Homologs in group_431

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09330 FBDBKF_09330 100.0 Morganella morganii S1 sctN type III secretion system ATPase SctN
NLDBIP_10425 NLDBIP_10425 100.0 Morganella morganii S4 sctN type III secretion system ATPase SctN
LHKJJB_10930 LHKJJB_10930 100.0 Morganella morganii S3 sctN type III secretion system ATPase SctN
HKOGLL_13990 HKOGLL_13990 100.0 Morganella morganii S5 sctN type III secretion system ATPase SctN
F4V73_RS10635 F4V73_RS10635 80.9 Morganella psychrotolerans sctN type III secretion system ATPase SctN
PMI_RS13265 PMI_RS13265 51.3 Proteus mirabilis HI4320 sctN type III secretion system ATPase SctN

Distribution of the homologs in the orthogroup group_431

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_431

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A1B9 3.18e-154 446 53 1 417 1 sctN1 SPI-1 type 3 secretion system ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1C0 3.18e-154 446 53 1 417 3 sctN1 SPI-1 type 3 secretion system ATPase Salmonella typhi
P0A1C2 2.09e-142 416 53 4 408 3 sctN Type 3 secretion system ATPase Shigella sonnei
P0A1C1 2.09e-142 416 53 4 408 1 sctN Type 3 secretion system ATPase Shigella flexneri
P40291 2.09e-119 358 45 3 426 1 sctN Type 3 secretion system ATPase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q7ARI8 2.09e-119 358 45 3 426 1 sctN Type 3 secretion system ATPase Yersinia pestis
P40290 2.96e-119 357 45 3 426 1 sctN Type 3 secretion system ATPase Yersinia enterocolitica
P80153 5.33e-110 334 44 5 424 3 sctN Type 3 secretion system ATPase Xanthomonas euvesicatoria
P55717 2.66e-103 317 42 3 413 3 sctN Type 3 secretion system ATPase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P23445 4.65e-98 303 41 5 419 3 fliI Flagellum-specific ATP synthase Bacillus subtilis (strain 168)
P74857 4.07e-94 293 42 4 413 1 sctN2 SPI-2 type 3 secretion system ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8RK01 4.79e-93 290 41 2 409 1 sctN Type 3 secretion system ATPase Pseudomonas savastanoi pv. phaseolicola
Q887B5 5.34e-93 290 41 2 409 3 sctN Type 3 secretion system ATPase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q52371 2.41e-92 289 41 2 417 1 sctN Type 3 secretion system ATPase Pseudomonas syringae pv. syringae
Q9I4N1 7.03e-92 288 40 5 418 3 fliI Flagellum-specific ATP synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8KA42 6.04e-89 280 39 5 413 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
O83417 1.06e-88 279 38 2 415 3 fliI Flagellum-specific ATP synthase Treponema pallidum (strain Nichols)
P57178 1.92e-83 266 37 4 410 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P26465 2.91e-83 265 40 4 404 1 fliI Flagellum-specific ATP synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q89AZ7 4.05e-83 265 38 6 415 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P52612 8.57e-82 262 39 4 421 1 fliI Flagellum-specific ATP synthase Escherichia coli (strain K12)
O67531 8.31e-79 253 35 5 419 3 fliI Flagellum-specific ATP synthase Aquifex aeolicus (strain VF5)
P52607 1.18e-72 237 34 3 403 3 fliI Flagellum-specific ATP synthase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
O07025 4.54e-71 233 45 2 284 1 fliI Flagellum-specific ATP synthase Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZJJ3 6.19e-71 233 42 2 302 3 fliI Flagellum-specific ATP synthase Helicobacter pylori (strain J99 / ATCC 700824)
O34171 1.14e-70 233 42 2 304 3 fliI Flagellum-specific ATP synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
O54249 2.67e-70 232 42 2 306 3 fliI Flagellum-specific ATP synthase Rhizobium meliloti (strain 1021)
B8H363 3.1e-69 229 35 6 399 3 fliI Flagellum-specific ATP synthase Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAT8 3.1e-69 229 35 6 399 3 fliI Flagellum-specific ATP synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B8GRB8 9.41e-44 162 31 4 327 3 atpD ATP synthase subunit beta Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A1WZT1 6.69e-43 159 31 7 357 3 atpD ATP synthase subunit beta Halorhodospira halophila (strain DSM 244 / SL1)
B8CVU5 1.04e-42 159 32 3 325 3 atpD ATP synthase subunit beta Shewanella piezotolerans (strain WP3 / JCM 13877)
B4RS81 1.91e-42 158 32 6 355 3 atpD ATP synthase subunit beta Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A8HAG3 3.02e-42 157 32 3 325 3 atpD ATP synthase subunit beta Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A5EXL4 3.92e-42 157 32 8 357 3 atpD ATP synthase subunit beta Dichelobacter nodosus (strain VCS1703A)
A3QJR0 3.98e-42 157 31 7 383 3 atpD ATP synthase subunit beta Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q12HQ1 6.61e-42 157 31 6 383 3 atpD ATP synthase subunit beta Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B1KQ34 9.3e-42 156 32 3 325 3 atpD ATP synthase subunit beta Shewanella woodyi (strain ATCC 51908 / MS32)
A6W3S8 9.78e-42 156 31 7 378 3 atpD2 ATP synthase subunit beta 2 Marinomonas sp. (strain MWYL1)
A8G1W5 1.01e-41 156 32 3 325 3 atpD ATP synthase subunit beta Shewanella sediminis (strain HAW-EB3)
B0TQF4 1.15e-41 156 32 3 325 3 atpD ATP synthase subunit beta Shewanella halifaxensis (strain HAW-EB4)
C4LDW0 1.2e-41 156 31 7 378 3 atpD ATP synthase subunit beta Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q3SF66 1.34e-41 156 30 6 355 3 atpD ATP synthase subunit beta Thiobacillus denitrificans (strain ATCC 25259)
Q15MU4 1.88e-41 155 32 7 357 3 atpD2 ATP synthase subunit beta 2 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A9NBD0 2e-41 155 31 6 355 3 atpD ATP synthase subunit beta Coxiella burnetii (strain RSA 331 / Henzerling II)
A6VL57 2.28e-41 155 31 4 327 3 atpD ATP synthase subunit beta Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q83AF5 2.33e-41 155 31 6 355 3 atpD ATP synthase subunit beta Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KBF7 2.33e-41 155 31 6 355 3 atpD ATP synthase subunit beta Coxiella burnetii (strain Dugway 5J108-111)
Q5QZI6 3.77e-41 155 31 7 357 3 atpD ATP synthase subunit beta Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q4K3A9 4.77e-41 154 31 7 357 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9CKW1 4.98e-41 154 31 4 327 3 atpD ATP synthase subunit beta Pasteurella multocida (strain Pm70)
Q07VU4 5.41e-41 154 31 5 355 3 atpD1 ATP synthase subunit beta 1 Shewanella frigidimarina (strain NCIMB 400)
Q3IK50 5.67e-41 154 31 6 357 3 atpD ATP synthase subunit beta Pseudoalteromonas translucida (strain TAC 125)
Q88BX4 7.54e-41 154 30 7 375 3 atpD ATP synthase subunit beta Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5WBA3 7.54e-41 154 30 7 375 3 atpD ATP synthase subunit beta Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q2YCA3 8.24e-41 154 31 6 355 3 atpD1 ATP synthase subunit beta 1 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q9HT20 1e-40 154 31 7 357 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DF4 1e-40 154 31 7 357 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V791 1e-40 154 31 7 357 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain LESB58)
A6VF32 1e-40 154 31 7 357 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain PA7)
B0KRA8 1.1e-40 153 30 7 375 3 atpD ATP synthase subunit beta Pseudomonas putida (strain GB-1)
A4VS62 1.91e-40 153 31 8 380 3 atpD ATP synthase subunit beta Stutzerimonas stutzeri (strain A1501)
Q48AW0 1.99e-40 153 31 6 355 3 atpD ATP synthase subunit beta Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A1SBU0 2.15e-40 153 32 3 325 3 atpD ATP synthase subunit beta Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q1I2I7 2.18e-40 152 30 7 375 3 atpD ATP synthase subunit beta Pseudomonas entomophila (strain L48)
Q9PE85 2.47e-40 152 31 7 361 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain 9a5c)
Q65Q07 2.59e-40 152 31 4 327 3 atpD ATP synthase subunit beta Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q87TT4 2.77e-40 152 30 7 357 3 atpD ATP synthase subunit beta Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZL24 2.83e-40 152 30 7 357 3 atpD ATP synthase subunit beta Pseudomonas syringae pv. syringae (strain B728a)
C3K1E6 2.87e-40 152 30 7 357 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain SBW25)
B0U598 2.87e-40 152 31 7 361 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain M12)
B4SJR9 3.09e-40 152 31 6 359 3 atpD ATP synthase subunit beta Stenotrophomonas maltophilia (strain R551-3)
C5BKJ5 3.47e-40 152 30 7 362 3 atpD ATP synthase subunit beta Teredinibacter turnerae (strain ATCC 39867 / T7901)
B1JFU1 3.48e-40 152 30 7 357 3 atpD ATP synthase subunit beta Pseudomonas putida (strain W619)
A1U7H4 3.81e-40 152 31 8 378 3 atpD ATP synthase subunit beta Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A5CVI6 4.08e-40 152 31 5 353 3 atpD ATP synthase subunit beta Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A0L2S8 4.36e-40 152 31 5 353 3 atpD ATP synthase subunit beta Shewanella sp. (strain ANA-3)
Q87E90 4.54e-40 152 31 4 331 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I877 4.54e-40 152 31 4 331 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain M23)
Q7MGI0 4.66e-40 152 30 7 352 3 atpD ATP synthase subunit beta Vibrio vulnificus (strain YJ016)
Q8DDG8 4.66e-40 152 30 7 352 3 atpD ATP synthase subunit beta Vibrio vulnificus (strain CMCP6)
Q3K441 4.67e-40 152 31 7 357 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain Pf0-1)
Q31DM0 4.75e-40 152 30 6 360 3 atpD ATP synthase subunit beta Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q4A604 4.81e-40 152 29 9 408 3 atpD ATP synthase subunit beta Mycoplasmopsis synoviae (strain 53)
Q48BG5 5.26e-40 152 30 7 357 3 atpD ATP synthase subunit beta Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q3BP15 6.17e-40 152 30 6 359 3 atpD ATP synthase subunit beta Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q3J6N1 6.81e-40 151 31 7 357 3 atpD ATP synthase subunit beta Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q8E8C0 6.82e-40 151 31 3 325 3 atpD ATP synthase subunit beta Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A4Y187 7.31e-40 151 31 4 327 3 atpD ATP synthase subunit beta Pseudomonas mendocina (strain ymp)
B2FHY8 7.56e-40 151 31 6 359 3 atpD ATP synthase subunit beta Stenotrophomonas maltophilia (strain K279a)
Q0HD79 9.07e-40 151 31 3 325 3 atpD ATP synthase subunit beta Shewanella sp. (strain MR-4)
Q2S6P1 9.49e-40 151 32 6 355 3 atpD ATP synthase subunit beta Hahella chejuensis (strain KCTC 2396)
B6EHG4 9.69e-40 151 29 7 363 3 atpD ATP synthase subunit beta Aliivibrio salmonicida (strain LFI1238)
Q0HPG1 1.05e-39 151 31 3 325 3 atpD ATP synthase subunit beta Shewanella sp. (strain MR-7)
Q8DP44 1.06e-39 151 30 6 352 1 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97PT6 1.06e-39 151 30 6 352 3 atpD ATP synthase subunit beta Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZLA9 1.06e-39 151 30 6 352 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1ICS9 1.06e-39 151 30 6 352 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain Hungary19A-6)
Q04HT9 1.06e-39 151 30 6 352 3 atpD ATP synthase subunit beta Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A9KX06 1.13e-39 151 31 3 325 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS195)
A6WUJ0 1.13e-39 151 31 3 325 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS185)
A3DAR4 1.13e-39 151 31 3 325 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EDV0 1.13e-39 151 31 3 325 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS223)
Q8PGG7 1.16e-39 151 30 6 359 3 atpD ATP synthase subunit beta Xanthomonas axonopodis pv. citri (strain 306)
A5UQN3 1.54e-39 150 32 5 317 3 atpD ATP synthase subunit beta Roseiflexus sp. (strain RS-1)
B5FCZ1 1.76e-39 150 29 7 363 3 atpD ATP synthase subunit beta Aliivibrio fischeri (strain MJ11)
P42470 1.89e-39 150 29 8 372 3 atpD ATP synthase subunit beta Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
B0RWC2 2.09e-39 150 30 6 359 3 atpD ATP synthase subunit beta Xanthomonas campestris pv. campestris (strain B100)
A1RQB0 2.13e-39 150 31 3 325 3 atpD ATP synthase subunit beta Shewanella sp. (strain W3-18-1)
A4YCH8 2.13e-39 150 31 3 325 3 atpD ATP synthase subunit beta Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
P41168 2.43e-39 150 30 4 327 3 atpD ATP synthase subunit beta Acidithiobacillus ferridurans
Q8PCZ5 2.45e-39 150 30 6 359 3 atpD ATP synthase subunit beta Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UQF4 2.45e-39 150 30 6 359 3 atpD ATP synthase subunit beta Xanthomonas campestris pv. campestris (strain 8004)
Q5E1N7 2.62e-39 150 29 7 363 3 atpD ATP synthase subunit beta Aliivibrio fischeri (strain ATCC 700601 / ES114)
A9AVV4 2.65e-39 150 30 4 327 3 atpD ATP synthase subunit beta Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
B5E670 3.64e-39 149 30 7 364 3 atpD ATP synthase subunit beta Streptococcus pneumoniae serotype 19F (strain G54)
Q6G1W9 3.67e-39 150 29 6 380 3 atpD ATP synthase subunit beta Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q0I5X3 3.73e-39 149 31 4 327 3 atpD ATP synthase subunit beta Histophilus somni (strain 129Pt)
Q9K6H5 3.96e-39 149 31 4 326 3 atpD ATP synthase subunit beta Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5H4Y4 4.07e-39 149 30 6 359 3 atpD ATP synthase subunit beta Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SQB0 4.07e-39 149 30 6 359 3 atpD ATP synthase subunit beta Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P7Q4 4.07e-39 149 30 6 359 3 atpD ATP synthase subunit beta Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A3DIM9 4.1e-39 149 33 7 302 3 atpD ATP synthase subunit beta Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
P42466 4.32e-39 149 30 4 327 3 atpD ATP synthase subunit beta Herpetosiphon aurantiacus
C1D5G2 4.42e-39 149 30 6 355 3 atpD ATP synthase subunit beta Laribacter hongkongensis (strain HLHK9)
C3LSI9 4.62e-39 149 29 8 365 3 atpD ATP synthase subunit beta Vibrio cholerae serotype O1 (strain M66-2)
Q9KNH5 4.62e-39 149 29 8 365 3 atpD ATP synthase subunit beta Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F459 4.62e-39 149 29 8 365 3 atpD ATP synthase subunit beta Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
C1CSC8 4.69e-39 149 30 6 352 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain Taiwan19F-14)
A5UGY9 5.01e-39 149 30 4 327 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain PittGG)
A7NIQ9 5.03e-39 149 31 5 317 3 atpD ATP synthase subunit beta Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B8F774 5.32e-39 149 31 4 327 3 atpD ATP synthase subunit beta Glaesserella parasuis serovar 5 (strain SH0165)
A0ALL3 5.46e-39 149 32 7 341 3 atpD2 ATP synthase subunit beta 2 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
P95789 5.52e-39 149 29 8 421 3 atpD ATP synthase subunit beta Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8Y4C1 5.74e-39 149 32 7 341 3 atpD2 ATP synthase subunit beta 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71WP9 5.74e-39 149 32 7 341 3 atpD2 ATP synthase subunit beta 2 Listeria monocytogenes serotype 4b (strain F2365)
C1CLK6 5.81e-39 149 30 6 352 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain P1031)
C1CF93 5.81e-39 149 30 6 352 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain JJA)
B2IQX0 5.81e-39 149 30 6 352 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain CGSP14)
C1C899 5.81e-39 149 30 6 352 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain 70585)
A0KQX8 7.08e-39 149 30 7 377 3 atpD ATP synthase subunit beta Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q13SQ2 7.23e-39 149 29 7 387 3 atpD2 ATP synthase subunit beta 2 Paraburkholderia xenovorans (strain LB400)
B0UWG5 7.75e-39 148 31 4 327 3 atpD ATP synthase subunit beta Histophilus somni (strain 2336)
P43715 7.75e-39 148 30 4 327 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QN64 7.75e-39 148 30 4 327 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain 86-028NP)
P55988 8e-39 149 28 6 369 3 atpD ATP synthase subunit beta Helicobacter pylori (strain ATCC 700392 / 26695)
A5UA11 8.23e-39 148 30 4 327 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain PittEE)
Q1QSD0 8.29e-39 148 31 7 357 3 atpD ATP synthase subunit beta Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A7N6Q5 8.44e-39 148 30 5 353 3 atpD2 ATP synthase subunit beta 2 Vibrio campbellii (strain ATCC BAA-1116)
Q8EM83 8.59e-39 148 33 4 288 3 atpD ATP synthase subunit beta Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q7W3B0 9.24e-39 148 30 6 376 3 atpD ATP synthase subunit beta Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WEM9 9.24e-39 148 30 6 376 3 atpD ATP synthase subunit beta Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q0A4M8 9.94e-39 148 29 7 357 3 atpD ATP synthase subunit beta Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q7VU44 1.09e-38 148 30 6 376 3 atpD ATP synthase subunit beta Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q0VKX4 1.11e-38 148 31 4 327 3 atpD ATP synthase subunit beta Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q7NA94 1.2e-38 148 30 7 357 3 atpD ATP synthase subunit beta Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B6JMX2 1.41e-38 148 28 6 369 3 atpD ATP synthase subunit beta Helicobacter pylori (strain P12)
B4RJG0 1.52e-38 148 30 7 382 3 atpD ATP synthase subunit beta Neisseria gonorrhoeae (strain NCCP11945)
Q5F4Z0 1.52e-38 148 30 7 382 3 atpD ATP synthase subunit beta Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q17Y78 1.6e-38 148 28 6 369 3 atpD ATP synthase subunit beta Helicobacter acinonychis (strain Sheeba)
B5YI24 1.63e-38 148 29 4 327 3 atpD ATP synthase subunit beta Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A9IYW6 1.71e-38 149 29 6 380 3 atpD ATP synthase subunit beta Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q2NQ86 1.72e-38 147 31 8 351 3 atpD ATP synthase subunit beta Sodalis glossinidius (strain morsitans)
Q5WSG8 1.74e-38 147 31 6 355 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Lens)
Q5ZRA1 1.74e-38 147 31 6 355 3 atpD ATP synthase subunit beta Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5III3 1.74e-38 147 31 6 355 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Corby)
Q5X0P3 1.74e-38 147 31 6 355 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Paris)
C0MH17 2.02e-38 147 31 4 319 3 atpD ATP synthase subunit beta Streptococcus equi subsp. zooepidemicus (strain H70)
B4U2E1 2.02e-38 147 31 4 319 3 atpD ATP synthase subunit beta Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C0M720 2.02e-38 147 31 4 319 3 atpD ATP synthase subunit beta Streptococcus equi subsp. equi (strain 4047)
B3PIS7 2.1e-38 147 30 8 385 3 atpD ATP synthase subunit beta Cellvibrio japonicus (strain Ueda107)
P0DA05 2.32e-38 147 30 7 353 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48UD3 2.32e-38 147 30 7 353 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JMI9 2.32e-38 147 30 7 353 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JCL3 2.32e-38 147 30 7 353 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M12 (strain MGAS2096)
P0DA04 2.32e-38 147 30 7 353 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q9A0I7 2.32e-38 147 30 7 353 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M1
Q5M5J1 2.42e-38 147 30 6 352 3 atpD ATP synthase subunit beta Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
A2RFC2 2.47e-38 147 30 7 353 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M5 (strain Manfredo)
B9LBM0 2.51e-38 147 29 4 331 3 atpD ATP synthase subunit beta Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WGS4 2.51e-38 147 29 4 331 3 atpD ATP synthase subunit beta Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
P22478 2.55e-38 147 31 8 358 3 atpD ATP synthase subunit beta Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q60CR4 2.58e-38 147 29 7 357 3 atpD ATP synthase subunit beta Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A7N0Y1 2.64e-38 147 30 7 363 3 atpD1 ATP synthase subunit beta 1 Vibrio campbellii (strain ATCC BAA-1116)
Q1J7F9 2.93e-38 147 30 7 353 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JHN5 2.93e-38 147 30 7 353 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q8P1K5 2.93e-38 147 30 7 353 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XCY0 2.93e-38 147 30 7 353 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q6LKZ6 2.96e-38 147 30 3 325 3 atpD2 ATP synthase subunit beta 2 Photobacterium profundum (strain SS9)
Q927W4 3.14e-38 147 32 7 341 3 atpD2 ATP synthase subunit beta 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A4WGF5 3.19e-38 147 31 8 351 3 atpD ATP synthase subunit beta Enterobacter sp. (strain 638)
B1XSD4 3.48e-38 147 29 6 376 3 atpD ATP synthase subunit beta Polynucleobacter necessarius subsp. necessarius (strain STIR1)
B4F0E7 3.64e-38 147 30 7 357 3 atpD ATP synthase subunit beta Proteus mirabilis (strain HI4320)
A4SUT4 3.66e-38 147 29 6 376 3 atpD ATP synthase subunit beta Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q07232 3.85e-38 147 30 4 328 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q1CSD5 4.01e-38 147 28 6 369 3 atpD ATP synthase subunit beta Helicobacter pylori (strain HPAG1)
Q7VQV6 4.08e-38 147 31 11 380 3 atpD ATP synthase subunit beta Blochmanniella floridana
Q87KA8 4.11e-38 147 30 8 365 3 atpD ATP synthase subunit beta Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A4STP3 4.16e-38 146 29 7 377 3 atpD ATP synthase subunit beta Aeromonas salmonicida (strain A449)
P43451 4.18e-38 147 29 7 419 3 atpD ATP synthase subunit beta Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
Q0AJB0 5.57e-38 146 29 7 376 3 atpD1 ATP synthase subunit beta 1 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q03LX3 5.6e-38 146 30 6 352 3 atpD ATP synthase subunit beta Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M104 5.6e-38 146 30 6 352 3 atpD ATP synthase subunit beta Streptococcus thermophilus (strain CNRZ 1066)
Q82XP8 6.1e-38 146 30 6 355 3 atpD ATP synthase subunit beta Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q6CYJ5 6.17e-38 146 30 8 380 3 atpD ATP synthase subunit beta Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9JXQ2 6.22e-38 146 31 4 331 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q6LLG8 6.26e-38 146 31 8 335 3 atpD1 ATP synthase subunit beta 1 Photobacterium profundum (strain SS9)
Q9JW70 6.41e-38 146 31 4 331 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
C6DJH2 6.42e-38 146 31 8 351 3 atpD ATP synthase subunit beta Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A1AXU2 7.14e-38 146 30 6 355 3 atpD ATP synthase subunit beta Ruthia magnifica subsp. Calyptogena magnifica
A1KW11 7.16e-38 146 31 4 331 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M123 7.16e-38 146 31 4 331 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup C (strain 053442)
Q7VPP0 7.34e-38 145 30 8 380 3 atpD ATP synthase subunit beta Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B5Z8D0 8.09e-38 146 28 6 369 3 atpD ATP synthase subunit beta Helicobacter pylori (strain G27)
A6TG36 8.61e-38 145 33 7 308 3 atpD ATP synthase subunit beta Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XZM4 8.61e-38 145 33 7 308 3 atpD ATP synthase subunit beta Klebsiella pneumoniae (strain 342)
B0BRX2 8.81e-38 145 31 4 327 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q9ZK81 8.86e-38 145 28 6 369 3 atpD ATP synthase subunit beta Helicobacter pylori (strain J99 / ATCC 700824)
B3H2P3 9.08e-38 145 31 4 327 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N2U4 9.08e-38 145 31 4 327 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q329S1 9.62e-38 145 31 8 351 3 atpD ATP synthase subunit beta Shigella dysenteriae serotype 1 (strain Sd197)
B5RFW3 9.62e-38 145 31 8 351 3 atpD ATP synthase subunit beta Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q7CPE2 9.72e-38 145 31 8 351 3 atpD ATP synthase subunit beta Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XGX4 9.72e-38 145 31 8 351 3 atpD ATP synthase subunit beta Salmonella typhi
B4TN31 9.72e-38 145 31 8 351 3 atpD ATP synthase subunit beta Salmonella schwarzengrund (strain CVM19633)
C0Q2N2 9.72e-38 145 31 8 351 3 atpD ATP synthase subunit beta Salmonella paratyphi C (strain RKS4594)
A9MXA6 9.72e-38 145 31 8 351 3 atpD ATP synthase subunit beta Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SYD1 9.72e-38 145 31 8 351 3 atpD ATP synthase subunit beta Salmonella newport (strain SL254)
B4TAX2 9.72e-38 145 31 8 351 3 atpD ATP synthase subunit beta Salmonella heidelberg (strain SL476)
B5QUS4 9.72e-38 145 31 8 351 3 atpD ATP synthase subunit beta Salmonella enteritidis PT4 (strain P125109)
B5FN33 9.72e-38 145 31 8 351 3 atpD ATP synthase subunit beta Salmonella dublin (strain CT_02021853)
Q57HX9 9.72e-38 145 31 8 351 3 atpD ATP synthase subunit beta Salmonella choleraesuis (strain SC-B67)
A9MJR9 9.72e-38 145 31 8 351 3 atpD ATP synthase subunit beta Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5EYZ6 9.72e-38 145 31 8 351 3 atpD ATP synthase subunit beta Salmonella agona (strain SL483)
A8A6J5 1.06e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli O9:H4 (strain HS)
B5BIN6 1.09e-37 145 31 8 351 3 atpD ATP synthase subunit beta Salmonella paratyphi A (strain AKU_12601)
Q5PKX2 1.09e-37 145 31 8 351 3 atpD ATP synthase subunit beta Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B2VCA4 1.09e-37 145 31 10 366 3 atpD ATP synthase subunit beta Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A8ACN6 1.09e-37 145 31 8 351 3 atpD ATP synthase subunit beta Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q3YVN6 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Shigella sonnei (strain Ss046)
P0ABB7 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Shigella flexneri
Q0SYU4 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Shigella flexneri serotype 5b (strain 8401)
Q31UN2 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Shigella boydii serotype 4 (strain Sb227)
B2TUP3 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LK77 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R4K2 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli (strain UTI89 / UPEC)
B1LL59 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli (strain SMS-3-5 / SECEC)
B6I3W9 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli (strain SE11)
B7NF48 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0ABB4 1.11e-37 145 31 8 351 1 atpD ATP synthase subunit beta Escherichia coli (strain K12)
B1IX06 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0ABB5 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAX7 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHR4 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli O1:K1 / APEC
B1X9W0 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli (strain K12 / DH10B)
C4ZZ10 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli (strain K12 / MC4100 / BW2952)
B7M588 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli O8 (strain IAI1)
B7N2H1 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli O81 (strain ED1a)
B7NR34 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YXD6 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ABB6 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli O157:H7
B7L882 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli (strain 55989 / EAEC)
B7MGF2 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMJ7 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZTU4 1.11e-37 145 31 8 351 3 atpD ATP synthase subunit beta Escherichia coli O139:H28 (strain E24377A / ETEC)
C5BF40 1.23e-37 145 32 7 328 3 atpD ATP synthase subunit beta Edwardsiella ictaluri (strain 93-146)
B0VBP3 1.28e-37 145 32 8 352 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AYE)
A3M144 1.28e-37 145 32 8 352 1 atpD ATP synthase subunit beta Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VNK4 1.28e-37 145 32 8 352 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain SDF)
B2I102 1.28e-37 145 32 8 352 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain ACICU)
B7I1W4 1.28e-37 145 32 8 352 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AB0057)
B7H294 1.28e-37 145 32 8 352 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AB307-0294)
Q1WUC6 1.37e-37 145 31 4 321 3 atpD ATP synthase subunit beta Ligilactobacillus salivarius (strain UCC118)
Q6FFK0 1.46e-37 145 30 6 348 3 atpD ATP synthase subunit beta Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A8G7M8 1.66e-37 145 32 8 328 3 atpD ATP synthase subunit beta Serratia proteamaculans (strain 568)
B9IRT7 1.73e-37 145 30 7 352 3 atpD ATP synthase subunit beta Bacillus cereus (strain Q1)
B7HY64 1.73e-37 145 30 7 352 3 atpD ATP synthase subunit beta Bacillus cereus (strain AH187)
Q72XE8 1.73e-37 145 30 7 352 3 atpD ATP synthase subunit beta Bacillus cereus (strain ATCC 10987 / NRS 248)
Q21DK8 1.73e-37 145 30 8 364 3 atpD ATP synthase subunit beta Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8XU76 1.95e-37 145 29 6 381 3 atpD ATP synthase subunit beta Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B5XKQ1 1.98e-37 145 30 7 353 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M49 (strain NZ131)
B8J439 2.03e-37 145 32 4 291 3 atpD ATP synthase subunit beta Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
A8AYG1 2.3e-37 144 30 6 352 3 atpD ATP synthase subunit beta Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B8D6S7 2.36e-37 144 30 7 358 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57124 2.36e-37 144 30 7 358 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8H3 2.36e-37 144 30 7 358 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q1LHL0 2.53e-37 144 29 6 381 3 atpD ATP synthase subunit beta Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q46VY0 2.56e-37 144 29 6 381 3 atpD ATP synthase subunit beta Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q5P4E2 2.67e-37 144 29 5 353 3 atpD ATP synthase subunit beta Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A7MMW9 2.81e-37 144 34 6 285 3 atpD ATP synthase subunit beta Cronobacter sakazakii (strain ATCC BAA-894)
A4VVJ9 2.87e-37 144 29 8 419 3 atpD ATP synthase subunit beta Streptococcus suis (strain 05ZYH33)
A4W1V7 2.87e-37 144 29 8 419 3 atpD ATP synthase subunit beta Streptococcus suis (strain 98HAH33)
Q24MP1 3e-37 144 30 5 313 3 atpD ATP synthase subunit beta Desulfitobacterium hafniense (strain Y51)
Q2KU36 3.02e-37 144 29 6 383 3 atpD ATP synthase subunit beta Bordetella avium (strain 197N)
P12986 3.53e-37 144 29 7 363 1 atpD ATP synthase subunit beta Vibrio alginolyticus
B3R7L5 3.53e-37 144 29 6 381 3 atpD ATP synthase subunit beta Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A3CM14 3.69e-37 144 30 6 352 3 atpD ATP synthase subunit beta Streptococcus sanguinis (strain SK36)
A1UR49 3.71e-37 145 29 6 380 3 atpD ATP synthase subunit beta Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
B1W0A3 3.79e-37 144 31 7 332 3 atpD ATP synthase subunit beta Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
B8G6G6 3.9e-37 144 32 3 276 3 atpD ATP synthase subunit beta Chloroflexus aggregans (strain MD-66 / DSM 9485)
A0Q8D9 3.91e-37 144 34 5 284 3 atpD ATP synthase subunit beta Francisella tularensis subsp. novicida (strain U112)
A4IW24 4.2e-37 144 35 5 284 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NIK3 4.2e-37 144 35 5 284 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14K06 4.2e-37 144 35 5 284 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain FSC 198)
A4GAG9 4.43e-37 144 31 5 331 3 atpD ATP synthase subunit beta Herminiimonas arsenicoxydans
Q1GXN0 4.63e-37 144 30 5 353 3 atpD ATP synthase subunit beta Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
B0TWS7 4.84e-37 144 31 8 357 3 atpD ATP synthase subunit beta Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B8FZ34 4.97e-37 144 30 5 313 3 atpD ATP synthase subunit beta Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q313W0 5.15e-37 144 30 7 349 3 atpD ATP synthase subunit beta Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q98QU5 5.54e-37 144 31 6 351 3 atpD1 ATP synthase subunit beta 1 Mycoplasmopsis pulmonis (strain UAB CTIP)
A2S6J8 6.32e-37 143 29 7 378 3 atpD ATP synthase subunit beta Burkholderia mallei (strain NCTC 10229)
Q2STE9 6.36e-37 143 29 7 378 1 atpD1 ATP synthase subunit beta 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63PI0 6.36e-37 143 29 7 378 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain K96243)
A3NF40 6.36e-37 143 29 7 378 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain 668)
Q3JXV8 6.36e-37 143 29 7 378 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain 1710b)
A3P0Z0 6.36e-37 143 29 7 378 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain 1106a)
A1V8T1 6.36e-37 143 29 7 378 3 atpD1 ATP synthase subunit beta 1 Burkholderia mallei (strain SAVP1)
Q62FR5 6.36e-37 143 29 7 378 3 atpD1 ATP synthase subunit beta 1 Burkholderia mallei (strain ATCC 23344)
A3MQJ9 6.36e-37 143 29 7 378 3 atpD1 ATP synthase subunit beta 1 Burkholderia mallei (strain NCTC 10247)
A9HY42 6.62e-37 143 30 5 353 3 atpD ATP synthase subunit beta Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q0K5M7 6.72e-37 143 29 6 381 3 atpD ATP synthase subunit beta Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q6FYM3 6.86e-37 144 28 6 380 3 atpD ATP synthase subunit beta Bartonella quintana (strain Toulouse)
Q494C3 7.03e-37 143 30 9 359 3 atpD ATP synthase subunit beta Blochmanniella pennsylvanica (strain BPEN)
C5D990 7.13e-37 143 33 4 282 3 atpD ATP synthase subunit beta Geobacillus sp. (strain WCH70)
P63680 7.25e-37 143 31 8 345 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain MW2)
A8YY70 7.25e-37 143 31 8 345 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain USA300 / TCH1516)
Q6G7K7 7.25e-37 143 31 8 345 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain MSSA476)
Q6GEX2 7.25e-37 143 31 8 345 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain MRSA252)
P99112 7.25e-37 143 31 8 345 1 atpD ATP synthase subunit beta Staphylococcus aureus (strain N315)
P63679 7.25e-37 143 31 8 345 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QIU7 7.25e-37 143 31 8 345 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain Newman)
Q5HE97 7.25e-37 143 31 8 345 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain COL)
Q2YUK1 7.25e-37 143 31 8 345 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IUP8 7.25e-37 143 31 8 345 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain JH9)
Q2FWF0 7.25e-37 143 31 8 345 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FF24 7.25e-37 143 31 8 345 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain USA300)
A6U3I8 7.25e-37 143 31 8 345 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain JH1)
A7X4U3 7.25e-37 143 31 8 345 3 atpD ATP synthase subunit beta Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4AAV7 7.28e-37 143 31 7 341 3 atpD ATP synthase subunit beta Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
Q4A8V9 7.5e-37 143 31 7 341 3 atpD ATP synthase subunit beta Mesomycoplasma hyopneumoniae (strain 7448)
B9KES3 7.87e-37 143 27 9 398 3 atpD ATP synthase subunit beta Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
A0LLF8 7.89e-37 143 30 5 323 3 atpD ATP synthase subunit beta Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B2SEY1 8.34e-37 143 35 5 284 3 atpD ATP synthase subunit beta Francisella tularensis subsp. mediasiatica (strain FSC147)
A5WBW1 9.07e-37 143 29 9 370 3 atpD ATP synthase subunit beta Psychrobacter sp. (strain PRwf-1)
A7G9Q9 9.46e-37 143 30 4 310 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IE34 9.46e-37 143 30 4 310 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Okra / Type B1)
A1JTC6 9.51e-37 143 31 7 328 3 atpD ATP synthase subunit beta Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8E072 9.7e-37 143 29 7 379 3 atpD ATP synthase subunit beta Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3K1J5 9.7e-37 143 29 7 379 3 atpD ATP synthase subunit beta Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8E5U8 9.9e-37 143 29 7 379 3 atpD ATP synthase subunit beta Streptococcus agalactiae serotype III (strain NEM316)
A1VFJ5 1.02e-36 143 32 4 289 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain DP4)
Q72E04 1.02e-36 143 32 4 289 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A6VWP9 1.05e-36 143 31 7 351 3 atpD1 ATP synthase subunit beta 1 Marinomonas sp. (strain MWYL1)
Q601Z5 1.06e-36 143 31 7 341 3 atpD ATP synthase subunit beta Mesomycoplasma hyopneumoniae (strain 232)
Q814W2 1.11e-36 143 30 7 352 3 atpD ATP synthase subunit beta Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HFK1 1.11e-36 143 30 7 352 3 atpD ATP synthase subunit beta Bacillus cereus (strain B4264)
Q3A083 1.14e-36 143 32 5 323 3 atpD2 ATP synthase subunit beta 2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A6Q4C0 1.24e-36 142 28 8 406 3 atpD ATP synthase subunit beta Nitratiruptor sp. (strain SB155-2)
C0Z776 1.25e-36 142 29 8 369 3 atpD ATP synthase subunit beta Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q6HAY0 1.28e-36 142 30 7 352 3 atpD ATP synthase subunit beta Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q630U3 1.28e-36 142 30 7 352 3 atpD ATP synthase subunit beta Bacillus cereus (strain ZK / E33L)
C1F0M8 1.28e-36 142 30 7 352 3 atpD ATP synthase subunit beta Bacillus cereus (strain 03BB102)
Q81JZ5 1.28e-36 142 30 7 352 3 atpD ATP synthase subunit beta Bacillus anthracis
A0RL95 1.28e-36 142 30 7 352 3 atpD ATP synthase subunit beta Bacillus thuringiensis (strain Al Hakam)
C3LFH9 1.28e-36 142 30 7 352 3 atpD ATP synthase subunit beta Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P1F4 1.28e-36 142 30 7 352 3 atpD ATP synthase subunit beta Bacillus anthracis (strain A0248)
B7JGN0 1.33e-36 142 30 7 352 3 atpD ATP synthase subunit beta Bacillus cereus (strain AH820)
B2TK00 1.37e-36 142 30 6 340 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Eklund 17B / Type B)
B7IQV8 1.56e-36 142 30 7 352 3 atpD ATP synthase subunit beta Bacillus cereus (strain G9842)
B9DRT6 1.57e-36 142 31 5 322 3 atpD ATP synthase subunit beta Streptococcus uberis (strain ATCC BAA-854 / 0140J)
A6T470 1.57e-36 142 31 5 331 3 atpD ATP synthase subunit beta Janthinobacterium sp. (strain Marseille)
A9BPU7 1.64e-36 142 29 4 332 3 atpD ATP synthase subunit beta Delftia acidovorans (strain DSM 14801 / SPH-1)
Q8KDL4 1.66e-36 142 31 6 323 3 atpD1 ATP synthase subunit beta 1 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B8DRD2 1.76e-36 142 33 4 270 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
B1JRN2 2.13e-36 142 31 10 360 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q663Q8 2.13e-36 142 31 10 360 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TSJ3 2.13e-36 142 31 10 360 3 atpD ATP synthase subunit beta Yersinia pestis (strain Pestoides F)
Q1CCH5 2.13e-36 142 31 10 360 3 atpD ATP synthase subunit beta Yersinia pestis bv. Antiqua (strain Nepal516)
A9R5T9 2.13e-36 142 31 10 360 3 atpD ATP synthase subunit beta Yersinia pestis bv. Antiqua (strain Angola)
Q7CFM8 2.13e-36 142 31 10 360 3 atpD ATP synthase subunit beta Yersinia pestis
B2K847 2.13e-36 142 31 10 360 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C095 2.13e-36 142 31 10 360 3 atpD ATP synthase subunit beta Yersinia pestis bv. Antiqua (strain Antiqua)
A7FPE0 2.13e-36 142 31 10 360 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q8D3J3 2.35e-36 142 30 4 328 3 atpD ATP synthase subunit beta Wigglesworthia glossinidia brevipalpis
P22068 2.55e-36 142 30 14 411 1 atp2 ATP synthase subunit beta, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q2LR05 2.56e-36 142 31 6 339 3 atpD ATP synthase subunit beta Syntrophus aciditrophicus (strain SB)
Q477Z1 2.57e-36 142 29 6 374 3 atpD ATP synthase subunit beta Dechloromonas aromatica (strain RCB)
Q7P095 2.64e-36 142 29 7 361 3 atpD ATP synthase subunit beta Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q4L7Y4 2.76e-36 142 30 8 346 3 atpD ATP synthase subunit beta Staphylococcus haemolyticus (strain JCSC1435)
Q2GD08 3.2e-36 141 29 5 328 3 atpD ATP synthase subunit beta Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
Q8RGE2 3.25e-36 141 31 4 321 1 atpD ATP synthase subunit beta Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8CNJ7 3.65e-36 141 31 6 319 3 atpD ATP synthase subunit beta Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HMB9 3.65e-36 141 31 6 319 3 atpD ATP synthase subunit beta Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B9E8E6 3.71e-36 141 31 6 310 3 atpD ATP synthase subunit beta Macrococcus caseolyticus (strain JCSC5402)
Q98EV8 3.88e-36 141 28 7 390 3 atpD ATP synthase subunit beta Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q49Z50 4.08e-36 141 31 9 353 3 atpD ATP synthase subunit beta Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q30QQ1 4.21e-36 141 29 7 341 3 atpD ATP synthase subunit beta Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q0BK84 4.26e-36 141 34 5 284 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1I2 4.26e-36 141 34 5 284 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain LVS)
A7NEH4 4.26e-36 141 34 5 284 3 atpD ATP synthase subunit beta Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B5Y831 4.28e-36 141 30 8 352 3 atpD ATP synthase subunit beta Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
Q2VZN2 4.5e-36 141 30 9 376 3 atpD ATP synthase subunit beta Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q6MS94 4.56e-36 141 30 7 357 3 atpD ATP synthase subunit beta Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q5WB78 4.7e-36 141 31 5 327 3 atpD ATP synthase subunit beta Shouchella clausii (strain KSM-K16)
A5HY52 4.98e-36 141 30 4 310 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
C3KYJ3 4.98e-36 141 30 4 310 3 atpD ATP synthase subunit beta Clostridium botulinum (strain 657 / Type Ba4)
A7FQH9 4.98e-36 141 30 4 310 3 atpD ATP synthase subunit beta Clostridium botulinum (strain ATCC 19397 / Type A)
Q1LTV4 4.98e-36 140 35 6 285 3 atpD ATP synthase subunit beta Baumannia cicadellinicola subsp. Homalodisca coagulata
A1VPR5 5.02e-36 141 31 5 322 3 atpD2 ATP synthase subunit beta 2 Polaromonas naphthalenivorans (strain CJ2)
B2UZK0 5.13e-36 141 30 6 340 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Alaska E43 / Type E3)
Q8G7B3 5.24e-36 141 28 8 378 3 atpD ATP synthase subunit beta Bifidobacterium longum (strain NCC 2705)
B3DTV0 5.24e-36 141 28 8 378 3 atpD ATP synthase subunit beta Bifidobacterium longum (strain DJO10A)
B8I579 5.39e-36 140 30 5 313 3 atpD ATP synthase subunit beta Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q2ST34 5.49e-36 141 34 6 286 3 atpD ATP synthase subunit beta Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
C1FQP5 5.73e-36 140 30 4 310 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Kyoto / Type A2)
B9MBA3 6.29e-36 140 30 5 332 3 atpD ATP synthase subunit beta Acidovorax ebreus (strain TPSY)
A9AJG4 6.49e-36 140 29 7 378 3 atpD ATP synthase subunit beta Burkholderia multivorans (strain ATCC 17616 / 249)
Q9CES0 6.98e-36 140 30 4 321 3 atpD ATP synthase subunit beta Lactococcus lactis subsp. lactis (strain IL1403)
A9VSA3 6.98e-36 140 30 7 352 3 atpD ATP synthase subunit beta Bacillus mycoides (strain KBAB4)
A1W2T7 7.09e-36 140 30 5 332 3 atpD ATP synthase subunit beta Acidovorax sp. (strain JS42)
A6LQH6 7.14e-36 140 30 3 310 3 atpD ATP synthase subunit beta Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A0JY64 7.8e-36 140 30 6 350 3 atpD ATP synthase subunit beta Arthrobacter sp. (strain FB24)
Q6AQ10 8.35e-36 140 29 6 367 3 atpD ATP synthase subunit beta Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q9Z687 8.42e-36 140 30 4 312 3 atpD ATP synthase subunit beta Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A1A3C5 9.01e-36 140 28 7 375 3 atpD ATP synthase subunit beta Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
A7GV56 9.13e-36 140 30 7 352 3 atpD ATP synthase subunit beta Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A4ITI9 9.31e-36 140 32 5 285 3 atpD ATP synthase subunit beta Geobacillus thermodenitrificans (strain NG80-2)
Q21CY7 9.43e-36 140 31 6 308 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain BisB18)
Q21ZA6 9.88e-36 141 32 5 297 3 atpD2 ATP synthase subunit beta 2 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q1MRB8 1e-35 140 34 4 270 3 atpD ATP synthase subunit beta Lawsonia intracellularis (strain PHE/MN1-00)
Q3Z8Z2 1.02e-35 140 33 12 327 3 atpD ATP synthase subunit beta Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q2J3I4 1.06e-35 140 31 6 308 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain HaA2)
Q04ZU5 1.12e-35 140 30 4 321 3 atpD ATP synthase subunit beta Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04S18 1.12e-35 140 30 4 321 3 atpD ATP synthase subunit beta Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
B9LZ84 1.15e-35 140 28 8 381 3 atpD ATP synthase subunit beta Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A8ZUA1 1.17e-35 140 30 7 351 3 atpD ATP synthase subunit beta Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q1GQS5 1.2e-35 140 28 9 406 3 atpD ATP synthase subunit beta Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q9LA80 1.23e-35 140 32 5 285 3 atpD ATP synthase subunit beta Geobacillus thermoleovorans
B1HM56 1.26e-35 140 30 6 350 3 atpD ATP synthase subunit beta Lysinibacillus sphaericus (strain C3-41)
A1TJ41 1.26e-35 140 30 7 362 3 atpD ATP synthase subunit beta Paracidovorax citrulli (strain AAC00-1)
Q03EL4 1.27e-35 140 30 8 356 3 atpD ATP synthase subunit beta Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
A9NGW2 1.33e-35 139 31 6 319 3 atpD ATP synthase subunit beta Acholeplasma laidlawii (strain PG-8A)
Q5KUJ3 1.34e-35 140 32 5 285 1 atpD ATP synthase subunit beta Geobacillus kaustophilus (strain HTA426)
P12698 1.49e-35 140 29 7 353 3 atpD ATP synthase subunit beta Priestia megaterium (strain ATCC 12872 / QMB1551)
B2G691 1.5e-35 140 31 7 320 3 atpD ATP synthase subunit beta Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VIR1 1.5e-35 140 31 7 320 3 atpD ATP synthase subunit beta Limosilactobacillus reuteri (strain DSM 20016)
B0T335 1.52e-35 140 29 8 377 3 atpD ATP synthase subunit beta Caulobacter sp. (strain K31)
A9H9A8 1.7e-35 140 30 7 355 3 atpD ATP synthase subunit beta Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
B7GTZ3 1.72e-35 140 28 7 372 3 atpD ATP synthase subunit beta Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
Q2RFX9 1.72e-35 139 31 7 297 1 atpD ATP synthase subunit beta Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q180W5 1.81e-35 139 31 6 330 3 atpD ATP synthase subunit beta Clostridioides difficile (strain 630)
Q07UZ5 1.9e-35 139 30 12 386 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain BisA53)
Q3YS09 1.99e-35 140 31 5 304 3 atpD ATP synthase subunit beta Ehrlichia canis (strain Jake)
B8DWS2 2.03e-35 140 28 8 378 3 atpD ATP synthase subunit beta Bifidobacterium animalis subsp. lactis (strain AD011)
Q2T873 2.04e-35 140 31 5 345 3 atpA2 ATP synthase subunit alpha 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q05FY1 2.22e-35 139 32 7 299 3 atpD ATP synthase subunit beta Carsonella ruddii (strain PV)
A1VIV2 2.28e-35 139 29 7 385 3 atpD1 ATP synthase subunit beta 1 Polaromonas naphthalenivorans (strain CJ2)
B1I6J7 2.5e-35 139 30 4 321 3 atpD ATP synthase subunit beta Desulforudis audaxviator (strain MP104C)
Q0SQZ5 2.53e-35 139 29 4 312 3 atpD ATP synthase subunit beta Clostridium perfringens (strain SM101 / Type A)
Q8RC15 2.66e-35 139 31 6 313 3 atpD ATP synthase subunit beta Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8XID4 2.68e-35 139 29 4 312 3 atpD ATP synthase subunit beta Clostridium perfringens (strain 13 / Type A)
Q0TNC4 2.68e-35 139 29 4 312 3 atpD ATP synthase subunit beta Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A2RMI2 2.78e-35 139 28 7 391 3 atpD ATP synthase subunit beta Lactococcus lactis subsp. cremoris (strain MG1363)
Q13DP2 2.98e-35 139 31 6 308 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain BisB5)
A1T0Y9 3.02e-35 139 29 8 365 3 atpD2 ATP synthase subunit beta 2 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q98QB6 3.06e-35 139 31 15 386 3 atpD2 ATP synthase subunit beta 2 Mycoplasmopsis pulmonis (strain UAB CTIP)
Q11DD5 3.16e-35 139 29 4 327 3 atpD ATP synthase subunit beta Chelativorans sp. (strain BNC1)
C6E9F1 3.28e-35 139 28 8 381 3 atpD ATP synthase subunit beta Geobacter sp. (strain M21)
A2SC70 3.46e-35 139 28 7 385 3 atpD ATP synthase subunit beta Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B4EEY9 3.46e-35 139 29 7 378 3 atpD ATP synthase subunit beta Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q82J84 3.59e-35 139 30 6 329 3 atpD ATP synthase subunit beta Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q02XA5 3.68e-35 139 28 7 391 3 atpD ATP synthase subunit beta Lactococcus lactis subsp. cremoris (strain SK11)
B3EJK9 3.76e-35 138 29 7 351 3 atpD ATP synthase subunit beta Chlorobium phaeobacteroides (strain BS1)
A5G9D8 3.77e-35 139 28 9 383 3 atpD ATP synthase subunit beta Geotalea uraniireducens (strain Rf4)
A1K1S2 3.86e-35 138 29 5 353 3 atpD ATP synthase subunit beta Azoarcus sp. (strain BH72)
B5YBP8 4.04e-35 138 31 4 336 3 atpD ATP synthase subunit beta Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q0AKW0 4.06e-35 139 29 7 354 3 atpD ATP synthase subunit beta Maricaulis maris (strain MCS10)
P29707 4.24e-35 138 29 7 372 1 atpD ATP synthase subunit beta, sodium ion specific Propionigenium modestum
P0A301 4.66e-35 138 30 6 329 1 atpD ATP synthase subunit beta Streptomyces lividans
P0A300 4.66e-35 138 30 6 329 3 atpD ATP synthase subunit beta Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q5FGY3 4.88e-35 139 30 5 328 3 atpD ATP synthase subunit beta Ehrlichia ruminantium (strain Gardel)
A9WNC8 4.95e-35 138 30 7 351 3 atpD ATP synthase subunit beta Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
B1KSS8 5e-35 138 30 4 310 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Loch Maree / Type A3)
Q5HB71 5.29e-35 139 30 5 328 3 atpD ATP synthase subunit beta Ehrlichia ruminantium (strain Welgevonden)
Q12GQ0 5.34e-35 138 29 7 385 3 atpD ATP synthase subunit beta Polaromonas sp. (strain JS666 / ATCC BAA-500)
A0Q2Z4 5.55e-35 138 30 4 312 3 atpD ATP synthase subunit beta Clostridium novyi (strain NT)
B0RED4 6.14e-35 138 29 6 350 3 atpD ATP synthase subunit beta Clavibacter sepedonicus
Q0BJL5 6.32e-35 138 29 7 378 3 atpD ATP synthase subunit beta Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q1BRB0 6.38e-35 138 29 7 378 3 atpD ATP synthase subunit beta Burkholderia orbicola (strain AU 1054)
B1JSV7 6.38e-35 138 29 7 378 3 atpD ATP synthase subunit beta Burkholderia orbicola (strain MC0-3)
A0K2Y3 6.38e-35 138 29 7 378 3 atpD ATP synthase subunit beta Burkholderia cenocepacia (strain HI2424)
A5CQ60 6.65e-35 138 29 6 350 3 atpD ATP synthase subunit beta Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
B5EFI7 6.87e-35 138 28 8 381 3 atpD ATP synthase subunit beta Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q6AG58 7.08e-35 138 29 7 351 3 atpD ATP synthase subunit beta Leifsonia xyli subsp. xyli (strain CTCB07)
A4J999 7.14e-35 138 27 6 351 3 atpD ATP synthase subunit beta Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A1SS55 7.18e-35 138 30 7 351 3 atpD1 ATP synthase subunit beta 1 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
P33253 7.4e-35 138 28 9 387 3 atpD ATP synthase subunit beta Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q8F2J5 8.29e-35 137 30 4 321 3 atpD ATP synthase subunit beta Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72SX9 8.29e-35 137 30 4 321 3 atpD ATP synthase subunit beta Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q74GY0 8.48e-35 137 28 8 381 3 atpD ATP synthase subunit beta Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_10080
Feature type CDS
Gene sctN
Product type III secretion system ATPase SctN
Location 48337 - 49629 (strand: 1)
Length 1293 (nucleotides) / 430 (amino acids)
In genomic island -

Contig

Accession ZDB_219
Length 213167 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_431
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00006 ATP synthase alpha/beta family, nucleotide-binding domain
PF18269 T3SS EscN ATPase C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1157 Cell motility (N)
Intracellular trafficking, secretion, and vesicular transport (U)
NU Flagellar biosynthesis/type III secretory pathway ATPase FliI

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K22506 type III secretion system ATPase [EC:7.4.2.8] - -

Protein Sequence

MLNALLSQRAFPVHIRGYYLEAPLPDVFIGEICLLWQDVTCRVLLGRAQVVGFNEHNTLLSLIGQAAGLTLTTVIAPTGSAVTLTFTPQIPGSVIDPSGNTLARLSEITEPDNRSIIRPVSGEVPDVLSRQRITEILPTGVKAIDALLTCGKGQRLGIFAGAGCGKTVLMNMLIEHAQADIFVIALIGERGREVTELIDELRNSPQAAKCILVCSTSDKPAVDRCNAALVATSLAEYYRDEGKEVILFVDSLTRYGRALRDVALSAGELPVRLGYPASVFEQLPALLERPGATKTGVITAFYTVLLDSENEPDGFGDEVRSILDGHIYLSRRLAMQNHYPAIDIPASISRVMSQIVSPQHLAAAGHFRTLLAKQNELKLLVELGEYKPGLNAESDKAVELTLPMRHFLCQSPAESVAADETGRLLEQLTQ

Flanking regions ( +/- flanking 50bp)

TTTGTCCGCCTCAGTCAGCAGTGTCACACACTGATCCTCAGAGGCTGACGATGCTGAATGCACTGCTCAGTCAGCGGGCATTTCCGGTGCATATCCGCGGGTATTATCTGGAAGCGCCGTTGCCGGATGTCTTTATCGGGGAAATTTGTCTGTTATGGCAGGATGTTACCTGTCGCGTACTGCTCGGCCGGGCTCAGGTGGTGGGTTTTAATGAACACAACACGCTGCTGAGTCTGATCGGACAGGCCGCCGGGCTGACACTGACAACGGTTATCGCACCGACGGGTAGTGCAGTAACACTGACATTCACACCGCAAATTCCGGGCTCGGTGATTGATCCGTCCGGTAATACCCTGGCCCGTCTGAGTGAGATAACAGAGCCGGATAACCGGAGTATCATCCGCCCCGTCAGCGGTGAGGTGCCGGATGTGCTCTCCCGGCAGCGTATCACGGAGATTTTGCCGACCGGCGTGAAAGCCATTGATGCTCTGCTGACCTGCGGAAAAGGCCAGCGGCTGGGAATTTTTGCCGGTGCCGGCTGCGGTAAGACCGTGCTGATGAATATGCTGATTGAGCATGCGCAAGCCGATATTTTTGTTATAGCCCTGATTGGCGAACGCGGCCGGGAAGTGACTGAACTGATTGATGAACTGCGCAACAGCCCGCAGGCGGCAAAATGTATTCTGGTCTGCTCGACATCCGATAAACCGGCGGTTGACCGCTGTAATGCGGCGCTGGTGGCCACCTCACTGGCGGAATATTACCGTGATGAGGGGAAAGAGGTGATCCTCTTTGTTGATTCACTGACACGCTACGGGCGGGCGTTAAGGGATGTGGCACTGAGTGCCGGGGAATTGCCTGTCAGGCTGGGGTATCCGGCATCGGTATTTGAGCAGTTACCGGCACTGCTGGAGCGCCCGGGAGCGACGAAAACCGGCGTGATCACGGCTTTCTATACTGTTTTACTTGATAGCGAGAATGAGCCGGATGGCTTTGGCGATGAAGTCCGTTCCATTCTCGACGGACATATTTATCTCTCCCGGCGACTGGCGATGCAGAATCACTATCCGGCGATTGATATCCCGGCCAGCATCAGCCGTGTCATGTCACAGATTGTTTCACCGCAGCATCTGGCGGCTGCCGGGCATTTCCGGACACTGCTGGCGAAACAGAATGAGCTGAAACTGCTGGTGGAGCTAGGGGAATATAAACCCGGGCTGAATGCGGAGAGTGATAAAGCGGTTGAGCTTACTCTGCCGATGCGCCATTTTTTGTGTCAGTCACCGGCGGAATCCGTTGCGGCGGATGAAACAGGCAGATTACTTGAACAGCTCACACAATGAATTACAGCAACTGATCGCGCATTTCAGTCTGAAAGAGCGCTGTGTCCGGG