beta Cutibacterium acnes (strain DSM 16379 / KPA171202)
B9MS68 4.57e-42 157 28 7 423 3 atpD ATP synthase subunit beta Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q82XP8 4.57e-42 157 30 4 354 3 atpD ATP synthase subunit beta Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B3R7L5 5.28e-42 157 30 5 354 3 atpD ATP synthase subunit beta Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q87TT4 5.35e-42 157 30 5 357 3 atpD ATP synthase subunit beta Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A7G9Q9 5.8e-42 157 31 5 342 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IE34 5.8e-42 157 31 5 342 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Okra / Type B1)
C5BKJ5 6.03e-42 157 31 8 364 3 atpD ATP synthase subunit beta Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q4ZL24 6.05e-42 157 30 5 357 3 atpD ATP synthase subunit beta Pseudomonas syringae pv. syringae (strain B728a)
Q3K441 6.58e-42 157 30 5 357 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain Pf0-1)
Q88BX4 6.92e-42 157 31 5 357 3 atpD ATP synthase subunit beta Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5WBA3 6.92e-42 157 31 5 357 3 atpD ATP synthase subunit beta Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q3J6N1 7.91e-42 157 30 5 357 3 atpD ATP synthase subunit beta Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q0AJB0 8.11e-42 157 30 4 354 3 atpD1 ATP synthase subunit beta 1 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A9WNC8 8.36e-42 157 32 7 346 3 atpD ATP synthase subunit beta Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
Q9HT20 9.03e-42 156 31 5 357 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DF4 9.03e-42 156 31 5 357 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V791 9.03e-42 156 31 5 357 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain LESB58)
A6VF32 9.03e-42 156 31 5 357 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain PA7)
B1XSD4 9.09e-42 157 29 5 380 3 atpD ATP synthase subunit beta Polynucleobacter necessarius subsp. necessarius (strain STIR1)
A4SUT4 9.09e-42 157 30 5 354 3 atpD ATP synthase subunit beta Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A6W3S8 9.12e-42 156 31 5 357 3 atpD2 ATP synthase subunit beta 2 Marinomonas sp. (strain MWYL1)
Q31DM0 9.58e-42 156 29 5 365 3 atpD ATP synthase subunit beta Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q0K5M7 1.01e-41 156 30 6 357 3 atpD ATP synthase subunit beta Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q5WSG8 1.06e-41 156 30 5 357 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Lens)
Q5ZRA1 1.06e-41 156 30 5 357 3 atpD ATP synthase subunit beta Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5III3 1.06e-41 156 30 5 357 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Corby)
Q5X0P3 1.06e-41 156 30 5 357 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Paris)
Q48BG5 1.15e-41 156 30 5 357 3 atpD ATP synthase subunit beta Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B1JFU1 1.18e-41 156 30 5 357 3 atpD ATP synthase subunit beta Pseudomonas putida (strain W619)
C3K1E6 1.29e-41 156 30 5 357 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain SBW25)
B0THN2 1.35e-41 156 30 7 377 3 atpD ATP synthase subunit beta Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A4Y187 1.39e-41 156 30 5 357 3 atpD ATP synthase subunit beta Pseudomonas mendocina (strain ymp)
C1D5G2 1.47e-41 156 31 5 356 3 atpD ATP synthase subunit beta Laribacter hongkongensis (strain HLHK9)
B0KRA8 1.55e-41 156 31 5 357 3 atpD ATP synthase subunit beta Pseudomonas putida (strain GB-1)
Q5P4E2 1.64e-41 156 30 6 356 3 atpD ATP synthase subunit beta Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A1WZT1 1.9e-41 155 31 5 357 3 atpD ATP synthase subunit beta Halorhodospira halophila (strain DSM 244 / SL1)
A0Q2Z4 1.91e-41 155 31 5 357 3 atpD ATP synthase subunit beta Clostridium novyi (strain NT)
Q8RC15 2.09e-41 155 30 6 343 3 atpD ATP synthase subunit beta Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q0A4M8 2.13e-41 155 31 5 357 3 atpD ATP synthase subunit beta Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A3DIM9 2.16e-41 155 30 7 365 3 atpD ATP synthase subunit beta Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A4VS62 2.2e-41 155 30 5 357 3 atpD ATP synthase subunit beta Stutzerimonas stutzeri (strain A1501)
Q65Q07 2.36e-41 155 31 5 357 3 atpD ATP synthase subunit beta Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q2YCA3 2.4e-41 155 30 4 355 3 atpD1 ATP synthase subunit beta 1 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q8RGE2 2.58e-41 155 31 7 372 1 atpD ATP synthase subunit beta Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
B0VBP3 2.64e-41 155 30 7 363 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AYE)
A3M144 2.64e-41 155 30 7 363 1 atpD ATP synthase subunit beta Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VNK4 2.64e-41 155 30 7 363 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain SDF)
B2I102 2.64e-41 155 30 7 363 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain ACICU)
B7I1W4 2.64e-41 155 30 7 363 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AB0057)
B7H294 2.64e-41 155 30 7 363 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AB307-0294)
C4LDW0 2.8e-41 155 31 6 357 3 atpD ATP synthase subunit beta Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q6AG58 2.89e-41 155 32 8 346 3 atpD ATP synthase subunit beta Leifsonia xyli subsp. xyli (strain CTCB07)
A5CVI6 3.13e-41 155 30 6 357 3 atpD ATP synthase subunit beta Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q5QZI6 3.14e-41 155 29 5 357 3 atpD ATP synthase subunit beta Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q60CR4 3.49e-41 155 30 6 357 3 atpD ATP synthase subunit beta Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B8D6S7 3.58e-41 155 31 7 364 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57124 3.58e-41 155 31 7 364 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8H3 3.58e-41 155 31 7 364 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q3BP15 4.57e-41 155 30 7 363 3 atpD ATP synthase subunit beta Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q1CSD5 6.18e-41 154 31 8 358 3 atpD ATP synthase subunit beta Helicobacter pylori (strain HPAG1)
Q0I5X3 6.57e-41 154 30 5 357 3 atpD ATP synthase subunit beta Histophilus somni (strain 129Pt)
Q2RFX9 1.01e-40 154 30 8 373 1 atpD ATP synthase subunit beta Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q9CKW1 1.15e-40 153 30 5 357 3 atpD ATP synthase subunit beta Pasteurella multocida (strain Pm70)
Q8XU76 1.18e-40 154 29 5 354 3 atpD ATP synthase subunit beta Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B6JMX2 1.37e-40 153 30 8 358 3 atpD ATP synthase subunit beta Helicobacter pylori (strain P12)
Q17Y78 1.45e-40 153 30 7 358 3 atpD ATP synthase subunit beta Helicobacter acinonychis (strain Sheeba)
B8FZ34 1.5e-40 153 29 7 366 3 atpD ATP synthase subunit beta Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A7I177 1.5e-40 153 28 11 412 3 atpD ATP synthase subunit beta Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q1LHL0 1.52e-40 153 30 6 357 3 atpD ATP synthase subunit beta Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q24MP1 1.55e-40 153 29 7 366 3 atpD ATP synthase subunit beta Desulfitobacterium hafniense (strain Y51)
Q8KAC9 1.62e-40 153 30 7 343 3 atpD2 ATP synthase subunit beta 2 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q1QSD0 1.78e-40 153 29 5 357 3 atpD ATP synthase subunit beta Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q8PGG7 2.1e-40 153 30 7 363 3 atpD ATP synthase subunit beta Xanthomonas axonopodis pv. citri (strain 306)
B1VFY7 2.13e-40 153 30 7 366 3 atpD ATP synthase subunit beta Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
B2TK00 2.28e-40 153 30 5 342 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Eklund 17B / Type B)
Q15MU4 2.32e-40 152 29 5 357 3 atpD2 ATP synthase subunit beta 2 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
P55988 2.32e-40 153 30 8 358 3 atpD ATP synthase subunit beta Helicobacter pylori (strain ATCC 700392 / 26695)
Q8PCZ5 2.38e-40 153 30 7 363 3 atpD ATP synthase subunit beta Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UQF4 2.38e-40 153 30 7 363 3 atpD ATP synthase subunit beta Xanthomonas campestris pv. campestris (strain 8004)
Q0VKX4 2.47e-40 152 29 5 357 3 atpD ATP synthase subunit beta Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A1VFJ5 2.75e-40 152 30 7 375 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain DP4)
Q72E04 2.75e-40 152 30 7 375 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B0RWC2 2.8e-40 152 30 7 363 3 atpD ATP synthase subunit beta Xanthomonas campestris pv. campestris (strain B100)
Q5H4Y4 3.06e-40 152 30 7 363 3 atpD ATP synthase subunit beta Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SQB0 3.06e-40 152 30 7 363 3 atpD ATP synthase subunit beta Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P7Q4 3.06e-40 152 30 7 363 3 atpD ATP synthase subunit beta Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8XID4 3.33e-40 152 31 5 348 3 atpD ATP synthase subunit beta Clostridium perfringens (strain 13 / Type A)
Q0TNC4 3.33e-40 152 31 5 348 3 atpD ATP synthase subunit beta Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B2UZK0 3.39e-40 152 30 5 342 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Alaska E43 / Type E3)
Q83G91 3.56e-40 152 32 7 342 3 atpD ATP synthase subunit beta Tropheryma whipplei (strain Twist)
Q83HY0 3.56e-40 152 32 7 342 3 atpD ATP synthase subunit beta Tropheryma whipplei (strain TW08/27)
Q05FY1 3.57e-40 152 31 7 367 3 atpD ATP synthase subunit beta Carsonella ruddii (strain PV)
Q0SQZ5 3.72e-40 152 31 5 348 3 atpD ATP synthase subunit beta Clostridium perfringens (strain SM101 / Type A)
A5CQ60 4.01e-40 152 31 8 346 3 atpD ATP synthase subunit beta Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q1I2I7 4.05e-40 152 30 6 357 3 atpD ATP synthase subunit beta Pseudomonas entomophila (strain L48)
Q9Z687 4.5e-40 152 30 5 348 3 atpD ATP synthase subunit beta Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B0RED4 4.53e-40 152 31 8 346 3 atpD ATP synthase subunit beta Clavibacter sepedonicus
C4LJL4 4.69e-40 152 30 7 366 3 atpD ATP synthase subunit beta Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
A1SHJ1 4.71e-40 152 33 9 347 3 atpD ATP synthase subunit beta Nocardioides sp. (strain ATCC BAA-499 / JS614)
A0KQX8 4.9e-40 152 30 5 357 3 atpD ATP synthase subunit beta Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B0UWG5 5.3e-40 152 30 5 357 3 atpD ATP synthase subunit beta Histophilus somni (strain 2336)
B8J439 5.36e-40 152 31 7 377 3 atpD ATP synthase subunit beta Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
B3EJK9 5.37e-40 152 30 7 343 3 atpD ATP synthase subunit beta Chlorobium phaeobacteroides (strain BS1)
Q9ZK81 5.5e-40 152 31 8 346 3 atpD ATP synthase subunit beta Helicobacter pylori (strain J99 / ATCC 700824)
A5G9D8 5.54e-40 152 31 7 343 3 atpD ATP synthase subunit beta Geotalea uraniireducens (strain Rf4)
Q7VJ21 6.1e-40 152 29 8 347 3 atpD ATP synthase subunit beta Helicobacter hepaticus (strain ATCC 51449 / 3B1)
B5Z8D0 6.28e-40 152 31 8 346 3 atpD ATP synthase subunit beta Helicobacter pylori (strain G27)
C3LSI9 6.33e-40 152 29 7 365 3 atpD ATP synthase subunit beta Vibrio cholerae serotype O1 (strain M66-2)
Q9KNH5 6.33e-40 152 29 7 365 3 atpD ATP synthase subunit beta Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F459 6.33e-40 152 29 7 365 3 atpD ATP synthase subunit beta Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B3QUP6 6.51e-40 151 30 7 358 3 atpD ATP synthase subunit beta Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q12HQ1 6.69e-40 151 31 7 357 3 atpD ATP synthase subunit beta Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
P29707 7.15e-40 151 29 7 372 1 atpD ATP synthase subunit beta, sodium ion specific Propionigenium modestum
B0TWS7 7.93e-40 151 30 6 357 3 atpD ATP synthase subunit beta Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A3QJR0 8.1e-40 151 30 6 357 3 atpD ATP synthase subunit beta Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1SBU0 8.75e-40 151 30 6 357 3 atpD ATP synthase subunit beta Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q85FT2 9.03e-40 151 32 9 365 3 atpB ATP synthase subunit beta, chloroplastic Cyanidioschyzon merolae (strain NIES-3377 / 10D)
Q7MGI0 9.31e-40 151 30 8 365 3 atpD ATP synthase subunit beta Vibrio vulnificus (strain YJ016)
Q8DDG8 9.31e-40 151 30 8 365 3 atpD ATP synthase subunit beta Vibrio vulnificus (strain CMCP6)
A1R7V3 1.03e-39 151 31 7 345 3 atpD ATP synthase subunit beta Paenarthrobacter aurescens (strain TC1)
Q1MRB8 1.08e-39 151 31 7 367 3 atpD ATP synthase subunit beta Lawsonia intracellularis (strain PHE/MN1-00)
A1K1S2 1.11e-39 151 30 6 357 3 atpD ATP synthase subunit beta Azoarcus sp. (strain BH72)
Q5HX59 1.14e-39 151 30 7 345 3 atpD ATP synthase subunit beta Campylobacter jejuni (strain RM1221)
A1VXJ0 1.14e-39 151 30 7 345 3 atpD ATP synthase subunit beta Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q0PC30 1.14e-39 151 30 7 345 3 atpD ATP synthase subunit beta Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FJR2 1.14e-39 151 30 7 345 3 atpD ATP synthase subunit beta Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
P35110 1.25e-39 150 30 7 343 3 atpD ATP synthase subunit beta Chlorobium limicola
B3EDQ7 1.25e-39 150 30 7 358 3 atpD ATP synthase subunit beta Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
A1AXU2 1.27e-39 150 29 5 357 3 atpD ATP synthase subunit beta Ruthia magnifica subsp. Calyptogena magnifica
B1W0A3 1.4e-39 151 30 7 364 3 atpD ATP synthase subunit beta Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
B5YBP8 1.56e-39 150 30 9 408 3 atpD ATP synthase subunit beta Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q13SQ2 1.63e-39 150 30 6 357 3 atpD2 ATP synthase subunit beta 2 Paraburkholderia xenovorans (strain LB400)
P42470 1.69e-39 150 29 8 358 3 atpD ATP synthase subunit beta Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q8F2J5 1.78e-39 150 32 9 392 3 atpD ATP synthase subunit beta Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72SX9 1.78e-39 150 32 9 392 3 atpD ATP synthase subunit beta Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q07232 1.9e-39 150 30 5 361 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q04ZU5 1.93e-39 150 32 6 346 3 atpD ATP synthase subunit beta Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04S18 1.93e-39 150 32 6 346 3 atpD ATP synthase subunit beta Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q46VY0 2.03e-39 150 30 6 357 3 atpD ATP synthase subunit beta Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
B4RS81 2.1e-39 150 29 5 357 3 atpD ATP synthase subunit beta Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
P0A301 2.19e-39 150 29 7 357 1 atpD ATP synthase subunit beta Streptomyces lividans
P0A300 2.19e-39 150 29 7 357 3 atpD ATP synthase subunit beta Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A4STP3 2.23e-39 150 29 5 357 3 atpD ATP synthase subunit beta Aeromonas salmonicida (strain A449)
Q2KU36 2.31e-39 150 30 6 357 3 atpD ATP synthase subunit beta Bordetella avium (strain 197N)
B9KES3 2.31e-39 150 30 7 343 3 atpD ATP synthase subunit beta Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q0SGP9 2.54e-39 150 31 7 346 3 atpD ATP synthase subunit beta Rhodococcus jostii (strain RHA1)
A2S6J8 2.73e-39 150 29 5 354 3 atpD ATP synthase subunit beta Burkholderia mallei (strain NCTC 10229)
Q2STE9 3.06e-39 150 29 5 354 1 atpD1 ATP synthase subunit beta 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63PI0 3.06e-39 150 29 5 354 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain K96243)
A3NF40 3.06e-39 150 29 5 354 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain 668)
Q3JXV8 3.06e-39 150 29 5 354 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain 1710b)
A3P0Z0 3.06e-39 150 29 5 354 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain 1106a)
A1V8T1 3.06e-39 150 29 5 354 3 atpD1 ATP synthase subunit beta 1 Burkholderia mallei (strain SAVP1)
Q62FR5 3.06e-39 150 29 5 354 3 atpD1 ATP synthase subunit beta 1 Burkholderia mallei (strain ATCC 23344)
A3MQJ9 3.06e-39 150 29 5 354 3 atpD1 ATP synthase subunit beta 1 Burkholderia mallei (strain NCTC 10247)
C1AVZ9 3.27e-39 150 31 7 346 3 atpD ATP synthase subunit beta Rhodococcus opacus (strain B4)
Q7W3B0 3.39e-39 149 29 6 357 3 atpD ATP synthase subunit beta Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WEM9 3.39e-39 149 29 6 357 3 atpD ATP synthase subunit beta Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VU44 3.42e-39 149 29 6 357 3 atpD ATP synthase subunit beta Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
B8DYT0 3.47e-39 149 30 10 409 3 atpD ATP synthase subunit beta Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
A0LLF8 3.52e-39 149 30 7 352 3 atpD ATP synthase subunit beta Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A7H1I1 3.71e-39 150 30 7 345 3 atpD ATP synthase subunit beta Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
B6EHG4 3.93e-39 149 29 7 365 3 atpD ATP synthase subunit beta Aliivibrio salmonicida (strain LFI1238)
A0RR26 4.08e-39 149 30 7 342 3 atpD ATP synthase subunit beta Campylobacter fetus subsp. fetus (strain 82-40)
B8F774 4.52e-39 149 29 5 357 3 atpD ATP synthase subunit beta Glaesserella parasuis serovar 5 (strain SH0165)
Q3A605 4.84e-39 149 30 7 360 3 atpD1 ATP synthase subunit beta 1 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A1BCJ2 5.01e-39 149 29 7 358 3 atpD ATP synthase subunit beta Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A2SC70 5.08e-39 149 29 7 364 3 atpD ATP synthase subunit beta Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q39KX6 5.12e-39 149 29 5 354 3 atpD ATP synthase subunit beta Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q50331 5.19e-39 149 30 7 358 3 atpD ATP synthase subunit beta Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
A4JA35 5.5e-39 149 29 5 354 3 atpD ATP synthase subunit beta Burkholderia vietnamiensis (strain G4 / LMG 22486)
B1YQL4 5.5e-39 149 29 5 354 3 atpD ATP synthase subunit beta Burkholderia ambifaria (strain MC40-6)
A9HY42 5.57e-39 149 31 7 358 3 atpD ATP synthase subunit beta Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A4SC45 5.95e-39 149 29 7 358 3 atpD ATP synthase subunit beta Chlorobium phaeovibrioides (strain DSM 265 / 1930)
B4RJG0 6.06e-39 149 29 12 418 3 atpD ATP synthase subunit beta Neisseria gonorrhoeae (strain NCCP11945)
Q5F4Z0 6.06e-39 149 29 12 418 3 atpD ATP synthase subunit beta Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q0HPG1 6.5e-39 149 30 6 357 3 atpD ATP synthase subunit beta Shewanella sp. (strain MR-7)
Q0HD79 6.56e-39 149 30 6 357 3 atpD ATP synthase subunit beta Shewanella sp. (strain MR-4)
Q1GXN0 7.28e-39 149 30 6 357 3 atpD ATP synthase subunit beta Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A1TD55 7.47e-39 149 29 8 372 3 atpD ATP synthase subunit beta Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P12986 7.9e-39 149 30 8 365 1 atpD ATP synthase subunit beta Vibrio alginolyticus
B8HAY9 7.91e-39 149 31 7 342 3 atpD ATP synthase subunit beta Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
Q39ZU1 8.11e-39 149 30 7 360 3 atpD3 ATP synthase subunit beta 3 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q21DK8 8.37e-39 149 30 8 365 3 atpD ATP synthase subunit beta Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A7N0Y1 8.83e-39 149 30 8 365 3 atpD1 ATP synthase subunit beta 1 Vibrio campbellii (strain ATCC BAA-1116)
A9KK92 9e-39 149 31 7 358 3 atpD ATP synthase subunit beta Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A0R200 9.05e-39 149 30 8 364 1 atpD ATP synthase subunit beta Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
B0TQF4 9.55e-39 148 30 7 357 3 atpD ATP synthase subunit beta Shewanella halifaxensis (strain HAW-EB4)
A9NGW2 1.03e-38 148 31 8 347 3 atpD ATP synthase subunit beta Acholeplasma laidlawii (strain PG-8A)
Q89B39 1.05e-38 148 31 7 364 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B8DRD2 1.15e-38 148 31 7 352 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q0BJL5 1.15e-38 148 29 5 354 3 atpD ATP synthase subunit beta Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A6QB59 1.17e-38 148 29 7 348 3 atpD ATP synthase subunit beta Sulfurovum sp. (strain NBC37-1)
A9AJG4 1.18e-38 148 29 5 354 3 atpD ATP synthase subunit beta Burkholderia multivorans (strain ATCC 17616 / 249)
C3PFR5 1.28e-38 148 30 7 366 3 atpD ATP synthase subunit beta Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
B8I579 1.32e-38 148 29 7 358 3 atpD ATP synthase subunit beta Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
C1A1X8 1.41e-38 148 30 7 366 3 atpD ATP synthase subunit beta Rhodococcus erythropolis (strain PR4 / NBRC 100887)
B5FCZ1 1.45e-38 148 30 8 365 3 atpD ATP synthase subunit beta Aliivibrio fischeri (strain MJ11)
Q3B6W8 1.5e-38 148 30 7 358 3 atpD1 ATP synthase subunit beta 1 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
C5BF40 1.54e-38 147 31 7 357 3 atpD ATP synthase subunit beta Edwardsiella ictaluri (strain 93-146)
Q313W0 1.6e-38 148 29 7 366 3 atpD ATP synthase subunit beta Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q9JW70 1.6e-38 148 29 12 418 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A0L2S8 1.65e-38 147 29 6 357 3 atpD ATP synthase subunit beta Shewanella sp. (strain ANA-3)
Q5E1N7 1.83e-38 147 30 8 365 3 atpD ATP synthase subunit beta Aliivibrio fischeri (strain ATCC 700601 / ES114)
B1KQ34 1.92e-38 147 30 6 357 3 atpD ATP synthase subunit beta Shewanella woodyi (strain ATCC 51908 / MS32)
P50002 2.03e-38 147 30 7 356 1 atpD ATP synthase subunit beta, sodium ion specific Acetobacterium woodii (strain ATCC 29683 / DSM 1030 / JCM 2381 / KCTC 1655 / WB1)
A8ZUA1 2.31e-38 147 29 7 366 3 atpD ATP synthase subunit beta Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
A0Q8D9 2.4e-38 147 29 6 357 3 atpD ATP synthase subunit beta Francisella tularensis subsp. novicida (strain U112)
A5WBW1 2.44e-38 147 30 9 370 3 atpD ATP synthase subunit beta Psychrobacter sp. (strain PRwf-1)
B4EEY9 2.49e-38 147 29 5 354 3 atpD ATP synthase subunit beta Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q74GY0 2.52e-38 147 30 7 343 3 atpD ATP synthase subunit beta Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A1KW11 2.53e-38 147 29 12 418 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M123 2.53e-38 147 29 12 418 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup C (strain 053442)
Q8E8C0 2.57e-38 147 29 6 357 3 atpD ATP synthase subunit beta Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q87KA8 2.83e-38 147 30 8 365 3 atpD ATP synthase subunit beta Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A1RQB0 2.91e-38 147 30 6 357 3 atpD ATP synthase subunit beta Shewanella sp. (strain W3-18-1)
A4YCH8 2.91e-38 147 30 6 357 3 atpD ATP synthase subunit beta Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
P47639 2.91e-38 147 30 6 358 3 atpD ATP synthase subunit beta Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q39Q56 2.99e-38 147 31 7 343 3 atpD ATP synthase subunit beta Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q1BRB0 3.08e-38 147 29 5 354 3 atpD ATP synthase subunit beta Burkholderia orbicola (strain AU 1054)
B1JSV7 3.08e-38 147 29 5 354 3 atpD ATP synthase subunit beta Burkholderia orbicola (strain MC0-3)
A0K2Y3 3.08e-38 147 29 5 354 3 atpD ATP synthase subunit beta Burkholderia cenocepacia (strain HI2424)
A5UGY9 3.1e-38 147 29 5 357 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain PittGG)
P33253 3.5e-38 147 29 7 367 3 atpD ATP synthase subunit beta Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q0P3P2 3.5e-38 147 29 7 375 3 atpB ATP synthase subunit beta, chloroplastic Ostreococcus tauri
Q6AQ10 3.61e-38 147 28 6 366 3 atpD ATP synthase subunit beta Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q4JUK0 3.61e-38 147 31 7 346 3 atpD ATP synthase subunit beta Corynebacterium jeikeium (strain K411)
A4IW24 3.75e-38 147 29 6 357 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NIK3 3.75e-38 147 29 6 357 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14K06 3.75e-38 147 29 6 357 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain FSC 198)
B4F0E7 3.75e-38 147 30 7 358 3 atpD ATP synthase subunit beta Proteus mirabilis (strain HI4320)
Q9JXQ2 4.06e-38 147 29 12 418 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q5Z0Y1 4.1e-38 147 30 7 366 3 atpD ATP synthase subunit beta Nocardia farcinica (strain IFM 10152)
P42465 4.24e-38 146 29 8 364 3 atpD ATP synthase subunit beta Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
A5N3H7 4.34e-38 146 29 6 347 3 atpD ATP synthase subunit beta Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
Q98QU5 4.51e-38 147 31 8 365 3 atpD1 ATP synthase subunit beta 1 Mycoplasmopsis pulmonis (strain UAB CTIP)
P41168 4.71e-38 146 28 10 419 3 atpD ATP synthase subunit beta Acidithiobacillus ferridurans
A5UA11 4.8e-38 146 29 5 357 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain PittEE)
B3PIS7 4.81e-38 146 29 6 357 3 atpD ATP synthase subunit beta Cellvibrio japonicus (strain Ueda107)
P43715 5.47e-38 146 29 5 357 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QN64 5.47e-38 146 29 5 357 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain 86-028NP)
B9LZ84 6.07e-38 146 30 7 343 3 atpD ATP synthase subunit beta Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A8HAG3 6.47e-38 146 29 6 357 3 atpD ATP synthase subunit beta Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B8CVU5 6.81e-38 146 29 6 357 3 atpD ATP synthase subunit beta Shewanella piezotolerans (strain WP3 / JCM 13877)
Q0BK84 6.88e-38 146 29 6 357 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1I2 6.88e-38 146 29 6 357 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain LVS)
A7NEH4 6.88e-38 146 29 6 357 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A9BPU7 7.39e-38 146 29 9 385 3 atpD ATP synthase subunit beta Delftia acidovorans (strain DSM 14801 / SPH-1)
P42467 7.52e-38 145 29 7 365 3 atpD ATP synthase subunit beta (Fragment) Peptococcus niger
A6LQH6 7.67e-38 146 29 6 358 3 atpD ATP synthase subunit beta Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A4XAW2 7.71e-38 146 30 9 370 3 atpD ATP synthase subunit beta Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
P06541 8.33e-38 146 32 9 365 1 atpB ATP synthase subunit beta, chloroplastic Chlamydomonas reinhardtii
A9KX06 8.49e-38 145 30 6 357 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS195)
A6WUJ0 8.49e-38 145 30 6 357 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS185)
A3DAR4 8.49e-38 145 30 6 357 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EDV0 8.49e-38 145 30 6 357 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS223)
A4GAG9 8.54e-38 145 29 8 364 3 atpD ATP synthase subunit beta Herminiimonas arsenicoxydans
A0JY64 8.71e-38 146 30 7 342 3 atpD ATP synthase subunit beta Arthrobacter sp. (strain FB24)
P9WPU5 8.97e-38 146 30 7 349 1 atpD ATP synthase subunit beta Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU4 8.97e-38 146 30 7 349 3 atpD ATP synthase subunit beta Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U209 8.97e-38 146 30 7 349 3 atpD ATP synthase subunit beta Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AMV4 8.97e-38 146 30 7 349 3 atpD ATP synthase subunit beta Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KI98 8.97e-38 146 30 7 349 3 atpD ATP synthase subunit beta Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P63678 8.97e-38 146 30 7 349 3 atpD ATP synthase subunit beta Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A4J999 9.18e-38 146 28 7 366 3 atpD ATP synthase subunit beta Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A7ZC37 9.69e-38 145 29 7 358 3 atpD ATP synthase subunit beta Campylobacter concisus (strain 13826)
Q30QQ1 1.22e-37 145 29 7 343 3 atpD ATP synthase subunit beta Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q5M5J1 1.23e-37 145 29 10 382 3 atpD ATP synthase subunit beta Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q3IK50 1.24e-37 145 29 5 357 3 atpD ATP synthase subunit beta Pseudoalteromonas translucida (strain TAC 125)
Q4A8V9 1.31e-37 145 28 10 419 3 atpD ATP synthase subunit beta Mesomycoplasma hyopneumoniae (strain 7448)
A0PUK0 1.36e-37 145 30 7 352 3 atpD ATP synthase subunit beta Mycobacterium ulcerans (strain Agy99)
B2HQK2 1.36e-37 145 30 7 352 3 atpD ATP synthase subunit beta Mycobacterium marinum (strain ATCC BAA-535 / M)
Q8D3J3 1.41e-37 145 30 6 358 3 atpD ATP synthase subunit beta Wigglesworthia glossinidia brevipalpis
Q4AAV7 1.42e-37 145 28 10 418 3 atpD ATP synthase subunit beta Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
A4QDH3 1.43e-37 145 30 8 362 3 atpD ATP synthase subunit beta Corynebacterium glutamicum (strain R)
B2SEY1 1.44e-37 145 29 6 357 3 atpD ATP synthase subunit beta Francisella tularensis subsp. mediasiatica (strain FSC147)
P42464 1.48e-37 145 30 8 362 3 atpD ATP synthase subunit beta Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q6MAK5 1.57e-37 145 29 11 418 3 atpA ATP synthase subunit alpha Protochlamydia amoebophila (strain UWE25)
Q2ST34 1.65e-37 145 29 6 355 3 atpD ATP synthase subunit beta Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q73X59 1.7e-37 145 29 7 349 3 atpD ATP synthase subunit beta Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q03LX3 1.71e-37 145 29 10 382 3 atpD ATP synthase subunit beta Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M104 1.71e-37 145 29 10 382 3 atpD ATP synthase subunit beta Streptococcus thermophilus (strain CNRZ 1066)
A0QCX8 1.73e-37 145 29 7 349 3 atpD ATP synthase subunit beta Mycobacterium avium (strain 104)
Q82J84 1.78e-37 145 29 7 357 3 atpD ATP synthase subunit beta Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A6T470 1.8e-37 145 29 7 364 3 atpD ATP synthase subunit beta Janthinobacterium sp. (strain Marseille)
Q07VU4 2.1e-37 145 29 6 357 3 atpD1 ATP synthase subunit beta 1 Shewanella frigidimarina (strain NCIMB 400)
B4SAN6 2.18e-37 144 29 7 358 3 atpD ATP synthase subunit beta Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q1LTV4 2.19e-37 144 31 6 357 3 atpD ATP synthase subunit beta Baumannia cicadellinicola subsp. Homalodisca coagulata
A1W2T7 2.27e-37 145 29 8 364 3 atpD ATP synthase subunit beta Acidovorax sp. (strain JS42)
B9MBA3 2.46e-37 144 29 8 364 3 atpD ATP synthase subunit beta Acidovorax ebreus (strain TPSY)
Q7P095 2.47e-37 144 30 7 363 3 atpD ATP synthase subunit beta Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B9K814 2.51e-37 144 29 10 399 3 atpB V-type ATP synthase beta chain Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q3AP13 2.56e-37 144 29 7 358 3 atpD ATP synthase subunit beta Chlorobium chlorochromatii (strain CaD3)
Q601Z5 2.68e-37 144 28 10 419 3 atpD ATP synthase subunit beta Mesomycoplasma hyopneumoniae (strain 232)
B5RFW3 2.75e-37 144 30 7 357 3 atpD ATP synthase subunit beta Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q6MS94 2.79e-37 144 29 6 357 3 atpD ATP synthase subunit beta Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
A8G1W5 3e-37 144 29 6 357 3 atpD ATP synthase subunit beta Shewanella sediminis (strain HAW-EB3)
A8M2J3 3.07e-37 144 30 9 370 3 atpD ATP synthase subunit beta Salinispora arenicola (strain CNS-205)
A0LSL6 3.57e-37 144 31 7 347 3 atpD ATP synthase subunit beta Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q6NHS9 3.73e-37 144 29 7 366 3 atpD ATP synthase subunit beta Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
P95789 4.04e-37 144 29 8 364 3 atpD ATP synthase subunit beta Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A7H017 4.1e-37 144 29 7 358 3 atpD ATP synthase subunit beta Campylobacter curvus (strain 525.92)
Q7VPP0 4.13e-37 144 29 7 364 3 atpD ATP synthase subunit beta Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B3H2P3 4.25e-37 144 29 7 364 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N2U4 4.25e-37 144 29 7 364 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A4T8K2 4.32e-37 144 29 8 372 3 atpD ATP synthase subunit beta Mycolicibacterium gilvum (strain PYR-GCK)
Q6CYJ5 4.37e-37 144 30 7 357 3 atpD ATP synthase subunit beta Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B0BRX2 4.52e-37 144 29 7 364 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q1AVH9 5.17e-37 144 29 7 360 3 atpD ATP synthase subunit beta Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q7NA94 5.34e-37 144 30 8 358 3 atpD ATP synthase subunit beta Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1ALL7 5.43e-37 144 31 7 358 3 atpD1 ATP synthase subunit beta 1 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q2NQ86 5.51e-37 143 30 8 358 3 atpD ATP synthase subunit beta Sodalis glossinidius (strain morsitans)
Q3A083 6.09e-37 144 30 6 359 3 atpD2 ATP synthase subunit beta 2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
O50292 6.39e-37 144 29 9 391 3 atpD ATP synthase subunit beta Aquifex pyrophilus
Q477Z1 7.02e-37 143 31 7 357 3 atpD ATP synthase subunit beta Dechloromonas aromatica (strain RCB)
A1JTC6 7.84e-37 143 30 7 357 3 atpD ATP synthase subunit beta Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8DP44 8.16e-37 143 29 8 366 1 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97PT6 8.16e-37 143 29 8 366 3 atpD ATP synthase subunit beta Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZLA9 8.16e-37 143 29 8 366 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1ICS9 8.16e-37 143 29 8 366 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain Hungary19A-6)
Q04HT9 8.16e-37 143 29 8 366 3 atpD ATP synthase subunit beta Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A1AP52 8.37e-37 143 30 7 358 3 atpD2 ATP synthase subunit beta 2 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q19V65 8.38e-37 143 32 12 373 3 atpB ATP synthase subunit beta, chloroplastic Chlorokybus atmophyticus
Q0AEJ6 8.81e-37 143 27 8 414 3 atpD2 ATP synthase subunit beta 2 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q2GD08 9.01e-37 143 27 11 418 3 atpD ATP synthase subunit beta Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
A1TJ41 9.19e-37 143 29 8 364 3 atpD ATP synthase subunit beta Paracidovorax citrulli (strain AAC00-1)
Q4FP38 9.2e-37 143 30 8 364 3 atpD ATP synthase subunit beta Pelagibacter ubique (strain HTCC1062)
P42468 9.45e-37 143 29 6 354 3 atpD ATP synthase subunit beta Burkholderia cepacia
Q2LR05 9.54e-37 143 29 7 372 3 atpD ATP synthase subunit beta Syntrophus aciditrophicus (strain SB)
B5EFI7 9.59e-37 143 30 7 346 3 atpD ATP synthase subunit beta Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q8FQ20 1.02e-36 143 29 7 366 3 atpD ATP synthase subunit beta Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
A6Q4C0 1.05e-36 143 29 8 346 3 atpD ATP synthase subunit beta Nitratiruptor sp. (strain SB155-2)
Q1CX36 1.06e-36 143 29 7 365 3 atpD ATP synthase subunit beta Myxococcus xanthus (strain DK1622)
Q8EWY8 1.09e-36 146 30 6 366 3 atpD ATP synthase subunit beta Malacoplasma penetrans (strain HF-2)
B8FGT4 1.24e-36 142 29 7 366 3 atpD ATP synthase subunit beta Desulfatibacillum aliphaticivorans
Q2JX57 1.25e-36 143 30 7 358 3 atpD ATP synthase subunit beta Synechococcus sp. (strain JA-3-3Ab)
Q6LLG8 1.3e-36 142 29 8 364 3 atpD1 ATP synthase subunit beta 1 Photobacterium profundum (strain SS9)
Q9CES0 1.3e-36 142 28 9 388 3 atpD ATP synthase subunit beta Lactococcus lactis subsp. lactis (strain IL1403)
B0SLC8 1.32e-36 142 29 8 366 3 atpD ATP synthase subunit beta Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SDA5 1.32e-36 142 29 8 366 3 atpD ATP synthase subunit beta Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
A8ACN6 1.34e-36 142 30 7 357 3 atpD ATP synthase subunit beta Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C1CLK6 1.36e-36 142 29 8 366 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain P1031)
C1CF93 1.36e-36 142 29 8 366 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain JJA)
B2IQX0 1.36e-36 142 29 8 366 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain CGSP14)
C1C899 1.36e-36 142 29 8 366 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain 70585)
C1CSC8 1.41e-36 142 29 8 366 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain Taiwan19F-14)
A4VVJ9 1.42e-36 142 29 8 365 3 atpD ATP synthase subunit beta Streptococcus suis (strain 05ZYH33)
A4W1V7 1.42e-36 142 29 8 365 3 atpD ATP synthase subunit beta Streptococcus suis (strain 98HAH33)
B5Y831 1.48e-36 142 29 7 342 3 atpD ATP synthase subunit beta Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
Q3YVN6 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Shigella sonnei (strain Ss046)
P0ABB7 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Shigella flexneri
Q0SYU4 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Shigella flexneri serotype 5b (strain 8401)
Q31UN2 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Shigella boydii serotype 4 (strain Sb227)
B2TUP3 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LK77 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R4K2 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli (strain UTI89 / UPEC)
B1LL59 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli (strain SMS-3-5 / SECEC)
B6I3W9 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli (strain SE11)
B7NF48 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0ABB4 1.49e-36 142 30 7 357 1 atpD ATP synthase subunit beta Escherichia coli (strain K12)
B1IX06 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0ABB5 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAX7 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHR4 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli O1:K1 / APEC
B1X9W0 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli (strain K12 / DH10B)
C4ZZ10 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli (strain K12 / MC4100 / BW2952)
B7M588 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli O8 (strain IAI1)
B7N2H1 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli O81 (strain ED1a)
B7NR34 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YXD6 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ABB6 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli O157:H7
B7L882 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli (strain 55989 / EAEC)
B7MGF2 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMJ7 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZTU4 1.49e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli O139:H28 (strain E24377A / ETEC)
Q7CPE2 1.52e-36 142 30 7 357 3 atpD ATP synthase subunit beta Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XGX4 1.52e-36 142 30 7 357 3 atpD ATP synthase subunit beta Salmonella typhi
B4TN31 1.52e-36 142 30 7 357 3 atpD ATP synthase subunit beta Salmonella schwarzengrund (strain CVM19633)
C0Q2N2 1.52e-36 142 30 7 357 3 atpD ATP synthase subunit beta Salmonella paratyphi C (strain RKS4594)
A9MXA6 1.52e-36 142 30 7 357 3 atpD ATP synthase subunit beta Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SYD1 1.52e-36 142 30 7 357 3 atpD ATP synthase subunit beta Salmonella newport (strain SL254)
B4TAX2 1.52e-36 142 30 7 357 3 atpD ATP synthase subunit beta Salmonella heidelberg (strain SL476)
B5QUS4 1.52e-36 142 30 7 357 3 atpD ATP synthase subunit beta Salmonella enteritidis PT4 (strain P125109)
B5FN33 1.52e-36 142 30 7 357 3 atpD ATP synthase subunit beta Salmonella dublin (strain CT_02021853)
Q57HX9 1.52e-36 142 30 7 357 3 atpD ATP synthase subunit beta Salmonella choleraesuis (strain SC-B67)
A9MJR9 1.52e-36 142 30 7 357 3 atpD ATP synthase subunit beta Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5EYZ6 1.52e-36 142 30 7 357 3 atpD ATP synthase subunit beta Salmonella agona (strain SL483)
Q329S1 1.57e-36 142 30 7 357 3 atpD ATP synthase subunit beta Shigella dysenteriae serotype 1 (strain Sd197)
B5BIN6 1.6e-36 142 30 7 357 3 atpD ATP synthase subunit beta Salmonella paratyphi A (strain AKU_12601)
Q5PKX2 1.6e-36 142 30 7 357 3 atpD ATP synthase subunit beta Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q02XA5 1.78e-36 142 28 8 388 3 atpD ATP synthase subunit beta Lactococcus lactis subsp. cremoris (strain SK11)
Q6B8S4 1.79e-36 142 31 8 365 3 atpB ATP synthase subunit beta, chloroplastic Gracilaria tenuistipitata var. liui
B9IRT7 1.88e-36 142 29 8 364 3 atpD ATP synthase subunit beta Bacillus cereus (strain Q1)
B7HY64 1.88e-36 142 29 8 364 3 atpD ATP synthase subunit beta Bacillus cereus (strain AH187)
Q72XE8 1.88e-36 142 29 8 364 3 atpD ATP synthase subunit beta Bacillus cereus (strain ATCC 10987 / NRS 248)
A2RMI2 1.89e-36 142 28 8 388 3 atpD ATP synthase subunit beta Lactococcus lactis subsp. cremoris (strain MG1363)
A8A6J5 1.96e-36 142 30 7 357 3 atpD ATP synthase subunit beta Escherichia coli O9:H4 (strain HS)
Q07YM7 2.03e-36 142 30 7 356 3 atpD2 ATP synthase subunit beta 2 Shewanella frigidimarina (strain NCIMB 400)
Q0AUD3 2.05e-36 142 29 6 349 3 atpD ATP synthase subunit beta Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
O67828 2.22e-36 142 29 8 388 3 atpD ATP synthase subunit beta Aquifex aeolicus (strain VF5)
B9L7Y7 2.28e-36 142 27 12 418 3 atpD ATP synthase subunit beta Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
B2VCA4 2.3e-36 142 31 7 331 3 atpD ATP synthase subunit beta Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q9TL34 2.5e-36 142 31 8 365 3 atpB ATP synthase subunit beta, chloroplastic Nephroselmis olivacea
A8L3W5 2.54e-36 142 30 8 366 3 atpD ATP synthase subunit beta Parafrankia sp. (strain EAN1pec)
Q8KDL4 2.55e-36 142 30 7 345 3 atpD1 ATP synthase subunit beta 1 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q2JIV9 2.75e-36 142 30 6 358 3 atpD ATP synthase subunit beta Synechococcus sp. (strain JA-2-3B'a(2-13))
A9F3R4 2.83e-36 142 30 8 370 3 atpD ATP synthase subunit beta Sorangium cellulosum (strain So ce56)
C5D990 2.99e-36 142 29 8 364 3 atpD ATP synthase subunit beta Geobacillus sp. (strain WCH70)
A6VWP9 3.01e-36 142 30 7 356 3 atpD1 ATP synthase subunit beta 1 Marinomonas sp. (strain MWYL1)
Q6HAY0 3.35e-36 141 28 9 395 3 atpD ATP synthase subunit beta Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q630U3 3.35e-36 141 28 9 395 3 atpD ATP synthase subunit beta Bacillus cereus (strain ZK / E33L)
C1F0M8 3.35e-36 141 28 9 395 3 atpD ATP synthase subunit beta Bacillus cereus (strain 03BB102)
Q81JZ5 3.35e-36 141 28 9 395 3 atpD ATP synthase subunit beta Bacillus anthracis
A0RL95 3.35e-36 141 28 9 395 3 atpD ATP synthase subunit beta Bacillus thuringiensis (strain Al Hakam)
C3LFH9 3.35e-36 141 28 9 395 3 atpD ATP synthase subunit beta Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P1F4 3.35e-36 141 28 9 395 3 atpD ATP synthase subunit beta Bacillus anthracis (strain A0248)
A0LDA0 3.39e-36 141 30 9 365 3 atpD ATP synthase subunit beta Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B7JGN0 3.49e-36 141 28 9 395 3 atpD ATP synthase subunit beta Bacillus cereus (strain AH820)
A6TG36 3.51e-36 141 29 7 357 3 atpD ATP synthase subunit beta Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q8E5U8 3.58e-36 141 29 8 358 3 atpD ATP synthase subunit beta Streptococcus agalactiae serotype III (strain NEM316)
Q47M82 3.66e-36 141 30 7 346 3 atpD ATP synthase subunit beta Thermobifida fusca (strain YX)
B1I6J7 4.03e-36 141 29 7 375 3 atpD ATP synthase subunit beta Desulforudis audaxviator (strain MP104C)
Q8E072 4.03e-36 141 29 8 358 3 atpD ATP synthase subunit beta Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3K1J5 4.03e-36 141 29 8 358 3 atpD ATP synthase subunit beta Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q7VQV6 4.29e-36 141 30 6 357 3 atpD ATP synthase subunit beta Blochmanniella floridana
A3CM14 4.37e-36 141 28 7 364 3 atpD ATP synthase subunit beta Streptococcus sanguinis (strain SK36)
A4WGF5 4.56e-36 141 29 7 357 3 atpD ATP synthase subunit beta Enterobacter sp. (strain 638)
B1JRN2 4.61e-36 141 30 7 357 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q663Q8 4.61e-36 141 30 7 357 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TSJ3 4.61e-36 141 30 7 357 3 atpD ATP synthase subunit beta Yersinia pestis (strain Pestoides F)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS13265
Feature type CDS
Gene sctN
Product type III secretion system ATPase SctN
Location 2943068 - 2944366 (strand: -1)
Length 1299 (nucleotides) / 432 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1459
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00006 ATP synthase alpha/beta family, nucleotide-binding domain
PF18269 T3SS EscN ATPase C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1157 Cell motility (N)
Intracellular trafficking, secretion, and vesicular transport (U)		 NU Flagellar biosynthesis/type III secretory pathway ATPase FliI

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K22506 type III secretion system ATPase [EC:7.4.2.8] - -

Protein Sequence

MNARFLMFHNAAHPLRIQGNILEVMLRDVFIGEVCQLKENIFSENILGEAIVIGFHNNIAILSMMGSAQGYSLQIIVEPTGKTFSVALGPHILGSMIDSKGNCLLRFNTEIAEKTFSTLCPIEGRPPLFSDRLPITTLFKSGIRAIDGLLSCGLGQRMGIFASAGTGKTMLMNMIIRFAQADVFVIGLIGERGREVTEFIEELKQHKRCENTVLICSTSEQSAVERCNAALVATTVAEYFRQQGKNVVLFIDSMTRYCRALRDIALTAGELPVRKGYPASVFDKLPAILERPGVTKTGSITAFYTVLLESDDEPDAIGEEIRSILDGHIYLSRKIAASGHYPAIDVLGSVSRVFQQVTDSKQQKSALKIRQILMRLQDVKLLQELGEYHEGDNELNDIAVRKQAKIESFLTQSFKEKADFQQTLEQMYEITA

Flanking regions ( +/- flanking 50bp)

ACTATTTTCAAATTATGAATAGTATACATCAACGGTTTATTGGCTAAATAATGAACGCCAGATTTCTAATGTTTCATAACGCAGCGCATCCTTTACGAATACAAGGAAATATTTTAGAAGTGATGTTACGTGATGTTTTTATTGGGGAGGTCTGCCAACTAAAAGAGAATATTTTCAGTGAAAATATTCTCGGTGAAGCTATTGTTATTGGGTTTCATAATAACATAGCAATATTAAGTATGATGGGAAGCGCTCAAGGTTACTCTTTACAAATTATAGTTGAGCCAACAGGAAAAACATTTTCAGTTGCCCTAGGCCCACATATATTAGGCAGCATGATTGATAGTAAAGGGAATTGCTTATTACGATTTAATACAGAAATAGCAGAGAAGACCTTTAGTACCTTATGTCCTATCGAAGGTCGGCCACCTTTGTTTAGTGATAGGCTGCCTATTACAACACTATTTAAGTCAGGTATACGTGCTATTGATGGATTATTAAGTTGTGGATTGGGGCAACGAATGGGGATTTTTGCTAGTGCAGGAACGGGTAAAACGATGTTAATGAATATGATTATCCGTTTTGCACAGGCAGATGTTTTTGTTATTGGCTTGATTGGTGAACGAGGAAGAGAAGTTACAGAGTTTATTGAAGAATTAAAGCAACATAAGCGATGTGAAAATACGGTTTTAATTTGCTCAACTTCAGAACAATCAGCGGTAGAAAGGTGTAATGCGGCTTTAGTGGCAACAACGGTTGCCGAATATTTTCGTCAACAAGGAAAAAATGTCGTTTTATTTATTGATTCTATGACTCGTTATTGTCGAGCGTTAAGGGATATCGCATTAACAGCGGGTGAGTTGCCCGTACGTAAAGGATATCCAGCATCTGTATTTGATAAACTTCCCGCTATTTTAGAGCGTCCAGGGGTAACAAAAACAGGCTCCATTACGGCATTTTATACTGTTTTATTAGAGAGTGATGATGAGCCAGATGCGATCGGTGAAGAAATTCGTTCTATTTTAGATGGACATATTTATTTATCTCGAAAAATAGCAGCATCAGGGCACTATCCTGCTATTGATGTATTAGGTAGTGTGAGTCGGGTTTTTCAACAAGTCACTGATAGTAAACAACAAAAATCTGCTTTAAAAATAAGACAAATATTGATGCGATTACAAGATGTTAAGTTATTGCAAGAGTTAGGAGAATATCATGAAGGAGATAACGAATTAAATGATATCGCGGTAAGAAAACAAGCCAAGATAGAAAGCTTTCTTACTCAATCCTTTAAAGAAAAAGCCGATTTTCAACAAACATTAGAACAAATGTATGAGATTACCGCTTAAGCATCAAGCATTGATTAGTGCCATTGCCCAACGGCAAAAAAAAATAGAAA