Homologs in group_343

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14075 FBDBKF_14075 31.0 Morganella morganii S1 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase
EHELCC_08205 EHELCC_08205 31.0 Morganella morganii S2 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase
NLDBIP_08530 NLDBIP_08530 31.0 Morganella morganii S4 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase
LHKJJB_05735 LHKJJB_05735 31.0 Morganella morganii S3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase
HKOGLL_05180 HKOGLL_05180 31.0 Morganella morganii S5 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase
F4V73_RS02860 F4V73_RS02860 29.8 Morganella psychrotolerans menB 1,4-dihydroxy-2-naphthoyl-CoA synthase
PMI_RS08555 PMI_RS08555 30.6 Proteus mirabilis HI4320 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase

Distribution of the homologs in the orthogroup group_343

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_343

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8GB17 0.0 528 100 0 261 1 caiD Carnitinyl-CoA dehydratase Proteus sp. (strain LE138)
B4EY26 0.0 528 100 0 261 3 caiD Carnitinyl-CoA dehydratase Proteus mirabilis (strain HI4320)
P31551 2.07e-161 451 82 0 261 1 caiD Carnitinyl-CoA dehydratase Escherichia coli (strain K12)
B1IRE0 2.07e-161 451 82 0 261 3 caiD Carnitinyl-CoA dehydratase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8FLA6 2.5e-161 450 82 0 261 3 caiD Carnitinyl-CoA dehydratase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLV3 2.5e-161 450 82 0 261 3 caiD Carnitinyl-CoA dehydratase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8XA35 4.18e-161 450 82 0 261 3 caiD Carnitinyl-CoA dehydratase Escherichia coli O157:H7
P59395 8.53e-161 449 82 0 261 3 caiD Carnitinyl-CoA dehydratase Shigella flexneri
B1LFW9 1.04e-160 449 82 0 261 3 caiD Carnitinyl-CoA dehydratase Escherichia coli (strain SMS-3-5 / SECEC)
B5RGA4 2.98e-160 447 81 0 261 3 caiD Carnitinyl-CoA dehydratase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R1Q9 2.98e-160 447 81 0 261 3 caiD Carnitinyl-CoA dehydratase Salmonella enteritidis PT4 (strain P125109)
B5BL54 3.11e-160 447 82 0 261 3 caiD Carnitinyl-CoA dehydratase Salmonella paratyphi A (strain AKU_12601)
C0Q4L2 3.11e-160 447 82 0 261 3 caiD Carnitinyl-CoA dehydratase Salmonella paratyphi C (strain RKS4594)
Q5PIL1 3.11e-160 447 82 0 261 3 caiD Carnitinyl-CoA dehydratase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57TJ1 3.11e-160 447 82 0 261 3 caiD Carnitinyl-CoA dehydratase Salmonella choleraesuis (strain SC-B67)
B5F749 3.11e-160 447 82 0 261 3 caiD Carnitinyl-CoA dehydratase Salmonella agona (strain SL483)
A8ALR7 4.18e-160 447 82 0 261 3 caiD Carnitinyl-CoA dehydratase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A9MYJ5 7.48e-160 447 81 0 261 3 caiD Carnitinyl-CoA dehydratase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5FHG4 7.48e-160 447 81 0 261 3 caiD Carnitinyl-CoA dehydratase Salmonella dublin (strain CT_02021853)
Q8Z9L5 1.12e-159 446 81 0 261 3 caiD Carnitinyl-CoA dehydratase Salmonella typhi
B4T6J5 1.96e-159 446 81 0 261 3 caiD Carnitinyl-CoA dehydratase Salmonella newport (strain SL254)
Q8ZRX5 2.82e-159 445 81 0 261 3 caiD Carnitinyl-CoA dehydratase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TWR3 2.82e-159 445 81 0 261 3 caiD Carnitinyl-CoA dehydratase Salmonella schwarzengrund (strain CVM19633)
B4TIG9 2.82e-159 445 81 0 261 3 caiD Carnitinyl-CoA dehydratase Salmonella heidelberg (strain SL476)
A9MR28 3.31e-154 432 80 0 261 3 caiD Carnitinyl-CoA dehydratase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
G4V4T7 3.47e-59 191 41 6 270 1 dpgD Enoyl-CoA-hydratase Amycolatopsis orientalis
Q9KJE7 4.95e-51 170 39 5 258 1 bbsH (E)-benzylidenesuccinyl-CoA hydratase Thauera aromatica
A4YI89 4.13e-47 160 37 4 261 1 Msed_2001 3-hydroxypropionyl-coenzyme A dehydratase Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
Q1ZXF1 5.44e-45 155 35 4 253 3 echs1 Probable enoyl-CoA hydratase, mitochondrial Dictyostelium discoideum
Q4WF54 1.59e-44 154 37 7 271 1 sidH Mevalonyl-coenzyme A hydratase sidH Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P52046 5.25e-44 152 35 4 262 1 crt Short-chain-enoyl-CoA hydratase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A0R4Q3 1.23e-42 149 36 6 257 3 echA19 Enoyl-CoA hydratase EchA19 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
O53561 2.97e-42 148 36 6 258 1 echA19 Enoyl-CoA hydratase EchA19 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNN9 3.34e-42 147 38 5 251 1 echA8 Probable enoyl-CoA hydratase EchA8 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNN8 3.34e-42 147 38 5 251 3 echA8 Probable enoyl-CoA hydratase echA8 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P64017 3.34e-42 147 38 5 251 3 echA8 Probable enoyl-CoA hydratase echA8 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P34559 6.34e-42 147 34 4 253 3 ech-6 Probable enoyl-CoA hydratase, mitochondrial Caenorhabditis elegans
P30084 3.49e-41 146 35 4 245 1 ECHS1 Enoyl-CoA hydratase, mitochondrial Homo sapiens
P14604 6.01e-41 145 35 4 249 1 Echs1 Enoyl-CoA hydratase, mitochondrial Rattus norvegicus
F4JML5 6.02e-41 145 36 5 254 2 At4g16800 Probable enoyl-CoA hydratase 2, mitochondrial Arabidopsis thaliana
Q58DM8 4.32e-40 143 34 4 245 2 ECHS1 Enoyl-CoA hydratase, mitochondrial Bos taurus
P76082 4.76e-40 142 35 5 260 1 paaF 2,3-dehydroadipyl-CoA hydratase Escherichia coli (strain K12)
O34893 7.64e-40 141 35 4 263 3 yngF Putative enoyl-CoA hydratase/isomerase YngF Bacillus subtilis (strain 168)
Q5R646 7.94e-40 142 34 4 245 2 ECHS1 Enoyl-CoA hydratase, mitochondrial Pongo abelii
Q8BH95 8.64e-40 142 34 4 249 1 Echs1 Enoyl-CoA hydratase, mitochondrial Mus musculus
Q0AVM1 8.55e-39 139 35 3 245 1 Swol_1936 Crotonyl-CoA hydratase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q52995 3.65e-38 137 36 7 265 3 fadB1 Probable enoyl-CoA hydratase Rhizobium meliloti (strain 1021)
O07137 5.78e-37 134 35 6 254 3 echA8 Probable enoyl-CoA hydratase echA8 Mycobacterium leprae (strain TN)
Q3TLP5 5.36e-35 130 33 5 259 1 Echdc2 Enoyl-CoA hydratase domain-containing protein 2, mitochondrial Mus musculus
Q86YB7 1.74e-34 128 34 5 255 1 ECHDC2 Enoyl-CoA hydratase domain-containing protein 2, mitochondrial Homo sapiens
Q2TBT3 1.48e-33 126 34 5 254 2 ECHDC2 Enoyl-CoA hydratase domain-containing protein 2, mitochondrial Bos taurus
F9XMX6 5.16e-32 122 32 5 268 3 MYCGRDRAFT_76805 Enoyl-CoA isomerase/hydratase MYCGRDRAFT_76805 Zymoseptoria tritici (strain CBS 115943 / IPO323)
Q54HG7 1.1e-29 116 32 4 242 3 auh Methylglutaconyl-CoA hydratase, mitochondrial Dictyostelium discoideum
Q4PEN0 3.1e-29 114 33 6 260 1 fer4 Enoyl-CoA isomerase/hydratase fer4 Ustilago maydis (strain 521 / FGSC 9021)
P94549 3.3e-29 114 33 4 248 2 fadB Probable enoyl-CoA hydratase Bacillus subtilis (strain 168)
Q4L549 3.12e-28 111 31 5 259 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus haemolyticus (strain JCSC1435)
Q5HQC3 2.01e-27 109 30 5 259 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CPQ4 2.26e-27 109 30 5 259 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q49WG8 2.84e-27 109 30 5 259 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9FHR8 3.24e-27 109 30 5 266 1 DCI1 Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, peroxisomal Arabidopsis thaliana
A0PJR5 3.45e-27 109 31 7 263 2 echdc3 Enoyl-CoA hydratase domain-containing protein 3, mitochondrial Danio rerio
O35459 5.24e-27 109 30 8 271 1 Ech1 Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial Mus musculus
Q8NXA0 5.49e-27 108 30 5 259 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus aureus (strain MW2)
Q6GAG7 5.49e-27 108 30 5 259 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus aureus (strain MSSA476)
Q7A6A9 8e-27 108 30 5 259 1 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus aureus (strain N315)
Q99V48 8e-27 108 30 5 259 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
P23966 8.26e-27 107 29 5 263 1 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Bacillus subtilis (strain 168)
Q6GI37 8.6e-27 107 30 5 259 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus aureus (strain MRSA252)
Q5HH38 8.6e-27 107 30 5 259 1 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus aureus (strain COL)
Q54SS0 1.75e-26 107 29 7 261 3 ech1 Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial Dictyostelium discoideum
B1LME7 4.37e-26 110 35 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli (strain SMS-3-5 / SECEC)
B7NP24 5.14e-26 110 35 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q8FFG4 9.66e-26 109 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B5XVW2 1.13e-25 108 37 4 188 3 fadJ Fatty acid oxidation complex subunit alpha Klebsiella pneumoniae (strain 342)
Q62651 1.14e-25 106 29 8 271 1 Ech1 Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial Rattus norvegicus
B7N5V2 1.23e-25 108 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q13011 1.5e-25 105 32 9 268 1 ECH1 Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial Homo sapiens
Q5RFG0 1.6e-25 105 32 9 268 2 ECH1 Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial Pongo abelii
A0A481WNM8 2.74e-25 107 31 6 263 3 claC Enoyl-CoA isomerase/hydratase claC Penicillium crustosum
B5YXY4 2.87e-25 107 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XCP2 2.87e-25 107 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O157:H7
B1IXA5 3.28e-25 107 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q3YZM2 4.08e-25 107 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Shigella sonnei (strain Ss046)
Q83QQ0 4.08e-25 107 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Shigella flexneri
A8A2L0 4.99e-25 107 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O9:H4 (strain HS)
B7LBJ5 5.28e-25 107 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli (strain 55989 / EAEC)
B7M6M2 5.59e-25 107 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O8 (strain IAI1)
A4WCW6 6.84e-25 106 34 4 190 3 fadJ Fatty acid oxidation complex subunit alpha Enterobacter sp. (strain 638)
B7MY16 7.44e-25 106 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O81 (strain ED1a)
Q1R972 8.11e-25 106 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli (strain UTI89 / UPEC)
Q0TFA6 8.11e-25 106 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADI8 8.11e-25 106 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O1:K1 / APEC
B7MGV7 8.19e-25 106 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O45:K1 (strain S88 / ExPEC)
B2TWV4 8.43e-25 106 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7UFZ8 8.43e-25 106 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q0T2E6 8.59e-25 106 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Shigella flexneri serotype 5b (strain 8401)
A7ZPF8 1.28e-24 105 35 5 200 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O139:H28 (strain E24377A / ETEC)
B6I6Q4 1.38e-24 105 35 5 200 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli (strain SE11)
Q31YB7 1.74e-24 105 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Shigella boydii serotype 4 (strain Sb227)
A6TC19 2.29e-24 105 36 4 188 3 fadJ Fatty acid oxidation complex subunit alpha Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q7MIS5 2.48e-24 105 34 3 178 3 fadJ Fatty acid oxidation complex subunit alpha Vibrio vulnificus (strain YJ016)
Q8DB47 3.71e-24 104 34 3 178 3 fadJ Fatty acid oxidation complex subunit alpha Vibrio vulnificus (strain CMCP6)
A8ADP2 4.38e-24 104 33 5 204 3 fadJ Fatty acid oxidation complex subunit alpha Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q32DJ4 4.73e-24 104 34 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Shigella dysenteriae serotype 1 (strain Sd197)
P77399 4.77e-24 104 33 6 216 1 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli (strain K12)
B1X9L4 4.77e-24 104 33 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli (strain K12 / DH10B)
C4ZVN2 4.77e-24 104 33 6 216 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli (strain K12 / MC4100 / BW2952)
P52045 7.92e-24 99 30 4 219 1 scpB Methylmalonyl-CoA decarboxylase Escherichia coli (strain K12)
Q87MM3 8.08e-24 103 33 3 189 3 fadJ Fatty acid oxidation complex subunit alpha Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6NL24 8.38e-24 99 30 4 228 1 ECHIA Probable enoyl-CoA hydratase 1, peroxisomal Arabidopsis thaliana
A8GH86 1e-23 103 33 5 199 3 fadJ Fatty acid oxidation complex subunit alpha Serratia proteamaculans (strain 568)
P9WNP1 1.04e-23 99 30 9 262 1 echA6 Probable enoyl-CoA hydratase EchA6 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNP0 1.04e-23 99 30 9 262 3 echA6 Probable enoyl-CoA hydratase echA6 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P64015 1.04e-23 99 30 9 262 3 echA6 Probable enoyl-CoA hydratase echA6 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P77467 1.13e-23 99 31 6 256 1 paaG 1,2-epoxyphenylacetyl-CoA isomerase Escherichia coli (strain K12)
P44960 1.21e-23 99 29 6 259 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A7MS61 1.5e-23 102 34 3 185 3 fadJ Fatty acid oxidation complex subunit alpha Vibrio campbellii (strain ATCC BAA-1116)
A9JS71 2.44e-23 99 30 6 246 2 echdc3 Enoyl-CoA hydratase domain-containing protein 3, mitochondrial Xenopus laevis
B4TQC2 3.46e-23 101 33 4 190 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella schwarzengrund (strain CVM19633)
Q8ZNA7 6.54e-23 100 33 4 190 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z4Z0 8.06e-23 100 33 4 190 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella typhi
B4SZR0 8.38e-23 100 33 4 190 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella newport (strain SL254)
B5FPN1 8.46e-23 100 33 4 190 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella dublin (strain CT_02021853)
A9N453 8.7e-23 100 33 4 190 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TCA8 8.78e-23 100 33 4 190 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella heidelberg (strain SL476)
B5EZR9 8.78e-23 100 33 4 190 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella agona (strain SL483)
Q57LW6 9.13e-23 100 33 4 190 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella choleraesuis (strain SC-B67)
B5RCL3 9.48e-23 100 33 4 190 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R3R9 9.48e-23 100 33 4 190 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella enteritidis PT4 (strain P125109)
Q6NYL3 9.86e-23 100 37 5 175 2 ehhadh Peroxisomal bifunctional enzyme Danio rerio
Q0S7P8 1.09e-22 96 29 4 221 1 echA20 (7aS)-7a-methyl-1,5-dioxo-2,3,5,6,7,7a-hexahydro-1H-indene-carboxyl-CoA hydrolase Rhodococcus jostii (strain RHA1)
Q9CLV5 1.82e-22 96 27 6 269 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Pasteurella multocida (strain Pm70)
Q39659 3.4e-22 99 32 7 233 1 None Glyoxysomal fatty acid beta-oxidation multifunctional protein MFP-a Cucumis sativus
Q5QXM1 3.57e-22 99 35 4 184 3 fadJ Fatty acid oxidation complex subunit alpha Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q50130 3.86e-22 95 30 9 259 3 echA6 Probable enoyl-CoA hydratase echA6 Mycobacterium leprae (strain TN)
Q8GYN9 3.93e-22 96 29 6 253 1 MENB 1,4-dihydroxy-2-naphthoyl-CoA synthase, peroxisomal Arabidopsis thaliana
Q5LLW6 4.57e-22 95 35 7 199 1 dmdD Methylthioacryloyl-CoA hydratase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
B5BBA1 4.81e-22 98 32 4 190 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella paratyphi A (strain AKU_12601)
Q5PCX6 4.81e-22 98 32 4 190 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9LCU3 6.25e-22 95 34 5 201 1 fcbB2 4-chlorobenzoyl coenzyme A dehalogenase-2 Arthrobacter sp.
C6DAL7 8.56e-22 97 32 4 196 3 fadJ Fatty acid oxidation complex subunit alpha Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q9TM10 1.06e-21 94 30 6 265 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Cyanidium caldarium
P45361 1.1e-21 91 36 2 157 3 crt Short-chain-enoyl-CoA hydratase (Fragment) Clostridioides difficile
O87873 1.45e-21 93 28 5 257 1 dch Cyclohexa-1,5-dienecarbonyl-CoA hydratase Thauera aromatica
O85078 2e-21 93 33 5 201 1 fcbB1 4-chlorobenzoyl coenzyme A dehalogenase-1 Arthrobacter sp.
Q3K9D8 3.34e-21 95 33 3 183 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas fluorescens (strain Pf0-1)
Q07ZP8 4.55e-21 95 30 5 223 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella frigidimarina (strain NCIMB 400)
Q5SKU3 6.49e-21 92 27 6 254 1 TTHA0550 Putative enoyl-CoA hydratase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P28793 6.74e-21 95 33 3 183 1 fadB Fatty acid oxidation complex subunit alpha Pseudomonas fragi
A1RI92 9.52e-21 94 32 5 204 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella sp. (strain W3-18-1)
B7LLD0 1.11e-20 94 31 5 206 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q96DC8 1.18e-20 92 29 6 251 1 ECHDC3 Enoyl-CoA hydratase domain-containing protein 3, mitochondrial Homo sapiens
Q6D2L7 1.49e-20 94 31 4 198 3 fadJ Fatty acid oxidation complex subunit alpha Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A4Y897 1.98e-20 93 32 5 204 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
C3K613 2.52e-20 93 32 3 183 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas fluorescens (strain SBW25)
Q5ZJ60 2.53e-20 92 30 6 226 2 HIBCH 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial Gallus gallus
Q4KFC4 2.64e-20 93 33 3 173 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q58EB4 3.19e-20 92 30 4 215 2 hibch 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial Danio rerio
Q5XIE6 3.41e-20 92 31 5 218 1 Hibch 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial Rattus norvegicus
A7MH81 3.79e-20 92 32 4 190 3 fadJ Fatty acid oxidation complex subunit alpha Cronobacter sakazakii (strain ATCC BAA-894)
A6WQ25 4.3e-20 92 32 5 204 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella baltica (strain OS185)
P41942 4.51e-20 89 27 4 218 3 B0272.4 Uncharacterized protein B0272.4 Caenorhabditis elegans
Q8ECP7 4.77e-20 92 34 5 200 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P0ABU0 4.81e-20 90 26 5 252 1 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Escherichia coli (strain K12)
P0ABU1 4.81e-20 90 26 5 252 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1JIG4 5.01e-20 92 32 5 197 3 fadB Fatty acid oxidation complex subunit alpha Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A0KV76 5.15e-20 92 34 5 200 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella sp. (strain ANA-3)
Q0HKD1 5.4e-20 92 34 5 200 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella sp. (strain MR-4)
Q0HWN3 5.56e-20 92 34 5 200 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella sp. (strain MR-7)
O69762 5.73e-20 89 31 4 213 1 None Hydroxycinnamoyl-CoA hydratase-lyase Pseudomonas fluorescens
Q3MIE0 9.77e-20 89 28 7 253 2 Echdc3 Enoyl-CoA hydratase domain-containing protein 3, mitochondrial Rattus norvegicus
Q7CQ56 1.04e-19 89 26 5 252 1 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A3D684 1.13e-19 91 32 5 204 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella baltica (strain OS155 / ATCC BAA-1091)
A5JTM5 1.56e-19 88 29 7 235 1 None 4-chlorobenzoyl coenzyme A dehalogenase Pseudomonas sp. (strain CBS-3)
Q7N288 1.63e-19 91 32 2 174 3 fadJ Fatty acid oxidation complex subunit alpha Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8QZS1 1.92e-19 89 32 6 221 1 Hibch 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial Mus musculus
A1JK30 2.07e-19 90 33 5 218 3 fadJ Fatty acid oxidation complex subunit alpha Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q9HZJ2 2.16e-19 90 31 4 191 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02PH8 2.16e-19 90 31 4 191 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UYR6 2.16e-19 90 31 4 191 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas aeruginosa (strain LESB58)
Q668V1 3e-19 90 34 3 176 3 fadJ Fatty acid oxidation complex subunit alpha Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TM82 3.12e-19 90 34 3 176 3 fadJ Fatty acid oxidation complex subunit alpha Yersinia pestis (strain Pestoides F)
Q1CHK2 3.23e-19 90 34 3 176 3 fadJ Fatty acid oxidation complex subunit alpha Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZD45 3.23e-19 90 34 3 176 3 fadJ Fatty acid oxidation complex subunit alpha Yersinia pestis
Q1C660 3.23e-19 90 34 3 176 3 fadJ Fatty acid oxidation complex subunit alpha Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGK1 3.23e-19 90 34 3 176 3 fadJ Fatty acid oxidation complex subunit alpha Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
F1LU71 4.79e-19 87 32 3 225 1 Auh Methylglutaconyl-CoA hydratase, mitochondrial Rattus norvegicus
A6V382 5.25e-19 89 31 4 191 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas aeruginosa (strain PA7)
Q9D7J9 6.14e-19 87 27 6 251 1 Echdc3 Enoyl-CoA hydratase domain-containing protein 3, mitochondrial Mus musculus
Q28FR6 9.25e-19 87 32 4 184 2 hibch 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial Xenopus tropicalis
P9WNN3 1.01e-18 86 31 3 209 1 echA17 Probable enoyl-CoA hydratase EchA17 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNN2 1.01e-18 86 31 3 209 3 echA17 Probable enoyl-CoA hydratase EchA17 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U753 1.01e-18 86 31 3 209 3 echA17 Probable enoyl-CoA hydratase EchA17 Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KN36 1.01e-18 86 31 3 209 3 echA17 Probable enoyl-CoA hydratase EchA17 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7TXE1 1.01e-18 86 31 3 209 1 echA17 Probable enoyl-CoA hydratase EchA17 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A7FDF2 1.07e-18 88 33 5 203 3 fadB Fatty acid oxidation complex subunit alpha Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66FR8 1.1e-18 88 33 5 203 3 fadB Fatty acid oxidation complex subunit alpha Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K0Z6 1.1e-18 88 33 5 203 3 fadB Fatty acid oxidation complex subunit alpha Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q9KT58 1.11e-18 88 31 6 204 3 fadJ Fatty acid oxidation complex subunit alpha Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B1JP63 1.12e-18 88 33 5 203 3 fadB Fatty acid oxidation complex subunit alpha Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TR27 1.12e-18 88 33 5 203 3 fadB Fatty acid oxidation complex subunit alpha Yersinia pestis (strain Pestoides F)
Q1CN99 1.12e-18 88 33 5 203 3 fadB Fatty acid oxidation complex subunit alpha Yersinia pestis bv. Antiqua (strain Nepal516)
A9R754 1.12e-18 88 33 5 203 3 fadB Fatty acid oxidation complex subunit alpha Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAN0 1.12e-18 88 33 5 203 3 fadB Fatty acid oxidation complex subunit alpha Yersinia pestis
Q1C2C4 1.12e-18 88 33 5 203 3 fadB Fatty acid oxidation complex subunit alpha Yersinia pestis bv. Antiqua (strain Antiqua)
A5F2P2 1.16e-18 88 32 6 187 3 fadJ Fatty acid oxidation complex subunit alpha Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
I6Y3U6 1.24e-18 85 27 4 221 1 echA20 (7aS)-7a-methyl-1,5-dioxo-2,3,5,6,7,7a-hexahydro-1H-indene-carboxyl-CoA hydrolase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A8G8D1 1.4e-18 88 31 5 200 3 fadB Fatty acid oxidation complex subunit alpha Serratia proteamaculans (strain 568)
Q6NVY1 1.8e-18 87 29 6 229 1 HIBCH 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial Homo sapiens
A2VDC2 1.82e-18 87 30 3 192 2 hibch 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial Xenopus laevis
A4XSM8 1.95e-18 87 31 3 176 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas mendocina (strain ymp)
Q87ZB2 1.98e-18 87 31 3 173 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q6NMB0 2.19e-18 86 28 6 229 2 At2g30660 Probable 3-hydroxyisobutyryl-CoA hydrolase 3 Arabidopsis thaliana
Q6LTK3 2.21e-18 87 30 2 184 3 fadJ Fatty acid oxidation complex subunit alpha Photobacterium profundum (strain SS9)
Q9JLZ3 2.4e-18 85 30 3 242 1 Auh Methylglutaconyl-CoA hydratase, mitochondrial Mus musculus
Q589W8 3.5e-18 85 30 10 250 3 ACTT3 Enoyl-CoA hydratase ACTT3 Alternaria alternata
Q1I7D4 4.12e-18 87 32 3 183 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas entomophila (strain L48)
Q48GW3 4.99e-18 86 31 3 173 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A4VKA3 6.19e-18 86 31 3 173 3 fadB Fatty acid oxidation complex subunit alpha Stutzerimonas stutzeri (strain A1501)
A5W6H0 7.2e-18 86 32 3 183 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KH74 7.26e-18 86 31 3 183 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas putida (strain GB-1)
Q7U004 9.51e-18 84 30 9 262 3 echA12 Probable enoyl-CoA hydratase echA12 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9LKJ1 9.79e-18 85 29 7 230 1 CHY1 3-hydroxyisobutyryl-CoA hydrolase 1 Arabidopsis thaliana
Q9AHY3 1e-17 85 31 3 183 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas putida
Q88L02 1.45e-17 85 32 3 183 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q4ZRA0 1.49e-17 85 31 3 173 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas syringae pv. syringae (strain B728a)
Q08426 1.86e-17 85 33 3 183 1 EHHADH Peroxisomal bifunctional enzyme Homo sapiens
P9WNN7 2.21e-17 82 30 9 262 1 echA12 Probable enoyl-CoA hydratase EchA12 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNN6 2.21e-17 82 30 9 262 3 echA12 Probable enoyl-CoA hydratase echA12 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B6EGU2 2.4e-17 84 28 6 240 3 fadB Fatty acid oxidation complex subunit alpha Aliivibrio salmonicida (strain LFI1238)
Q13825 2.48e-17 83 31 3 225 1 AUH Methylglutaconyl-CoA hydratase, mitochondrial Homo sapiens
B1J5A5 3.65e-17 84 31 3 186 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas putida (strain W619)
Q93Q12 4.01e-17 84 31 3 183 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas oleovorans
Q7MZ92 4.64e-17 84 30 4 195 3 fadB Fatty acid oxidation complex subunit alpha Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9P4U7 4.7e-17 82 30 10 250 3 AKT3-2 Enoyl-CoA hydratase AKT3-2 Alternaria alternata
Q5R5M8 5.14e-17 83 33 3 183 2 EHHADH Peroxisomal bifunctional enzyme Pongo abelii
B7LTY9 7.03e-17 83 26 7 263 3 fadB Fatty acid oxidation complex subunit alpha Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A7ZU51 8.1e-17 83 26 7 263 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O139:H28 (strain E24377A / ETEC)
B2TVJ5 8.73e-17 83 26 7 263 3 fadB Fatty acid oxidation complex subunit alpha Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1IW61 8.73e-17 83 26 7 263 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7M649 8.73e-17 83 26 7 263 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O8 (strain IAI1)
B7L9A7 8.73e-17 83 26 7 263 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli (strain 55989 / EAEC)
Q3YVC1 9.87e-17 82 26 7 263 3 fadB Fatty acid oxidation complex subunit alpha Shigella sonnei (strain Ss046)
P21177 9.87e-17 82 26 7 263 1 fadB Fatty acid oxidation complex subunit alpha Escherichia coli (strain K12)
B1XAK8 9.87e-17 82 26 7 263 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli (strain K12 / DH10B)
C5A020 9.87e-17 82 26 7 263 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli (strain K12 / MC4100 / BW2952)
B1LM32 1.02e-16 82 27 7 260 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli (strain SMS-3-5 / SECEC)
Q96VB3 1.2e-16 80 29 9 250 3 AFT3-1 Enoyl-CoA hydratase AFT3-1 Alternaria alternata
P53526 1.38e-16 80 32 6 208 3 echA12 Probable enoyl-CoA hydratase echA12 Mycobacterium leprae (strain TN)
A3QFP3 1.4e-16 82 35 3 174 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1S7L6 1.46e-16 82 31 5 200 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q869N6 1.52e-16 80 27 6 245 3 DDB_G0271866 3-hydroxybutyryl-CoA dehydratase-like protein, mitochondrial Dictyostelium discoideum
Q32A21 1.66e-16 82 26 7 263 3 fadB Fatty acid oxidation complex subunit alpha Shigella dysenteriae serotype 1 (strain Sd197)
Q64428 1.73e-16 82 30 3 182 1 Hadha Trifunctional enzyme subunit alpha, mitochondrial Rattus norvegicus
Q83PG1 1.85e-16 82 26 7 263 3 fadB Fatty acid oxidation complex subunit alpha Shigella flexneri
Q0SZ36 1.85e-16 82 26 7 263 3 fadB Fatty acid oxidation complex subunit alpha Shigella flexneri serotype 5b (strain 8401)
Q9P4U9 1.86e-16 80 29 9 250 3 AKT3-1 Enoyl-CoA hydratase AKT3-1 Alternaria alternata
B0TL21 1.89e-16 82 31 4 200 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella halifaxensis (strain HAW-EB4)
A8A6V1 1.96e-16 82 26 7 263 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O9:H4 (strain HS)
B5YY93 2.02e-16 82 26 7 263 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X8I2 2.02e-16 82 26 7 263 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O157:H7
P40802 2.13e-16 79 25 2 191 1 pksI Putative polyketide biosynthesis enoyl-CoA isomerase PksI Bacillus subtilis (strain 168)
B7NV20 2.65e-16 81 26 7 263 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q6LW06 2.72e-16 81 32 3 182 3 fadB Fatty acid oxidation complex subunit alpha Photobacterium profundum (strain SS9)
Q6DAP5 2.81e-16 81 29 5 205 3 fadB Fatty acid oxidation complex subunit alpha Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A7MQP0 2.81e-16 81 28 7 250 3 fadB Fatty acid oxidation complex subunit alpha Cronobacter sakazakii (strain ATCC BAA-894)
B7NFE7 3.03e-16 81 26 7 263 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A4WFX4 3.79e-16 81 26 6 249 3 fadB Fatty acid oxidation complex subunit alpha Enterobacter sp. (strain 638)
B6I4I6 3.79e-16 81 26 7 263 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli (strain SE11)
B5XYH0 4.05e-16 81 32 3 171 3 fadB Fatty acid oxidation complex subunit alpha Klebsiella pneumoniae (strain 342)
O75521 4.31e-16 80 27 5 218 1 ECI2 Enoyl-CoA delta isomerase 2 Homo sapiens
Q9F0Y7 5.27e-16 80 26 7 253 3 fadB Fatty acid oxidation complex subunit alpha Enterobacter cloacae
A5WH99 6.16e-16 80 32 4 181 3 fadB Fatty acid oxidation complex subunit alpha Psychrobacter sp. (strain PRwf-1)
Q8FBI2 7.47e-16 80 29 4 194 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAL0 7.68e-16 80 29 4 194 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7UNH4 7.9e-16 80 29 4 194 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q1R466 8.13e-16 80 29 4 194 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli (strain UTI89 / UPEC)
B7MHD1 8.13e-16 80 29 4 194 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O45:K1 (strain S88 / ExPEC)
A6TGM4 9.18e-16 80 39 0 112 3 fadB Fatty acid oxidation complex subunit alpha Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
O07533 9.35e-16 77 31 9 261 3 yhaR Putative enoyl-CoA hydratase/isomerase YhaR Bacillus subtilis (strain 168)
B7N2F2 1.17e-15 79 29 4 194 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O81 (strain ED1a)
Q87TN9 1.25e-15 79 29 8 256 3 fadB Fatty acid oxidation complex subunit alpha Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8BMS1 1.98e-15 79 29 3 182 1 Hadha Trifunctional enzyme subunit alpha, mitochondrial Mus musculus
Q55GS6 2.3e-15 78 26 8 226 3 hibch 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial Dictyostelium discoideum
Q5QXH7 3.47e-15 78 29 3 184 3 fadB Fatty acid oxidation complex subunit alpha Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q1PEY5 3.64e-15 77 27 6 220 2 At2g30650 Probable 3-hydroxyisobutyryl-CoA hydrolase 2 Arabidopsis thaliana
B4TNZ1 3.87e-15 78 38 0 103 3 fadB Fatty acid oxidation complex subunit alpha Salmonella schwarzengrund (strain CVM19633)
A8ACZ4 4.98e-15 77 38 0 103 3 fadB Fatty acid oxidation complex subunit alpha Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
G4V4T6 5.97e-15 77 30 4 191 1 dpgC (3,5-dihydroxyphenyl)acetyl-CoA 1,2-dioxygenase Amycolatopsis orientalis
Q1Q8J9 7.49e-15 77 30 2 176 3 fadB Fatty acid oxidation complex subunit alpha Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A7N1D2 8.17e-15 77 29 4 192 3 fadB Fatty acid oxidation complex subunit alpha Vibrio campbellii (strain ATCC BAA-1116)
Q5E8X6 1.12e-14 77 32 4 171 3 fadB Fatty acid oxidation complex subunit alpha Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9WUR2 1.18e-14 76 25 7 265 1 Eci2 Enoyl-CoA delta isomerase 2 Mus musculus
V5XZU2 1.25e-14 75 30 8 209 3 AKT6-1 Enoyl-CoA hydratase AKT6-1 Alternaria alternata
B5FEW8 1.29e-14 76 32 4 171 3 fadB Fatty acid oxidation complex subunit alpha Aliivibrio fischeri (strain MJ11)
B1KCZ3 1.42e-14 76 31 2 170 3 fadB Fatty acid oxidation complex subunit alpha Shewanella woodyi (strain ATCC 51908 / MS32)
Q4FQC6 1.42e-14 76 30 2 176 3 fadB Fatty acid oxidation complex subunit alpha Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q9L6L5 1.49e-14 76 38 0 103 3 fadB Fatty acid oxidation complex subunit alpha Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MYB0 1.49e-14 76 38 0 103 3 fadB Fatty acid oxidation complex subunit alpha Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q57HM6 1.49e-14 76 38 0 103 3 fadB Fatty acid oxidation complex subunit alpha Salmonella choleraesuis (strain SC-B67)
B5EZW0 1.49e-14 76 38 0 103 3 fadB Fatty acid oxidation complex subunit alpha Salmonella agona (strain SL483)
B5RFL6 1.55e-14 76 38 0 103 3 fadB Fatty acid oxidation complex subunit alpha Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QW85 1.55e-14 76 38 0 103 3 fadB Fatty acid oxidation complex subunit alpha Salmonella enteritidis PT4 (strain P125109)
Q8Z3C6 1.59e-14 76 38 0 103 3 fadB Fatty acid oxidation complex subunit alpha Salmonella typhi
Q78JN3 1.63e-14 75 27 4 183 1 Eci3 Enoyl-CoA delta isomerase 3, peroxisomal Mus musculus
B5BIZ0 1.85e-14 76 38 0 103 3 fadB Fatty acid oxidation complex subunit alpha Salmonella paratyphi A (strain AKU_12601)
Q5PKQ2 1.85e-14 76 38 0 103 3 fadB Fatty acid oxidation complex subunit alpha Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A0KEL1 2e-14 76 30 5 186 3 fadB Fatty acid oxidation complex subunit alpha Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
C3LSI3 2.03e-14 76 37 0 103 3 fadB Fatty acid oxidation complex subunit alpha Vibrio cholerae serotype O1 (strain M66-2)
Q9KNI1 2.03e-14 76 37 0 103 3 fadB Fatty acid oxidation complex subunit alpha Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A8FP63 2.12e-14 75 39 1 112 3 fadB Fatty acid oxidation complex subunit alpha Shewanella sediminis (strain HAW-EB3)
Q29554 2.24e-14 75 28 3 182 2 HADHA Trifunctional enzyme subunit alpha, mitochondrial Sus scrofa
A5F465 2.25e-14 75 37 0 103 3 fadB Fatty acid oxidation complex subunit alpha Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B4SZ85 2.43e-14 75 38 0 103 3 fadB Fatty acid oxidation complex subunit alpha Salmonella newport (strain SL254)
Q5E3U1 2.5e-14 75 30 4 177 3 fadJ Fatty acid oxidation complex subunit alpha Aliivibrio fischeri (strain ATCC 700601 / ES114)
P55100 3.8e-14 75 33 4 186 2 EHHADH Peroxisomal bifunctional enzyme Cavia porcellus
A0QJH8 4.25e-14 73 30 4 206 3 echA17 Probable enoyl-CoA hydratase echA17 Mycobacterium avium (strain 104)
Q6FF68 4.44e-14 75 32 2 158 3 fadB Fatty acid oxidation complex subunit alpha Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q7MQH9 4.67e-14 75 37 1 111 3 fadB Fatty acid oxidation complex subunit alpha Vibrio vulnificus (strain YJ016)
Q9XB60 4.68e-14 73 28 4 177 1 carB Carboxymethylproline synthase Pectobacterium carotovorum subsp. carotovorum
Q73VC7 4.7e-14 73 30 3 205 3 echA17 Probable enoyl-CoA hydratase echA17 Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8DDK6 4.71e-14 75 37 1 111 3 fadB Fatty acid oxidation complex subunit alpha Vibrio vulnificus (strain CMCP6)
Q8DR19 4.94e-14 73 25 6 252 1 fabM Trans-2-decenoyl-[acyl-carrier-protein] isomerase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B7VGL4 5.53e-14 74 35 0 112 3 fadB Fatty acid oxidation complex subunit alpha Vibrio atlanticus (strain LGP32)
A0QRD3 7.42e-14 73 26 7 269 1 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q5XIC0 1.12e-13 73 27 5 216 1 Eci2 Enoyl-CoA delta isomerase 2 Rattus norvegicus
B0VE45 1.13e-13 73 32 1 149 3 fadB Fatty acid oxidation complex subunit alpha Acinetobacter baumannii (strain AYE)
B7I3P1 1.13e-13 73 32 1 149 3 fadB Fatty acid oxidation complex subunit alpha Acinetobacter baumannii (strain AB0057)
B7H1I0 1.13e-13 73 32 1 149 3 fadB Fatty acid oxidation complex subunit alpha Acinetobacter baumannii (strain AB307-0294)
B2I2J9 1.14e-13 73 32 1 149 3 fadB Fatty acid oxidation complex subunit alpha Acinetobacter baumannii (strain ACICU)
Q8KLK7 1.21e-13 73 28 4 209 1 BU52_01220 (3,5-dihydroxyphenyl)acetyl-CoA 1,2-dioxygenase Streptomyces toyocaensis
A4STF2 1.3e-13 73 30 5 186 3 fadB Fatty acid oxidation complex subunit alpha Aeromonas salmonicida (strain A449)
C5NN19 1.4e-13 72 29 8 212 3 ACTT6 Enoyl-CoA hydratase ACTT6 Alternaria alternata
B0VLX4 1.4e-13 73 32 1 149 3 fadB Fatty acid oxidation complex subunit alpha Acinetobacter baumannii (strain SDF)
A6WHA0 1.42e-13 73 30 3 179 3 fadB Fatty acid oxidation complex subunit alpha Shewanella baltica (strain OS185)
A3CYJ4 1.62e-13 73 30 3 179 3 fadB Fatty acid oxidation complex subunit alpha Shewanella baltica (strain OS155 / ATCC BAA-1091)
V5XZU7 1.87e-13 72 30 8 209 3 AFT6-1 Enoyl-CoA hydratase AFT6-1 Alternaria alternata
A9KU91 3.14e-13 72 30 3 179 3 fadB Fatty acid oxidation complex subunit alpha Shewanella baltica (strain OS195)
Q93TU6 3.21e-13 70 30 5 204 1 camK 6-oxocamphor hydrolase Rhodococcus sp.
Q1K7A4 3.74e-13 72 28 5 178 1 ehd3 Small ribosomal subunit protein mS47 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A3Q8U4 3.82e-13 72 40 1 103 3 fadB Fatty acid oxidation complex subunit alpha Shewanella loihica (strain ATCC BAA-1088 / PV-4)
P28817 4.77e-13 72 26 6 193 1 EHD3 Small ribosomal subunit protein mS47 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B8E3R3 5.76e-13 71 30 3 179 3 fadB Fatty acid oxidation complex subunit alpha Shewanella baltica (strain OS223)
P40939 5.87e-13 71 27 3 182 1 HADHA Trifunctional enzyme subunit alpha, mitochondrial Homo sapiens
Q9SHJ8 7.19e-13 70 26 5 205 1 At1g06550 3-hydroxyisobutyryl-CoA hydrolase-like protein 5 Arabidopsis thaliana
Q9D9V3 8.47e-13 70 26 4 215 1 Echdc1 Ethylmalonyl-CoA decarboxylase Mus musculus
A1S1I8 8.84e-13 71 32 2 153 3 fadB Fatty acid oxidation complex subunit alpha Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B0TLB9 9.9e-13 71 30 3 179 3 fadB Fatty acid oxidation complex subunit alpha Shewanella halifaxensis (strain HAW-EB4)
Q2HJ73 1.15e-12 70 29 4 187 2 HIBCH 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial Bos taurus
P9WNP5 1.31e-12 69 25 7 275 1 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNP4 1.31e-12 69 25 7 275 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A8GYG0 1.46e-12 70 29 2 173 3 fadB Fatty acid oxidation complex subunit alpha Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q8EKR9 1.68e-12 70 30 3 179 3 fadB Fatty acid oxidation complex subunit alpha Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q08A39 2.71e-12 69 36 0 108 3 fadB Fatty acid oxidation complex subunit alpha Shewanella frigidimarina (strain NCIMB 400)
A1RDW6 3e-12 69 30 3 179 3 fadB Fatty acid oxidation complex subunit alpha Shewanella sp. (strain W3-18-1)
A4Y1B6 3e-12 69 30 3 179 3 fadB Fatty acid oxidation complex subunit alpha Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q0I0T3 4.04e-12 69 30 3 179 3 fadB Fatty acid oxidation complex subunit alpha Shewanella sp. (strain MR-7)
A0KR50 4.78e-12 68 37 1 114 3 fadB Fatty acid oxidation complex subunit alpha Shewanella sp. (strain ANA-3)
Q0HPB7 5.6e-12 68 30 3 179 3 fadB Fatty acid oxidation complex subunit alpha Shewanella sp. (strain MR-4)
B8CH91 5.76e-12 68 36 1 112 3 fadB Fatty acid oxidation complex subunit alpha Shewanella piezotolerans (strain WP3 / JCM 13877)
Q9ZPI5 5.78e-12 68 28 4 252 1 MFP2 Peroxisomal fatty acid beta-oxidation multifunctional protein MFP2 Arabidopsis thaliana
O49809 1.23e-11 67 30 2 186 2 None Glyoxysomal fatty acid beta-oxidation multifunctional protein MFP-a Brassica napus
Q6AYG5 1.84e-11 66 25 3 211 1 Echdc1 Ethylmalonyl-CoA decarboxylase Rattus norvegicus
Q489W3 2.53e-11 67 30 2 170 3 fadB Fatty acid oxidation complex subunit alpha Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q9Y232 2.8e-11 66 24 3 179 1 CDYL Chromodomain Y-like protein Homo sapiens
Q6AYK9 3.15e-11 66 24 3 179 1 Cdyl Chromodomain Y-like protein Rattus norvegicus
Q9Y6F8 3.36e-11 66 25 4 176 1 CDY1 Testis-specific chromodomain protein Y 1 Homo sapiens
Q8DSN0 3.43e-11 65 25 6 258 3 fabM Trans-2-decenoyl-[acyl-carrier-protein] isomerase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q9Y6F7 4.05e-11 66 24 7 244 1 CDY2A Testis-specific chromodomain protein Y 2 Homo sapiens
P24162 4.16e-11 64 33 6 250 3 fadB1 Probable enoyl-CoA hydratase Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q9WTK2 5.99e-11 65 24 3 179 1 Cdyl Chromodomain Y-like protein Mus musculus
Q8W1L6 1.8e-10 64 31 5 190 1 MFP Peroxisomal fatty acid beta-oxidation multifunctional protein Oryza sativa subsp. japonica
P95279 2.29e-10 63 30 8 231 2 echA13 Putative enoyl-CoA hydratase EchA13 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q84HH6 2.34e-10 63 25 9 222 1 boxC Benzoyl-CoA-dihydrodiol lyase Aromatoleum evansii
Q5XF59 2.66e-10 63 25 5 199 1 At3g60510 3-hydroxyisobutyryl-CoA hydrolase-like protein 1, mitochondrial Arabidopsis thaliana
Q9D5D8 4.53e-10 63 28 0 132 1 Cdyl2 Chromodomain Y-like protein 2 Mus musculus
Q8N8U2 5.51e-10 62 33 1 108 1 CDYL2 Chromodomain Y-like protein 2 Homo sapiens
P07896 5.86e-10 62 31 4 195 1 Ehhadh Peroxisomal bifunctional enzyme Rattus norvegicus
Q2HJD5 6.81e-10 62 24 4 218 2 ECHDC1 Ethylmalonyl-CoA decarboxylase Bos taurus
Q9DBM2 6.85e-10 62 32 3 177 1 Ehhadh Peroxisomal bifunctional enzyme Mus musculus
O74802 7.14e-10 62 30 5 169 1 snr1 Small ribosomal subunit protein mS47 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P9WNN5 7.36e-10 61 32 5 217 1 echA14 Probable enoyl-CoA hydratase EchA14 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNN4 7.36e-10 61 32 5 217 3 echA14 Probable enoyl-CoA hydratase echA14 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P64019 7.36e-10 61 32 5 217 1 echA14 Probable enoyl-CoA hydratase echA14 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8RXN4 7.79e-10 62 26 6 171 1 At4g31810 Small ribosomal subunit protein mS47 Arabidopsis thaliana
Q5R4W0 1.91e-09 60 24 4 215 2 ECHDC1 Ethylmalonyl-CoA decarboxylase Pongo abelii
Q9NTX5 5.61e-09 59 23 4 215 1 ECHDC1 Ethylmalonyl-CoA decarboxylase Homo sapiens
Q9LK08 6.48e-09 59 25 4 179 2 At3g24360 3-hydroxyisobutyryl-CoA hydrolase-like protein 4, mitochondrial Arabidopsis thaliana
Q28C91 1.63e-08 57 28 3 175 2 echdc1 Ethylmalonyl-CoA decarboxylase Xenopus tropicalis
F1NB38 1.77e-08 57 26 3 202 3 ECHDC1 Ethylmalonyl-CoA decarboxylase Gallus gallus
Q5HZQ8 2.03e-08 57 28 3 175 2 echdc1 Ethylmalonyl-CoA decarboxylase Xenopus laevis
O23300 1.11e-07 54 29 6 157 1 ECI3 Enoyl-CoA delta isomerase 3 Arabidopsis thaliana
F1R6N4 1.3e-07 55 26 4 188 3 echdc1 Ethylmalonyl-CoA decarboxylase Danio rerio
Q9T0K7 1.71e-07 55 25 4 179 1 At4g13360 3-hydroxyisobutyryl-CoA hydrolase-like protein 3, mitochondrial Arabidopsis thaliana
Q39TV7 2.18e-07 54 28 6 183 1 bamA 6-oxocyclohex-1-ene-1-carbonyl-CoA hydrolase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q9ZPI6 2.05e-06 52 33 0 106 1 AIM1 Peroxisomal fatty acid beta-oxidation multifunctional protein AIM1 Arabidopsis thaliana
P42125 4.25e-06 50 26 4 186 1 Eci1 Enoyl-CoA delta isomerase 1, mitochondrial Mus musculus
O04469 7.89e-06 49 26 4 164 1 ECI1 Enoyl-CoA delta isomerase 1, peroxisomal Arabidopsis thaliana
O87872 9.78e-06 49 27 6 185 1 oah 6-oxocyclohex-1-ene-1-carbonyl-CoA hydrolase Thauera aromatica
P42126 1.3e-05 49 28 5 175 1 ECI1 Enoyl-CoA delta isomerase 1, mitochondrial Homo sapiens
P23965 4.26e-05 47 27 4 183 1 Eci1 Enoyl-CoA delta isomerase 1, mitochondrial Rattus norvegicus

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS13095
Feature type CDS
Gene caiD
Product crotonobetainyl-CoA hydratase
Location 2908193 - 2908978 (strand: 1)
Length 786 (nucleotides) / 261 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_343
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00378 Enoyl-CoA hydratase/isomerase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1024 Lipid transport and metabolism (I) I Enoyl-CoA hydratase/carnithine racemase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K08299 crotonobetainyl-CoA hydratase [EC:4.2.1.149] - -

Protein Sequence

MSQSLHLTTRGSVLEIILDRPKANAIDAKTSHEMGEVFMRFRDDPSLRVAIITGAGERFFCAGWDLKAAAEGEAPDADFGAGGFAGLTELFDLNKPVIAAINGYAFGGGFELALAADMIICSDNASFALPEAQLGIVPDSGGVLRLPKRLPPAIVNEMLMTGRRMNAQEALRWGIANRVVSATELMDSARELADQIANSAPLAVAALKEIYRATSELSIEEGYKLMRSGVLKYYPRVLHSEDALEGPLAFAEKRSPEWKGR

Flanking regions ( +/- flanking 50bp)

TCGTGACAGTTAATTATAACTGCTTATTTTTATTGAAAAAGGAATATGACATGAGCCAATCATTACATCTAACAACACGTGGTTCAGTGCTTGAAATTATATTAGATAGACCGAAAGCCAATGCAATTGATGCCAAAACCAGTCATGAAATGGGTGAGGTATTTATGCGTTTTCGTGATGATCCTAGTTTACGCGTTGCCATTATTACAGGTGCTGGTGAACGATTCTTTTGTGCCGGTTGGGATTTGAAAGCCGCAGCTGAAGGAGAAGCCCCTGATGCAGACTTTGGTGCTGGTGGCTTTGCGGGCTTAACGGAATTATTTGATCTTAATAAACCTGTCATTGCTGCCATTAACGGCTATGCTTTTGGGGGTGGCTTTGAATTAGCACTGGCAGCCGACATGATAATTTGTTCAGACAATGCTTCTTTTGCCTTGCCAGAAGCACAATTAGGTATTGTTCCTGACAGTGGCGGTGTTTTACGTTTACCTAAACGCTTACCTCCTGCAATTGTCAATGAAATGCTCATGACTGGCCGTCGTATGAATGCACAAGAGGCGCTACGCTGGGGCATTGCTAACCGCGTTGTCAGTGCGACTGAACTGATGGATAGCGCCCGTGAATTAGCCGATCAAATCGCCAACAGTGCGCCACTTGCAGTCGCTGCATTAAAAGAGATCTACCGTGCCACTAGCGAGCTTTCGATTGAAGAAGGCTACAAATTAATGCGCAGTGGTGTTCTAAAATATTACCCACGTGTTTTACATTCAGAAGATGCACTCGAAGGCCCGCTAGCCTTTGCCGAAAAACGCTCACCTGAATGGAAAGGACGGTAATTATCACTTGAATTGATAATACAACTAAGAGGAAAACTGATGAGTATCTA