Homologs in group_1459

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09330 FBDBKF_09330 80.9 Morganella morganii S1 sctN type III secretion system ATPase SctN
EHELCC_10080 EHELCC_10080 80.9 Morganella morganii S2 sctN type III secretion system ATPase SctN
NLDBIP_10425 NLDBIP_10425 80.9 Morganella morganii S4 sctN type III secretion system ATPase SctN
LHKJJB_10930 LHKJJB_10930 80.9 Morganella morganii S3 sctN type III secretion system ATPase SctN
HKOGLL_13990 HKOGLL_13990 80.9 Morganella morganii S5 sctN type III secretion system ATPase SctN
PMI_RS13265 PMI_RS13265 49.2 Proteus mirabilis HI4320 sctN type III secretion system ATPase SctN

Distribution of the homologs in the orthogroup group_1459

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1459

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A1B9 3.21e-153 444 51 2 426 1 sctN1 SPI-1 type 3 secretion system ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1C0 3.21e-153 444 51 2 426 3 sctN1 SPI-1 type 3 secretion system ATPase Salmonella typhi
P0A1C2 5.52e-135 397 50 3 408 3 sctN Type 3 secretion system ATPase Shigella sonnei
P0A1C1 5.52e-135 397 50 3 408 1 sctN Type 3 secretion system ATPase Shigella flexneri
P40291 1.68e-117 353 44 4 428 1 sctN Type 3 secretion system ATPase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q7ARI8 1.68e-117 353 44 4 428 1 sctN Type 3 secretion system ATPase Yersinia pestis
P40290 2.15e-117 352 44 4 428 1 sctN Type 3 secretion system ATPase Yersinia enterocolitica
P80153 1.43e-109 333 44 5 423 3 sctN Type 3 secretion system ATPase Xanthomonas euvesicatoria
P55717 3.16e-102 314 43 3 414 3 sctN Type 3 secretion system ATPase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P23445 1.52e-99 307 40 4 435 3 fliI Flagellum-specific ATP synthase Bacillus subtilis (strain 168)
P74857 1.08e-98 305 44 2 391 1 sctN2 SPI-2 type 3 secretion system ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8RK01 7.21e-96 298 41 2 418 1 sctN Type 3 secretion system ATPase Pseudomonas savastanoi pv. phaseolicola
Q887B5 8.95e-96 297 41 2 418 3 sctN Type 3 secretion system ATPase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q52371 2.76e-94 294 41 2 418 1 sctN Type 3 secretion system ATPase Pseudomonas syringae pv. syringae
Q9I4N1 1.54e-93 292 40 3 421 3 fliI Flagellum-specific ATP synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O83417 2.72e-85 270 37 2 416 3 fliI Flagellum-specific ATP synthase Treponema pallidum (strain Nichols)
Q8KA42 6.88e-85 270 38 5 424 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P26465 4.4e-84 268 39 5 403 1 fliI Flagellum-specific ATP synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P52612 2.13e-82 263 39 5 403 1 fliI Flagellum-specific ATP synthase Escherichia coli (strain K12)
Q89AZ7 3.73e-82 263 37 4 407 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P57178 1.68e-81 261 38 8 428 3 fliI Flagellum-specific ATP synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
O67531 6.28e-81 259 36 5 419 3 fliI Flagellum-specific ATP synthase Aquifex aeolicus (strain VF5)
P52607 1.87e-80 258 37 3 398 3 fliI Flagellum-specific ATP synthase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q9ZJJ3 1.41e-76 248 41 4 350 3 fliI Flagellum-specific ATP synthase Helicobacter pylori (strain J99 / ATCC 700824)
O07025 5.87e-76 246 42 4 332 1 fliI Flagellum-specific ATP synthase Helicobacter pylori (strain ATCC 700392 / 26695)
O34171 2.26e-70 233 40 4 337 3 fliI Flagellum-specific ATP synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
O54249 1.66e-69 230 40 6 339 3 fliI Flagellum-specific ATP synthase Rhizobium meliloti (strain 1021)
B8H363 9.78e-66 219 33 6 397 3 fliI Flagellum-specific ATP synthase Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAT8 9.78e-66 219 33 6 397 3 fliI Flagellum-specific ATP synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q2YCA3 5.82e-46 168 30 8 385 3 atpD1 ATP synthase subunit beta 1 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B8GRB8 7.46e-46 167 30 7 385 3 atpD ATP synthase subunit beta Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q9PE85 2.41e-45 166 30 7 392 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain 9a5c)
B0U598 3.32e-45 166 30 7 392 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain M12)
Q3SF66 4.21e-45 166 30 9 372 3 atpD ATP synthase subunit beta Thiobacillus denitrificans (strain ATCC 25259)
A5EXL4 7.29e-45 165 31 9 385 3 atpD ATP synthase subunit beta Dichelobacter nodosus (strain VCS1703A)
A3QJR0 1.44e-44 164 30 8 383 3 atpD ATP synthase subunit beta Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A9HY42 1.47e-44 164 30 7 381 3 atpD ATP synthase subunit beta Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q87E90 1.9e-44 164 28 8 442 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I877 1.9e-44 164 28 8 442 3 atpD ATP synthase subunit beta Xylella fastidiosa (strain M23)
B2FHY8 3.14e-44 163 29 8 437 3 atpD ATP synthase subunit beta Stenotrophomonas maltophilia (strain K279a)
B4SJR9 7.58e-44 162 30 7 387 3 atpD ATP synthase subunit beta Stenotrophomonas maltophilia (strain R551-3)
A4VS62 9.73e-44 162 30 9 384 3 atpD ATP synthase subunit beta Stutzerimonas stutzeri (strain A1501)
Q2KU36 1.88e-43 161 29 7 381 3 atpD ATP synthase subunit beta Bordetella avium (strain 197N)
A1WZT1 2.3e-43 160 29 8 385 3 atpD ATP synthase subunit beta Halorhodospira halophila (strain DSM 244 / SL1)
Q46VY0 2.47e-43 161 31 8 380 3 atpD ATP synthase subunit beta Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q7W3B0 3.55e-43 160 30 7 381 3 atpD ATP synthase subunit beta Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WEM9 3.55e-43 160 30 7 381 3 atpD ATP synthase subunit beta Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VU44 4.01e-43 160 30 7 381 3 atpD ATP synthase subunit beta Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A1SBU0 4.05e-43 160 30 9 376 3 atpD ATP synthase subunit beta Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q31DM0 4.48e-43 160 30 10 391 3 atpD ATP synthase subunit beta Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B9MBA3 7.22e-43 159 31 9 390 3 atpD ATP synthase subunit beta Acidovorax ebreus (strain TPSY)
A1W2T7 7.3e-43 159 31 9 390 3 atpD ATP synthase subunit beta Acidovorax sp. (strain JS42)
Q13SQ2 1.59e-42 159 31 8 383 3 atpD2 ATP synthase subunit beta 2 Paraburkholderia xenovorans (strain LB400)
Q8XU76 1.84e-42 158 29 7 381 3 atpD ATP synthase subunit beta Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B0VBP3 2.05e-42 158 31 10 393 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AYE)
A3M144 2.05e-42 158 31 10 393 1 atpD ATP synthase subunit beta Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VNK4 2.05e-42 158 31 10 393 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain SDF)
B2I102 2.05e-42 158 31 10 393 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain ACICU)
B7I1W4 2.05e-42 158 31 10 393 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AB0057)
B7H294 2.05e-42 158 31 10 393 3 atpD ATP synthase subunit beta Acinetobacter baumannii (strain AB307-0294)
A7N6Q5 2.11e-42 158 29 7 381 3 atpD2 ATP synthase subunit beta 2 Vibrio campbellii (strain ATCC BAA-1116)
B8F774 2.14e-42 158 32 10 372 3 atpD ATP synthase subunit beta Glaesserella parasuis serovar 5 (strain SH0165)
Q82XP8 2.3e-42 158 29 8 385 3 atpD ATP synthase subunit beta Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B3R7L5 2.6e-42 158 29 7 381 3 atpD ATP synthase subunit beta Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A9NBD0 2.76e-42 158 30 8 383 3 atpD ATP synthase subunit beta Coxiella burnetii (strain RSA 331 / Henzerling II)
A2S6J8 2.77e-42 158 30 8 383 3 atpD ATP synthase subunit beta Burkholderia mallei (strain NCTC 10229)
Q7P095 2.93e-42 158 30 8 389 3 atpD ATP synthase subunit beta Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B8CVU5 3.08e-42 157 30 9 372 3 atpD ATP synthase subunit beta Shewanella piezotolerans (strain WP3 / JCM 13877)
Q83AF5 3.95e-42 157 30 8 383 3 atpD ATP synthase subunit beta Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KBF7 3.95e-42 157 30 8 383 3 atpD ATP synthase subunit beta Coxiella burnetii (strain Dugway 5J108-111)
Q07VU4 4.21e-42 157 30 8 383 3 atpD1 ATP synthase subunit beta 1 Shewanella frigidimarina (strain NCIMB 400)
A6VL57 4.23e-42 157 29 6 382 3 atpD ATP synthase subunit beta Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q2STE9 4.24e-42 157 30 8 383 1 atpD1 ATP synthase subunit beta 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63PI0 4.24e-42 157 30 8 383 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain K96243)
A3NF40 4.24e-42 157 30 8 383 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain 668)
Q3JXV8 4.24e-42 157 30 8 383 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain 1710b)
A3P0Z0 4.24e-42 157 30 8 383 3 atpD1 ATP synthase subunit beta 1 Burkholderia pseudomallei (strain 1106a)
A1V8T1 4.24e-42 157 30 8 383 3 atpD1 ATP synthase subunit beta 1 Burkholderia mallei (strain SAVP1)
Q62FR5 4.24e-42 157 30 8 383 3 atpD1 ATP synthase subunit beta 1 Burkholderia mallei (strain ATCC 23344)
A3MQJ9 4.24e-42 157 30 8 383 3 atpD1 ATP synthase subunit beta 1 Burkholderia mallei (strain NCTC 10247)
Q12HQ1 5.17e-42 157 32 6 327 3 atpD ATP synthase subunit beta Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A5CVI6 5.39e-42 157 30 7 383 3 atpD ATP synthase subunit beta Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A6LQH6 5.97e-42 157 31 8 368 3 atpD ATP synthase subunit beta Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
B5YI24 6.53e-42 157 28 6 382 3 atpD ATP synthase subunit beta Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q1BRB0 6.86e-42 157 30 8 383 3 atpD ATP synthase subunit beta Burkholderia orbicola (strain AU 1054)
B1JSV7 6.86e-42 157 30 8 383 3 atpD ATP synthase subunit beta Burkholderia orbicola (strain MC0-3)
A0K2Y3 6.86e-42 157 30 8 383 3 atpD ATP synthase subunit beta Burkholderia cenocepacia (strain HI2424)
Q0A4M8 7.58e-42 157 28 7 383 3 atpD ATP synthase subunit beta Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q1LHL0 7.68e-42 157 29 7 381 3 atpD ATP synthase subunit beta Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1GXN0 7.81e-42 157 29 7 381 3 atpD ATP synthase subunit beta Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
B4EEY9 9.23e-42 156 30 8 383 3 atpD ATP synthase subunit beta Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A5UQN3 1.01e-41 156 30 5 338 3 atpD ATP synthase subunit beta Roseiflexus sp. (strain RS-1)
Q5P4E2 1.06e-41 156 29 7 381 3 atpD ATP synthase subunit beta Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
C4LDW0 1.12e-41 156 29 6 381 3 atpD ATP synthase subunit beta Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q0K5M7 1.28e-41 156 29 7 381 3 atpD ATP synthase subunit beta Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A9BPU7 1.41e-41 156 31 9 390 3 atpD ATP synthase subunit beta Delftia acidovorans (strain DSM 14801 / SPH-1)
A6VWP9 1.52e-41 156 32 7 352 3 atpD1 ATP synthase subunit beta 1 Marinomonas sp. (strain MWYL1)
A8G1W5 1.66e-41 155 30 9 372 3 atpD ATP synthase subunit beta Shewanella sediminis (strain HAW-EB3)
Q98QU5 1.73e-41 156 31 11 395 3 atpD1 ATP synthase subunit beta 1 Mycoplasmopsis pulmonis (strain UAB CTIP)
P95789 1.88e-41 155 30 8 379 3 atpD ATP synthase subunit beta Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
B0KRA8 1.88e-41 155 29 8 406 3 atpD ATP synthase subunit beta Pseudomonas putida (strain GB-1)
A7NIQ9 1.9e-41 156 31 7 340 3 atpD ATP synthase subunit beta Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q6FFK0 2.13e-41 155 31 10 393 3 atpD ATP synthase subunit beta Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A3DIM9 2.27e-41 155 31 10 347 3 atpD ATP synthase subunit beta Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q3J6N1 2.69e-41 155 30 9 385 3 atpD ATP synthase subunit beta Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A9AJG4 2.95e-41 155 30 8 383 3 atpD ATP synthase subunit beta Burkholderia multivorans (strain ATCC 17616 / 249)
Q0BJL5 2.95e-41 155 30 8 383 3 atpD ATP synthase subunit beta Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q8PGG7 3.68e-41 155 28 8 437 3 atpD ATP synthase subunit beta Xanthomonas axonopodis pv. citri (strain 306)
Q3BP15 4.66e-41 155 29 7 387 3 atpD ATP synthase subunit beta Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q74GY0 4.82e-41 155 29 10 413 3 atpD ATP synthase subunit beta Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q15MU4 4.87e-41 154 29 8 383 3 atpD2 ATP synthase subunit beta 2 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
C1D5G2 5.01e-41 154 30 8 383 3 atpD ATP synthase subunit beta Laribacter hongkongensis (strain HLHK9)
C5BKJ5 5.12e-41 154 29 9 392 3 atpD ATP synthase subunit beta Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q65Q07 5.44e-41 154 29 7 383 3 atpD ATP synthase subunit beta Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q6G1W9 5.97e-41 155 29 11 444 3 atpD ATP synthase subunit beta Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A8HAG3 6.88e-41 154 29 9 372 3 atpD ATP synthase subunit beta Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B1YQL4 6.96e-41 154 30 8 383 3 atpD ATP synthase subunit beta Burkholderia ambifaria (strain MC40-6)
Q5WSG8 7.24e-41 154 29 8 385 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Lens)
Q5ZRA1 7.24e-41 154 29 8 385 3 atpD ATP synthase subunit beta Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5III3 7.24e-41 154 29 8 385 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Corby)
Q5X0P3 7.24e-41 154 29 8 385 3 atpD ATP synthase subunit beta Legionella pneumophila (strain Paris)
B1KQ34 7.47e-41 154 30 9 369 3 atpD ATP synthase subunit beta Shewanella woodyi (strain ATCC 51908 / MS32)
A1K1S2 7.65e-41 154 30 7 381 3 atpD ATP synthase subunit beta Azoarcus sp. (strain BH72)
A1TJ41 8.16e-41 154 30 8 390 3 atpD ATP synthase subunit beta Paracidovorax citrulli (strain AAC00-1)
B1XSD4 8.3e-41 154 29 7 381 3 atpD ATP synthase subunit beta Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q9K6H5 8.35e-41 154 30 9 384 3 atpD ATP synthase subunit beta Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5H4Y4 8.5e-41 154 27 8 437 3 atpD ATP synthase subunit beta Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SQB0 8.5e-41 154 27 8 437 3 atpD ATP synthase subunit beta Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P7Q4 8.5e-41 154 27 8 437 3 atpD ATP synthase subunit beta Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q7MGI0 8.97e-41 154 29 8 393 3 atpD ATP synthase subunit beta Vibrio vulnificus (strain YJ016)
Q8DDG8 8.97e-41 154 29 8 393 3 atpD ATP synthase subunit beta Vibrio vulnificus (strain CMCP6)
A4SUT4 9.1e-41 154 29 7 381 3 atpD ATP synthase subunit beta Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q5QZI6 9.25e-41 154 29 9 385 3 atpD ATP synthase subunit beta Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q39KX6 9.84e-41 154 30 8 383 3 atpD ATP synthase subunit beta Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1I2I7 9.93e-41 154 31 7 356 3 atpD ATP synthase subunit beta Pseudomonas entomophila (strain L48)
B9LZ84 1.03e-40 154 28 11 411 3 atpD ATP synthase subunit beta Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q0AJB0 1.13e-40 153 29 8 383 3 atpD1 ATP synthase subunit beta 1 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q3A946 1.24e-40 154 29 11 414 3 atpD ATP synthase subunit beta Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A1AP52 1.25e-40 154 29 11 414 3 atpD2 ATP synthase subunit beta 2 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q8PCZ5 1.29e-40 153 30 7 358 3 atpD ATP synthase subunit beta Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UQF4 1.29e-40 153 30 7 358 3 atpD ATP synthase subunit beta Xanthomonas campestris pv. campestris (strain 8004)
B0RWC2 1.37e-40 153 30 7 358 3 atpD ATP synthase subunit beta Xanthomonas campestris pv. campestris (strain B100)
A4Y187 1.4e-40 153 29 7 383 3 atpD ATP synthase subunit beta Pseudomonas mendocina (strain ymp)
A4JA35 1.48e-40 153 30 8 383 3 atpD ATP synthase subunit beta Burkholderia vietnamiensis (strain G4 / LMG 22486)
B4RJG0 1.65e-40 153 29 9 389 3 atpD ATP synthase subunit beta Neisseria gonorrhoeae (strain NCCP11945)
Q5F4Z0 1.65e-40 153 29 9 389 3 atpD ATP synthase subunit beta Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A5G9D8 1.68e-40 153 28 10 413 3 atpD ATP synthase subunit beta Geotalea uraniireducens (strain Rf4)
Q9CKW1 1.87e-40 153 29 8 385 3 atpD ATP synthase subunit beta Pasteurella multocida (strain Pm70)
B2G691 1.92e-40 153 31 6 329 3 atpD ATP synthase subunit beta Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VIR1 1.92e-40 153 31 6 329 3 atpD ATP synthase subunit beta Limosilactobacillus reuteri (strain DSM 20016)
Q0HD79 2.1e-40 153 31 6 327 3 atpD ATP synthase subunit beta Shewanella sp. (strain MR-4)
Q0HPG1 2.16e-40 153 31 6 327 3 atpD ATP synthase subunit beta Shewanella sp. (strain MR-7)
A1ALL7 2.25e-40 153 28 11 414 3 atpD1 ATP synthase subunit beta 1 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B4RS81 2.51e-40 152 29 8 383 3 atpD ATP synthase subunit beta Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A0KQX8 2.58e-40 152 32 7 324 3 atpD ATP synthase subunit beta Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A1KW11 2.83e-40 152 29 9 389 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M123 2.83e-40 152 29 9 389 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup C (strain 053442)
Q9JW70 2.85e-40 152 29 9 389 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A6W3S8 3.24e-40 152 29 8 383 3 atpD2 ATP synthase subunit beta 2 Marinomonas sp. (strain MWYL1)
A0L2S8 3.25e-40 152 31 6 327 3 atpD ATP synthase subunit beta Shewanella sp. (strain ANA-3)
A1RQB0 3.28e-40 152 30 8 363 3 atpD ATP synthase subunit beta Shewanella sp. (strain W3-18-1)
A4YCH8 3.28e-40 152 30 8 363 3 atpD ATP synthase subunit beta Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q9JXQ2 3.39e-40 152 29 9 389 3 atpD ATP synthase subunit beta Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q4A604 3.41e-40 152 28 9 421 3 atpD ATP synthase subunit beta Mycoplasmopsis synoviae (strain 53)
Q88BX4 3.41e-40 152 28 8 411 3 atpD ATP synthase subunit beta Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5WBA3 3.41e-40 152 28 8 411 3 atpD ATP synthase subunit beta Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q4ZL24 3.47e-40 152 30 7 356 3 atpD ATP synthase subunit beta Pseudomonas syringae pv. syringae (strain B728a)
Q87TT4 3.57e-40 152 30 7 356 3 atpD ATP synthase subunit beta Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A4GAG9 3.63e-40 152 30 10 391 3 atpD ATP synthase subunit beta Herminiimonas arsenicoxydans
P41168 3.64e-40 152 29 8 385 3 atpD ATP synthase subunit beta Acidithiobacillus ferridurans
Q8E8C0 3.78e-40 152 31 6 327 3 atpD ATP synthase subunit beta Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B0TQF4 4.05e-40 152 31 6 327 3 atpD ATP synthase subunit beta Shewanella halifaxensis (strain HAW-EB4)
Q0I5X3 4.69e-40 152 29 7 383 3 atpD ATP synthase subunit beta Histophilus somni (strain 129Pt)
B0UWG5 5.14e-40 152 29 7 383 3 atpD ATP synthase subunit beta Histophilus somni (strain 2336)
B1JFU1 5.28e-40 152 29 8 383 3 atpD ATP synthase subunit beta Pseudomonas putida (strain W619)
B5Y831 5.51e-40 151 28 8 367 3 atpD ATP synthase subunit beta Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
A2SC70 5.74e-40 152 30 9 383 3 atpD ATP synthase subunit beta Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
P22478 5.94e-40 152 32 5 326 3 atpD ATP synthase subunit beta Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
B3PIS7 6.25e-40 151 30 8 385 3 atpD ATP synthase subunit beta Cellvibrio japonicus (strain Ueda107)
A1VPR5 6.34e-40 152 31 6 350 3 atpD2 ATP synthase subunit beta 2 Polaromonas naphthalenivorans (strain CJ2)
A4STP3 6.64e-40 151 31 7 324 3 atpD ATP synthase subunit beta Aeromonas salmonicida (strain A449)
Q6FYM3 6.65e-40 153 30 9 388 3 atpD ATP synthase subunit beta Bartonella quintana (strain Toulouse)
Q48BG5 6.78e-40 151 30 7 356 3 atpD ATP synthase subunit beta Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B2TK00 6.89e-40 151 31 7 313 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Eklund 17B / Type B)
B2UZK0 6.96e-40 151 31 7 313 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Alaska E43 / Type E3)
Q5M5J1 7.04e-40 151 29 9 379 3 atpD ATP synthase subunit beta Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q9HT20 8.26e-40 151 29 9 385 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DF4 8.26e-40 151 29 9 385 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V791 8.26e-40 151 29 9 385 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain LESB58)
A6VF32 8.26e-40 151 29 9 385 3 atpD ATP synthase subunit beta Pseudomonas aeruginosa (strain PA7)
Q39Q56 9.28e-40 151 28 10 413 3 atpD ATP synthase subunit beta Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q601Z5 1.02e-39 151 31 9 368 3 atpD ATP synthase subunit beta Mesomycoplasma hyopneumoniae (strain 232)
A9KX06 1.02e-39 151 30 8 363 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS195)
A6WUJ0 1.02e-39 151 30 8 363 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS185)
A3DAR4 1.02e-39 151 30 8 363 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EDV0 1.02e-39 151 30 8 363 3 atpD ATP synthase subunit beta Shewanella baltica (strain OS223)
P55988 1.18e-39 151 29 9 381 3 atpD ATP synthase subunit beta Helicobacter pylori (strain ATCC 700392 / 26695)
Q1QSD0 1.22e-39 150 28 10 435 3 atpD ATP synthase subunit beta Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q3IK50 1.43e-39 150 30 7 358 3 atpD ATP synthase subunit beta Pseudoalteromonas translucida (strain TAC 125)
C3K1E6 1.47e-39 150 30 7 356 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain SBW25)
Q4K3A9 1.62e-39 150 29 8 383 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B9MS68 1.76e-39 150 29 9 386 3 atpD ATP synthase subunit beta Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
B6JMX2 1.86e-39 150 28 9 381 3 atpD ATP synthase subunit beta Helicobacter pylori (strain P12)
Q60CR4 1.89e-39 150 30 10 383 3 atpD ATP synthase subunit beta Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q4AAV7 2.06e-39 150 31 9 368 3 atpD ATP synthase subunit beta Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
Q6LKZ6 2.1e-39 150 29 7 381 3 atpD2 ATP synthase subunit beta 2 Photobacterium profundum (strain SS9)
C3LSI9 2.12e-39 150 28 8 393 3 atpD ATP synthase subunit beta Vibrio cholerae serotype O1 (strain M66-2)
Q9KNH5 2.12e-39 150 28 8 393 3 atpD ATP synthase subunit beta Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F459 2.12e-39 150 28 8 393 3 atpD ATP synthase subunit beta Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B5FCZ1 2.23e-39 150 28 8 393 3 atpD ATP synthase subunit beta Aliivibrio fischeri (strain MJ11)
Q4A8V9 2.23e-39 150 31 9 368 3 atpD ATP synthase subunit beta Mesomycoplasma hyopneumoniae (strain 7448)
B8DRD2 2.35e-39 150 33 6 300 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
A6T470 2.35e-39 150 30 10 391 3 atpD ATP synthase subunit beta Janthinobacterium sp. (strain Marseille)
Q03LX3 2.45e-39 150 29 9 379 3 atpD ATP synthase subunit beta Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M104 2.45e-39 150 29 9 379 3 atpD ATP synthase subunit beta Streptococcus thermophilus (strain CNRZ 1066)
Q8DP44 2.48e-39 150 29 8 379 1 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97PT6 2.48e-39 150 29 8 379 3 atpD ATP synthase subunit beta Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZLA9 2.48e-39 150 29 8 379 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1ICS9 2.48e-39 150 29 8 379 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain Hungary19A-6)
Q04HT9 2.48e-39 150 29 8 379 3 atpD ATP synthase subunit beta Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P43715 2.61e-39 150 31 7 328 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QN64 2.61e-39 150 31 7 328 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain 86-028NP)
A5UGY9 2.64e-39 150 31 7 328 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain PittGG)
A5UA11 2.78e-39 149 31 7 328 3 atpD ATP synthase subunit beta Haemophilus influenzae (strain PittEE)
A1VIV2 3.21e-39 150 30 9 390 3 atpD1 ATP synthase subunit beta 1 Polaromonas naphthalenivorans (strain CJ2)
Q5E1N7 3.24e-39 150 28 8 393 3 atpD ATP synthase subunit beta Aliivibrio fischeri (strain ATCC 700601 / ES114)
A7N0Y1 3.41e-39 149 28 8 393 3 atpD1 ATP synthase subunit beta 1 Vibrio campbellii (strain ATCC BAA-1116)
A1AXU2 3.45e-39 149 30 6 332 3 atpD ATP synthase subunit beta Ruthia magnifica subsp. Calyptogena magnifica
P42470 3.51e-39 149 28 10 387 3 atpD ATP synthase subunit beta Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
B3H2P3 3.73e-39 149 31 6 322 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N2U4 3.73e-39 149 31 6 322 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q2RFX9 3.73e-39 149 30 10 373 1 atpD ATP synthase subunit beta Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
C6E9F1 4.34e-39 149 28 11 413 3 atpD ATP synthase subunit beta Geobacter sp. (strain M21)
Q3A605 4.37e-39 149 29 9 384 3 atpD1 ATP synthase subunit beta 1 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
B8I579 4.57e-39 149 29 10 371 3 atpD ATP synthase subunit beta Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q04ZU5 4.71e-39 149 30 9 379 3 atpD ATP synthase subunit beta Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04S18 4.71e-39 149 30 9 379 3 atpD ATP synthase subunit beta Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
A9H9A8 5.46e-39 149 30 9 388 3 atpD ATP synthase subunit beta Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
A3CM14 5.63e-39 149 29 8 377 3 atpD ATP synthase subunit beta Streptococcus sanguinis (strain SK36)
Q1J7F9 5.69e-39 149 29 9 381 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JHN5 5.69e-39 149 29 9 381 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q8P1K5 5.69e-39 149 29 9 381 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XCY0 5.69e-39 149 29 9 381 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q477Z1 6.42e-39 149 29 7 383 3 atpD ATP synthase subunit beta Dechloromonas aromatica (strain RCB)
A1VFJ5 6.63e-39 149 33 6 296 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain DP4)
Q72E04 6.63e-39 149 33 6 296 3 atpD ATP synthase subunit beta Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A9IYW6 6.68e-39 150 28 10 438 3 atpD ATP synthase subunit beta Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q1CSD5 6.82e-39 149 28 9 381 3 atpD ATP synthase subunit beta Helicobacter pylori (strain HPAG1)
P0DA05 6.83e-39 149 29 9 381 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48UD3 6.83e-39 149 29 9 381 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JMI9 6.83e-39 149 29 9 381 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JCL3 6.83e-39 149 29 9 381 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M12 (strain MGAS2096)
P0DA04 6.83e-39 149 29 9 381 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
B3EA01 6.95e-39 149 28 11 413 3 atpD ATP synthase subunit beta Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
B6EHG4 7.51e-39 149 29 7 364 3 atpD ATP synthase subunit beta Aliivibrio salmonicida (strain LFI1238)
Q24MP1 7.97e-39 149 30 7 323 3 atpD ATP synthase subunit beta Desulfitobacterium hafniense (strain Y51)
A8HS10 8.66e-39 149 29 9 392 3 atpD ATP synthase subunit beta Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P83483 8.93e-39 150 31 9 389 1 At5g08670 ATP synthase subunit beta-1, mitochondrial Arabidopsis thaliana
P83484 9.3e-39 150 31 9 389 1 At5g08690 ATP synthase subunit beta-2, mitochondrial Arabidopsis thaliana
Q7VPP0 9.39e-39 148 31 6 322 3 atpD ATP synthase subunit beta Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q6KI82 9.46e-39 148 33 7 310 3 atpD ATP synthase subunit beta Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
B8FZ34 9.47e-39 148 30 7 323 3 atpD ATP synthase subunit beta Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
C1CSC8 9.73e-39 148 29 8 379 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain Taiwan19F-14)
Q0SQZ5 9.86e-39 148 30 7 328 3 atpD ATP synthase subunit beta Clostridium perfringens (strain SM101 / Type A)
B0BRX2 9.88e-39 148 33 5 295 3 atpD ATP synthase subunit beta Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q5FNZ3 1.01e-38 149 31 10 379 3 atpD2 ATP synthase subunit beta 2 Gluconobacter oxydans (strain 621H)
Q8RC15 1.01e-38 148 29 8 368 3 atpD ATP synthase subunit beta Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q3K441 1.07e-38 148 30 7 361 3 atpD ATP synthase subunit beta Pseudomonas fluorescens (strain Pf0-1)
B5EFI7 1.12e-38 148 28 11 413 3 atpD ATP synthase subunit beta Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q12GQ0 1.13e-38 148 30 9 390 3 atpD ATP synthase subunit beta Polaromonas sp. (strain JS666 / ATCC BAA-500)
A1WF58 1.13e-38 148 30 9 388 3 atpD ATP synthase subunit beta Verminephrobacter eiseniae (strain EF01-2)
C1CLK6 1.13e-38 148 29 8 379 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain P1031)
C1CF93 1.13e-38 148 29 8 379 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain JJA)
B2IQX0 1.13e-38 148 29 8 379 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain CGSP14)
C1C899 1.13e-38 148 29 8 379 3 atpD ATP synthase subunit beta Streptococcus pneumoniae (strain 70585)
Q8XID4 1.15e-38 148 30 7 328 3 atpD ATP synthase subunit beta Clostridium perfringens (strain 13 / Type A)
Q0TNC4 1.15e-38 148 30 7 328 3 atpD ATP synthase subunit beta Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8EM83 1.15e-38 148 31 7 327 3 atpD ATP synthase subunit beta Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B5Z8D0 1.19e-38 148 28 9 381 3 atpD ATP synthase subunit beta Helicobacter pylori (strain G27)
A1U7H4 1.23e-38 148 29 6 381 3 atpD ATP synthase subunit beta Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q9ZK81 1.33e-38 148 28 9 381 3 atpD ATP synthase subunit beta Helicobacter pylori (strain J99 / ATCC 700824)
Q9C5A9 1.34e-38 149 31 9 389 1 At5g08680 ATP synthase subunit beta-3, mitochondrial Arabidopsis thaliana
B1KSS8 1.4e-38 148 28 6 371 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Loch Maree / Type A3)
B5E670 1.42e-38 148 29 9 381 3 atpD ATP synthase subunit beta Streptococcus pneumoniae serotype 19F (strain G54)
Q4FQ37 1.47e-38 148 29 11 401 3 atpD ATP synthase subunit beta Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q6LLG8 1.47e-38 148 32 7 308 3 atpD1 ATP synthase subunit beta 1 Photobacterium profundum (strain SS9)
Q7NA94 1.53e-38 147 31 6 322 3 atpD ATP synthase subunit beta Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8Y4C1 1.59e-38 148 30 9 371 3 atpD2 ATP synthase subunit beta 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71WP9 1.59e-38 148 30 9 371 3 atpD2 ATP synthase subunit beta 2 Listeria monocytogenes serotype 4b (strain F2365)
P42468 1.62e-38 147 30 9 383 3 atpD ATP synthase subunit beta Burkholderia cepacia
Q87KA8 1.62e-38 148 28 8 393 3 atpD ATP synthase subunit beta Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A0ALL3 1.68e-38 148 30 9 371 3 atpD2 ATP synthase subunit beta 2 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q1WUC6 1.68e-38 147 29 7 379 3 atpD ATP synthase subunit beta Ligilactobacillus salivarius (strain UCC118)
Q8F2J5 1.76e-38 147 30 9 379 3 atpD ATP synthase subunit beta Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72SX9 1.76e-38 147 30 9 379 3 atpD ATP synthase subunit beta Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A1UR49 1.91e-38 149 30 10 390 3 atpD ATP synthase subunit beta Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
A9KK92 1.92e-38 147 27 10 433 3 atpD ATP synthase subunit beta Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q2S6P1 1.93e-38 147 29 7 381 3 atpD ATP synthase subunit beta Hahella chejuensis (strain KCTC 2396)
A5CYE2 1.98e-38 147 29 7 366 3 atpD ATP synthase subunit beta Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q313W0 2.08e-38 147 32 7 323 3 atpD ATP synthase subunit beta Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
P12986 2.2e-38 147 27 8 393 1 atpD ATP synthase subunit beta Vibrio alginolyticus
A2RFC2 2.28e-38 147 29 9 381 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M5 (strain Manfredo)
A5HY52 2.28e-38 147 28 6 371 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
C3KYJ3 2.28e-38 147 28 6 371 3 atpD ATP synthase subunit beta Clostridium botulinum (strain 657 / Type Ba4)
A7FQH9 2.28e-38 147 28 6 371 3 atpD ATP synthase subunit beta Clostridium botulinum (strain ATCC 19397 / Type A)
Q9A0I7 2.32e-38 147 29 9 381 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M1
Q39ZU1 2.35e-38 147 29 9 384 3 atpD3 ATP synthase subunit beta 3 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q927W4 2.62e-38 147 30 9 371 3 atpD2 ATP synthase subunit beta 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q1Q899 2.62e-38 147 29 11 401 3 atpD ATP synthase subunit beta Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
C1FQP5 2.71e-38 147 28 6 371 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Kyoto / Type A2)
Q21ZA6 2.75e-38 148 31 7 351 3 atpD2 ATP synthase subunit beta 2 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A5N3H7 2.99e-38 147 30 7 328 3 atpD ATP synthase subunit beta Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
Q8E072 2.99e-38 147 29 8 379 3 atpD ATP synthase subunit beta Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3K1J5 2.99e-38 147 29 8 379 3 atpD ATP synthase subunit beta Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q1MRB8 3.01e-38 147 33 6 300 3 atpD ATP synthase subunit beta Lawsonia intracellularis (strain PHE/MN1-00)
Q8E5U8 3.05e-38 147 29 8 379 3 atpD ATP synthase subunit beta Streptococcus agalactiae serotype III (strain NEM316)
B0THN2 3.2e-38 147 30 6 330 3 atpD ATP synthase subunit beta Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q2GD08 3.22e-38 147 28 8 383 3 atpD ATP synthase subunit beta Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
B4F0E7 3.29e-38 147 28 8 385 3 atpD ATP synthase subunit beta Proteus mirabilis (strain HI4320)
A5WBW1 3.51e-38 147 29 9 396 3 atpD ATP synthase subunit beta Psychrobacter sp. (strain PRwf-1)
Q9A2V9 4.17e-38 148 31 8 347 3 atpD ATP synthase subunit beta Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q17Y78 4.3e-38 146 28 9 384 3 atpD ATP synthase subunit beta Helicobacter acinonychis (strain Sheeba)
A0Q2Z4 4.43e-38 146 30 6 316 3 atpD ATP synthase subunit beta Clostridium novyi (strain NT)
Q98QB6 4.71e-38 146 33 6 287 3 atpD2 ATP synthase subunit beta 2 Mycoplasmopsis pulmonis (strain UAB CTIP)
B0SLC8 4.81e-38 146 31 7 327 3 atpD ATP synthase subunit beta Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SDA5 4.81e-38 146 31 7 327 3 atpD ATP synthase subunit beta Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
B9DRT6 4.91e-38 146 31 5 319 3 atpD ATP synthase subunit beta Streptococcus uberis (strain ATCC BAA-854 / 0140J)
A0LLF8 4.94e-38 146 31 9 354 3 atpD ATP synthase subunit beta Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B5XKQ1 5.11e-38 146 29 9 381 3 atpD ATP synthase subunit beta Streptococcus pyogenes serotype M49 (strain NZ131)
Q07YM7 5.12e-38 146 29 8 379 3 atpD2 ATP synthase subunit beta 2 Shewanella frigidimarina (strain NCIMB 400)
A8AYG1 5.16e-38 146 29 8 379 3 atpD ATP synthase subunit beta Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
P42466 5.19e-38 146 31 6 310 3 atpD ATP synthase subunit beta Herpetosiphon aurantiacus
B9IRT7 5.54e-38 146 32 5 319 3 atpD ATP synthase subunit beta Bacillus cereus (strain Q1)
B7HY64 5.54e-38 146 32 5 319 3 atpD ATP synthase subunit beta Bacillus cereus (strain AH187)
Q72XE8 5.54e-38 146 32 5 319 3 atpD ATP synthase subunit beta Bacillus cereus (strain ATCC 10987 / NRS 248)
A1SS55 5.91e-38 146 30 9 371 3 atpD1 ATP synthase subunit beta 1 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A4VVJ9 6.13e-38 146 29 8 379 3 atpD ATP synthase subunit beta Streptococcus suis (strain 05ZYH33)
A4W1V7 6.13e-38 146 29 8 379 3 atpD ATP synthase subunit beta Streptococcus suis (strain 98HAH33)
B5BIN6 6.49e-38 146 31 7 324 3 atpD ATP synthase subunit beta Salmonella paratyphi A (strain AKU_12601)
Q5PKX2 6.49e-38 146 31 7 324 3 atpD ATP synthase subunit beta Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B2VCA4 6.55e-38 146 30 6 326 3 atpD ATP synthase subunit beta Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C0MH17 6.71e-38 146 29 8 379 3 atpD ATP synthase subunit beta Streptococcus equi subsp. zooepidemicus (strain H70)
B4U2E1 6.71e-38 146 29 8 379 3 atpD ATP synthase subunit beta Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C0M720 6.71e-38 146 29 8 379 3 atpD ATP synthase subunit beta Streptococcus equi subsp. equi (strain 4047)
A9AVV4 6.82e-38 146 30 4 308 3 atpD ATP synthase subunit beta Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
B1JRN2 6.82e-38 146 29 10 386 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q663Q8 6.82e-38 146 29 10 386 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TSJ3 6.82e-38 146 29 10 386 3 atpD ATP synthase subunit beta Yersinia pestis (strain Pestoides F)
Q1CCH5 6.82e-38 146 29 10 386 3 atpD ATP synthase subunit beta Yersinia pestis bv. Antiqua (strain Nepal516)
A9R5T9 6.82e-38 146 29 10 386 3 atpD ATP synthase subunit beta Yersinia pestis bv. Antiqua (strain Angola)
Q7CFM8 6.82e-38 146 29 10 386 3 atpD ATP synthase subunit beta Yersinia pestis
B2K847 6.82e-38 146 29 10 386 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C095 6.82e-38 146 29 10 386 3 atpD ATP synthase subunit beta Yersinia pestis bv. Antiqua (strain Antiqua)
A7FPE0 6.82e-38 146 29 10 386 3 atpD ATP synthase subunit beta Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A7G9Q9 7.15e-38 146 28 6 371 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IE34 7.15e-38 146 28 6 371 3 atpD ATP synthase subunit beta Clostridium botulinum (strain Okra / Type B1)
A8ACN6 7.18e-38 146 31 7 324 3 atpD ATP synthase subunit beta Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q7CPE2 7.47e-38 145 31 7 324 3 atpD ATP synthase subunit beta Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XGX4 7.47e-38 145 31 7 324 3 atpD ATP synthase subunit beta Salmonella typhi
B4TN31 7.47e-38 145 31 7 324 3 atpD ATP synthase subunit beta Salmonella schwarzengrund (strain CVM19633)
C0Q2N2 7.47e-38 145 31 7 324 3 atpD ATP synthase subunit beta Salmonella paratyphi C (strain RKS4594)
A9MXA6 7.47e-38 145 31 7 324 3 atpD ATP synthase subunit beta Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SYD1 7.47e-38 145 31 7 324 3 atpD ATP synthase subunit beta Salmonella newport (strain SL254)
B4TAX2 7.47e-38 145 31 7 324 3 atpD ATP synthase subunit beta Salmonella heidelberg (strain SL476)
B5QUS4 7.47e-38 145 31 7 324 3 atpD ATP synthase subunit beta Salmonella enteritidis PT4 (strain P125109)
B5FN33 7.47e-38 145 31 7 324 3 atpD ATP synthase subunit beta Salmonella dublin (strain CT_02021853)
Q57HX9 7.47e-38 145 31 7 324 3 atpD ATP synthase subunit beta Salmonella choleraesuis (strain SC-B67)
A9MJR9 7.47e-38 145 31 7 324 3 atpD ATP synthase subunit beta Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5EYZ6 7.47e-38 145 31 7 324 3 atpD ATP synthase subunit beta Salmonella agona (strain SL483)
A1JTC6 7.86e-38 145 30 7 343 3 atpD ATP synthase subunit beta Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B5RFW3 7.86e-38 145 31 7 324 3 atpD ATP synthase subunit beta Salmonella gallinarum (strain 287/91 / NCTC 13346)
B8D6S7 7.92e-38 146 29 8 386 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57124 7.92e-38 146 29 8 386 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8H3 7.92e-38 146 29 8 386 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A4WGF5 7.94e-38 145 31 7 313 3 atpD ATP synthase subunit beta Enterobacter sp. (strain 638)
Q180W5 7.96e-38 145 31 7 323 3 atpD ATP synthase subunit beta Clostridioides difficile (strain 630)
A6TG36 8.1e-38 145 31 7 313 3 atpD ATP synthase subunit beta Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q329S1 8.18e-38 145 31 7 324 3 atpD ATP synthase subunit beta Shigella dysenteriae serotype 1 (strain Sd197)
Q21CY7 8.39e-38 146 30 6 333 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain BisB18)
Q3YVN6 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Shigella sonnei (strain Ss046)
P0ABB7 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Shigella flexneri
Q0SYU4 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Shigella flexneri serotype 5b (strain 8401)
Q31UN2 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Shigella boydii serotype 4 (strain Sb227)
B2TUP3 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LK77 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R4K2 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli (strain UTI89 / UPEC)
B1LL59 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli (strain SMS-3-5 / SECEC)
B6I3W9 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli (strain SE11)
B7NF48 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0ABB4 8.44e-38 145 31 7 324 1 atpD ATP synthase subunit beta Escherichia coli (strain K12)
B1IX06 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0ABB5 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAX7 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHR4 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli O1:K1 / APEC
B1X9W0 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli (strain K12 / DH10B)
C4ZZ10 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli (strain K12 / MC4100 / BW2952)
B7M588 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli O8 (strain IAI1)
B7N2H1 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli O81 (strain ED1a)
B7NR34 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YXD6 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ABB6 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli O157:H7
B7L882 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli (strain 55989 / EAEC)
B7MGF2 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMJ7 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZTU4 8.44e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli O139:H28 (strain E24377A / ETEC)
A8A6J5 8.52e-38 145 31 7 324 3 atpD ATP synthase subunit beta Escherichia coli O9:H4 (strain HS)
B5XZM4 8.61e-38 145 31 7 313 3 atpD ATP synthase subunit beta Klebsiella pneumoniae (strain 342)
Q48AW0 8.83e-38 145 28 7 385 3 atpD ATP synthase subunit beta Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
C0Z776 9.14e-38 145 30 6 325 3 atpD ATP synthase subunit beta Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q07232 9.65e-38 145 28 7 384 3 atpD ATP synthase subunit beta Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B9L7Y7 1.01e-37 145 30 9 354 3 atpD ATP synthase subunit beta Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
Q7VQV6 1.05e-37 145 32 10 334 3 atpD ATP synthase subunit beta Blochmanniella floridana
A7MMW9 1.08e-37 145 31 7 313 3 atpD ATP synthase subunit beta Cronobacter sakazakii (strain ATCC BAA-894)
Q2J3I4 1.11e-37 145 30 6 333 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain HaA2)
B9LBM0 1.13e-37 145 30 8 333 3 atpD ATP synthase subunit beta Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WGS4 1.13e-37 145 30 8 333 3 atpD ATP synthase subunit beta Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q831A5 1.17e-37 145 29 8 379 3 atpD ATP synthase subunit beta Enterococcus faecalis (strain ATCC 700802 / V583)
Q0VKX4 1.18e-37 145 29 8 383 3 atpD ATP synthase subunit beta Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q1GQS5 1.19e-37 146 28 11 434 3 atpD ATP synthase subunit beta Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q3A083 1.26e-37 145 31 7 355 3 atpD2 ATP synthase subunit beta 2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q6CYJ5 1.32e-37 145 31 7 328 3 atpD ATP synthase subunit beta Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B6JD09 1.32e-37 145 29 10 376 3 atpD ATP synthase subunit beta Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A4XKX0 1.44e-37 145 29 9 386 3 atpD ATP synthase subunit beta Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A6TK65 1.46e-37 145 30 10 371 3 atpD ATP synthase subunit beta Alkaliphilus metalliredigens (strain QYMF)
A6Q4C0 1.66e-37 145 28 11 418 3 atpD ATP synthase subunit beta Nitratiruptor sp. (strain SB155-2)
Q05FY1 1.72e-37 144 29 8 351 3 atpD ATP synthase subunit beta Carsonella ruddii (strain PV)
P05440 1.75e-37 145 32 13 373 3 atpD ATP synthase subunit beta Fuscovulum blasticum
Q2ST34 1.75e-37 145 33 5 302 3 atpD ATP synthase subunit beta Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
B8J439 1.8e-37 145 33 7 302 3 atpD ATP synthase subunit beta Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q5WB78 1.88e-37 145 30 8 384 3 atpD ATP synthase subunit beta Shouchella clausii (strain KSM-K16)
A4YKE0 2.05e-37 145 30 10 378 3 atpD ATP synthase subunit beta Bradyrhizobium sp. (strain ORS 278)
A6WXX1 2.11e-37 145 29 9 379 3 atpD ATP synthase subunit beta Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q8RGE2 2.14e-37 144 31 7 327 1 atpD ATP synthase subunit beta Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q03235 2.21e-37 145 30 9 380 3 atpD ATP synthase subunit beta Pectinatus frisingensis
Q3B406 2.23e-37 144 30 5 349 3 atpD2 ATP synthase subunit beta 2 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
C6DJH2 2.29e-37 144 31 7 324 3 atpD ATP synthase subunit beta Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q25117 2.3e-37 145 29 10 387 2 None ATP synthase subunit beta, mitochondrial Hemicentrotus pulcherrimus
Q13DP2 2.42e-37 145 30 6 333 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain BisB5)
Q6MS94 2.43e-37 145 32 5 302 3 atpD ATP synthase subunit beta Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q5FRC5 2.44e-37 145 30 9 389 3 atpD1 ATP synthase subunit beta 1 Gluconobacter oxydans (strain 621H)
Q7VJ21 2.47e-37 144 27 9 384 3 atpD ATP synthase subunit beta Helicobacter hepaticus (strain ATCC 51449 / 3B1)
B8G6G6 2.56e-37 144 30 8 333 3 atpD ATP synthase subunit beta Chloroflexus aggregans (strain MD-66 / DSM 9485)
A4J999 2.65e-37 144 27 9 381 3 atpD ATP synthase subunit beta Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
B0T335 2.67e-37 145 31 9 364 3 atpD ATP synthase subunit beta Caulobacter sp. (strain K31)
Q07UZ5 2.81e-37 144 30 6 333 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain BisA53)
Q2NQ86 3.01e-37 144 31 6 311 3 atpD ATP synthase subunit beta Sodalis glossinidius (strain morsitans)
B1W0A3 3.16e-37 144 31 5 329 3 atpD ATP synthase subunit beta Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
A5E950 3.23e-37 144 30 10 378 3 atpD1 ATP synthase subunit beta 1 Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
P43451 3.41e-37 144 28 9 382 3 atpD ATP synthase subunit beta Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
B7JGN0 3.56e-37 144 32 5 321 3 atpD ATP synthase subunit beta Bacillus cereus (strain AH820)
C5BF40 3.65e-37 144 31 7 324 3 atpD ATP synthase subunit beta Edwardsiella ictaluri (strain 93-146)
Q6HAY0 3.86e-37 144 32 5 319 3 atpD ATP synthase subunit beta Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q630U3 3.86e-37 144 32 5 319 3 atpD ATP synthase subunit beta Bacillus cereus (strain ZK / E33L)
C1F0M8 3.86e-37 144 32 5 319 3 atpD ATP synthase subunit beta Bacillus cereus (strain 03BB102)
Q81JZ5 3.86e-37 144 32 5 319 3 atpD ATP synthase subunit beta Bacillus anthracis
A0RL95 3.86e-37 144 32 5 319 3 atpD ATP synthase subunit beta Bacillus thuringiensis (strain Al Hakam)
C3LFH9 3.86e-37 144 32 5 319 3 atpD ATP synthase subunit beta Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P1F4 3.86e-37 144 32 5 319 3 atpD ATP synthase subunit beta Bacillus anthracis (strain A0248)
Q89X74 4.22e-37 144 29 10 391 3 atpD ATP synthase subunit beta Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q2LR05 5.22e-37 144 31 8 342 3 atpD ATP synthase subunit beta Syntrophus aciditrophicus (strain SB)
Q8FYR5 5.39e-37 144 30 6 336 3 atpD ATP synthase subunit beta Brucella suis biovar 1 (strain 1330)
A9WWS2 5.39e-37 144 30 6 336 3 atpD ATP synthase subunit beta Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VSE1 5.39e-37 144 30 6 336 3 atpD ATP synthase subunit beta Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YJ35 5.39e-37 144 30 6 336 3 atpD ATP synthase subunit beta Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M837 5.39e-37 144 30 6 336 3 atpD ATP synthase subunit beta Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
A4ITI9 5.6e-37 144 31 7 312 3 atpD ATP synthase subunit beta Geobacillus thermodenitrificans (strain NG80-2)
A0Q8D9 5.68e-37 143 32 6 312 3 atpD ATP synthase subunit beta Francisella tularensis subsp. novicida (strain U112)
Q57B88 5.96e-37 144 30 6 336 3 atpD ATP synthase subunit beta Brucella abortus biovar 1 (strain 9-941)
Q2YLE6 5.96e-37 144 30 6 336 3 atpD ATP synthase subunit beta Brucella abortus (strain 2308)
P22068 6.14e-37 144 30 12 399 1 atp2 ATP synthase subunit beta, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5KUJ3 6.19e-37 144 31 7 312 1 atpD ATP synthase subunit beta Geobacillus kaustophilus (strain HTA426)
Q162S9 6.35e-37 144 30 10 373 3 atpD ATP synthase subunit beta Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B1I6J7 6.42e-37 143 28 6 376 3 atpD ATP synthase subunit beta Desulforudis audaxviator (strain MP104C)
Q9LA80 6.51e-37 143 31 7 312 3 atpD ATP synthase subunit beta Geobacillus thermoleovorans
A9VSA3 6.72e-37 143 32 5 321 3 atpD ATP synthase subunit beta Bacillus mycoides (strain KBAB4)
Q8KDL4 7.21e-37 143 28 8 368 3 atpD1 ATP synthase subunit beta 1 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B0TWS7 7.24e-37 143 31 7 350 3 atpD ATP synthase subunit beta Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q0QEP2 7.29e-37 141 31 7 338 1 ATP5F1B ATP synthase subunit beta, mitochondrial (Fragment) Mesocricetus auratus
P33253 8.99e-37 143 26 10 426 3 atpD ATP synthase subunit beta Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
A7IH31 9.01e-37 143 31 6 339 3 atpD ATP synthase subunit beta Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
B8FGT4 9.79e-37 143 30 11 382 3 atpD ATP synthase subunit beta Desulfatibacillum aliphaticivorans
A0JY64 1.03e-36 143 30 5 322 3 atpD ATP synthase subunit beta Arthrobacter sp. (strain FB24)
Q6NDD2 1.04e-36 143 30 6 333 3 atpD ATP synthase subunit beta Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q3SVJ1 1.06e-36 143 29 8 368 3 atpD ATP synthase subunit beta Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B7IQV8 1.11e-36 143 34 3 254 3 atpD ATP synthase subunit beta Bacillus cereus (strain G9842)
Q1LTV4 1.14e-36 142 33 5 289 3 atpD ATP synthase subunit beta Baumannia cicadellinicola subsp. Homalodisca coagulata
Q814W2 1.16e-36 142 34 3 254 3 atpD ATP synthase subunit beta Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HFK1 1.16e-36 142 34 3 254 3 atpD ATP synthase subunit beta Bacillus cereus (strain B4264)
Q9Z687 1.18e-36 142 32 2 253 3 atpD ATP synthase subunit beta Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q6AQ10 1.43e-36 142 30 7 352 3 atpD ATP synthase subunit beta Desulfotalea psychrophila (strain LSv54 / DSM 12343)
P42469 1.46e-36 142 28 12 390 3 atpD ATP synthase subunit beta Stigmatella aurantiaca
A8G7M8 1.47e-36 142 31 6 311 3 atpD ATP synthase subunit beta Serratia proteamaculans (strain 568)
P0A301 1.5e-36 142 31 7 332 1 atpD ATP synthase subunit beta Streptomyces lividans
P0A300 1.5e-36 142 31 7 332 3 atpD ATP synthase subunit beta Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A7HIX7 1.6e-36 142 28 10 388 3 atpD ATP synthase subunit beta Anaeromyxobacter sp. (strain Fw109-5)
A7GV56 1.61e-36 142 34 3 252 3 atpD ATP synthase subunit beta Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A4IW24 1.64e-36 142 32 6 312 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NIK3 1.64e-36 142 32 6 312 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14K06 1.64e-36 142 32 6 312 3 atpD ATP synthase subunit beta Francisella tularensis subsp. tularensis (strain FSC 198)
A8MJV9 1.65e-36 142 29 9 373 3 atpD ATP synthase subunit beta Alkaliphilus oremlandii (strain OhILAs)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS10635
Feature type CDS
Gene sctN
Product type III secretion system ATPase SctN
Location 257461 - 258753 (strand: 1)
Length 1293 (nucleotides) / 430 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1459
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00006 ATP synthase alpha/beta family, nucleotide-binding domain
PF18269 T3SS EscN ATPase C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1157 Cell motility (N)
Intracellular trafficking, secretion, and vesicular transport (U)		 NU Flagellar biosynthesis/type III secretory pathway ATPase FliI

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K22506 type III secretion system ATPase [EC:7.4.2.8] - -

Protein Sequence

MLDSFISHRAFPVHIQGYYLEAPLPRVFIGEICLLWQDTSCQVLIGRAQVVGFNEKYTLLSLIGRACGLTLTTVIAPTGERLTLSFTRQIPGSVIDPSGNTLIRLSEPVVSDQRTITRLISADAPDVLSRQRITEIIPTGVKALDGLLTCGKGQRLGIFAGAGCGKTVLMNMLIDHADADIFIIALIGERGREVTELIDDLQKSANAAKCILVCSTSDKPAIDRCNAALVATSLAEYYRDEGKDVVLFVDSLTRYGRALRDVALSAGELPVRLGFPASVFEQLPALLERPGATKNGVITAFYTVLLESEDEPDGFADEVRSILDGHIYLSRRLAMSNHYPAIDILASISRVMSQIASPEHLSAAGQFRHFLAKQKELKLLVELGEYKTGFNPDNDKAVALTEEMRNFLCQPPAKSVPLSEVCNALQSLTA

Flanking regions ( +/- flanking 50bp)

TTTGTCTGTGTTTATCAGCAGTGTTATGCACTGATCCTGCGGGCCTGATTATGCTGGATTCATTCATCAGTCATCGGGCTTTTCCGGTTCATATTCAGGGGTATTATCTGGAAGCACCGCTTCCCCGGGTCTTTATCGGGGAGATTTGTCTGTTATGGCAGGATACGTCGTGTCAGGTTTTAATCGGACGGGCGCAGGTGGTCGGATTTAATGAAAAATATACCCTTCTGAGCCTGATTGGCAGGGCGTGTGGCCTGACACTGACAACCGTCATTGCACCCACCGGTGAACGCCTGACATTATCCTTTACCCGGCAGATCCCGGGCTCGGTGATTGATCCGTCAGGAAACACGCTGATCAGGCTAAGTGAACCGGTGGTAAGTGATCAGCGGACAATCACACGATTGATTAGTGCTGATGCGCCGGATGTACTGTCACGTCAGCGCATCACGGAAATTATTCCTACCGGTGTGAAAGCCCTTGATGGCTTGCTGACCTGTGGAAAAGGGCAGCGGCTGGGCATTTTTGCCGGTGCCGGGTGTGGTAAAACAGTGCTGATGAATATGCTGATTGATCACGCCGACGCTGATATTTTTATCATTGCATTAATTGGTGAGCGGGGACGGGAAGTCACGGAACTGATTGACGACCTGCAAAAAAGTGCCAATGCGGCTAAATGTATCCTGGTCTGTTCGACATCAGATAAACCGGCAATTGATCGCTGCAATGCGGCGCTGGTGGCGACATCTCTGGCGGAATATTACCGTGATGAGGGGAAAGATGTTGTTTTGTTTGTTGATTCTCTGACCCGCTACGGGCGCGCATTGCGGGATGTGGCACTGAGTGCCGGAGAATTGCCGGTACGGCTGGGGTTTCCTGCCTCCGTATTTGAACAGCTTCCGGCACTTCTGGAGCGCCCGGGTGCGACAAAAAACGGGGTGATTACGGCGTTTTATACCGTATTGCTGGAAAGTGAAGACGAGCCCGATGGCTTCGCGGATGAAGTCCGTTCTATCCTTGACGGACACATTTATCTTTCGCGGCGGCTGGCGATGAGTAATCACTATCCGGCGATTGATATTCTTGCCAGCATCAGCCGGGTGATGTCTCAGATTGCCTCTCCTGAACATTTATCCGCTGCAGGACAATTTCGCCATTTCCTGGCAAAACAGAAAGAGCTGAAACTGCTGGTCGAGCTGGGCGAATACAAAACCGGGTTTAATCCGGACAACGATAAAGCAGTGGCACTGACAGAAGAAATGCGTAATTTTTTGTGTCAGCCACCGGCAAAATCAGTGCCTTTGAGTGAGGTCTGTAATGCGCTGCAAAGCCTTACAGCGTGAGGTCAGACAGCTGATTGCACATTTCAGTCTGAAAGAGCGCTATGCTGAGA