Homologs in group_795

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03730 FBDBKF_03730 81.2 Morganella morganii S1 nuoL hydrogenase 4 subunit D
EHELCC_06805 EHELCC_06805 81.2 Morganella morganii S2 nuoL hydrogenase 4 subunit D
NLDBIP_07130 NLDBIP_07130 81.2 Morganella morganii S4 nuoL hydrogenase 4 subunit D
LHKJJB_06665 LHKJJB_06665 81.2 Morganella morganii S3 nuoL hydrogenase 4 subunit D
HKOGLL_04265 HKOGLL_04265 81.2 Morganella morganii S5 nuoL hydrogenase 4 subunit D
F4V73_RS11140 F4V73_RS11140 81.7 Morganella psychrotolerans - hydrogenase 4 subunit D

Distribution of the homologs in the orthogroup group_795

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_795

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P77416 0.0 688 70 0 478 3 hyfD Hydrogenase-4 component D Escherichia coli (strain K12)
Q4L4W7 7.77e-51 188 33 11 429 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus haemolyticus (strain JCSC1435)
Q9ZCG1 1.32e-49 182 30 10 437 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia prowazekii (strain Madrid E)
P31971 2.25e-49 182 35 12 371 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q32238 5.67e-49 182 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Flaveria ramosissima
Q9PMA7 1.41e-48 179 30 9 405 3 nuoL NADH-quinone oxidoreductase subunit L Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q32091 2.51e-48 180 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carthamus tinctorius
Q32551 2.56e-48 180 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mutisia acuminata
Q859V1 3.8e-48 179 30 12 438 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anthoceros angustus
Q32384 3.83e-48 180 32 13 387 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Helianthus annuus
Q32126 4.02e-48 180 32 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dampiera diversifolia
Q9RGZ5 4.05e-48 180 33 13 432 1 mrpA Na(+)/H(+) antiporter subunit A Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q0G9R5 4.41e-48 179 32 10 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Daucus carota
P51095 4.75e-48 179 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adenocaulon himalaicum
Q31849 5.63e-48 179 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ambrosia trifida
P51098 7.14e-48 179 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Athroisma gracile
B2LMQ1 8.79e-48 179 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Guizotia abyssinica
P33607 9.23e-48 177 32 11 416 1 nuoL NADH-quinone oxidoreductase subunit L Escherichia coli (strain K12)
Q68VV7 1.37e-47 177 30 9 430 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q32007 1.41e-47 178 33 11 366 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cichorium intybus
Q49W91 1.75e-47 178 31 11 429 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q92G97 1.88e-47 177 30 9 430 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P51097 4.19e-47 177 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Symphyotrichum cordifolium
P51099 5.89e-47 176 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atractylodes lancea
Q32539 6.84e-47 176 33 11 366 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lactuca sativa
Q68RV9 8.09e-47 176 32 11 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Panax ginseng
P51096 1.5e-46 175 32 10 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anisothrix integra
P60675 1.62e-46 176 34 10 391 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain N315)
P60674 1.62e-46 176 34 10 391 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRD0 1.62e-46 176 34 10 391 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH9)
A6U059 1.62e-46 176 34 10 391 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH1)
A7X0G4 1.62e-46 176 34 10 391 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NXF6 1.8e-46 176 34 10 391 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MW2)
A8Z059 1.8e-46 176 34 10 391 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GAX4 1.8e-46 176 34 10 391 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MSSA476)
A6QFG2 1.8e-46 176 34 10 391 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Newman)
Q5HHD3 1.8e-46 176 34 10 391 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain COL)
Q2FZV1 1.8e-46 176 34 10 391 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIC3 1.8e-46 176 34 10 391 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300)
Q9ZNG6 1.82e-46 176 34 10 391 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus
Q1RKE6 2.31e-46 174 30 10 433 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia bellii (strain RML369-C)
Q55429 2.33e-46 174 34 10 364 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A0A382 2.34e-46 175 32 10 367 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Coffea arabica
Q6GID6 3.11e-46 175 34 10 391 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MRSA252)
Q2YWT4 3.46e-46 175 34 10 391 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8CPU8 3.81e-46 174 34 6 346 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQL0 3.81e-46 174 34 6 346 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q2L960 3.89e-46 174 31 9 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium hirsutum
Q9MUK8 4.01e-46 173 33 10 363 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mesostigma viride
Q9TLC2 5.16e-46 174 32 11 378 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Tecoma stans
Q8S8V0 5.53e-46 174 32 11 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atropa belladonna
A0ZZ82 6.53e-46 173 31 9 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium barbadense
Q9TKV7 7.18e-46 172 32 8 369 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nephroselmis olivacea
Q8W8H5 8.03e-46 173 33 10 366 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Psilotum nudum
B1X491 9e-46 172 32 8 365 3 ndhF1 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 1 Paulinella chromatophora
B1VKJ3 1.07e-45 173 34 11 363 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cryptomeria japonica
Q4UK27 1.12e-45 172 29 9 430 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q2VED3 1.16e-45 172 32 11 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum tuberosum
Q32516 1.23e-45 172 32 11 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum lycopersicum
Q2MIE0 1.23e-45 172 32 11 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum bulbocastanum
A7Y3K7 1.4e-45 172 32 11 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ipomoea purpurea
Q2QD43 1.71e-45 172 32 10 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cucumis sativus
Q32RH9 1.72e-45 172 33 12 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zygnema circumcarinatum
Q33BX5 2.24e-45 172 32 11 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tomentosiformis
Q33113 2.26e-45 171 31 11 378 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Sesamum indicum
Q31952 2.39e-45 171 32 11 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Capsicum baccatum
A4GGE3 2.87e-45 172 32 9 356 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Phaseolus vulgaris
Q9M3J4 2.87e-45 172 32 11 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Spinacia oleracea
P06265 3.41e-45 171 32 11 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tabacum
Q3C1N9 3.54e-45 171 32 11 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana sylvestris
P51100 3.69e-45 171 32 11 369 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gerbera jamesonii
Q9XAR5 3.83e-45 170 33 9 427 3 nuoL NADH-quinone oxidoreductase subunit L Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9K2S2 4.89e-45 171 33 12 420 1 mrpA Na(+)/H(+) antiporter subunit A Bacillus subtilis (strain 168)
B0Z5H4 5.11e-45 171 33 12 389 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera parviflora
B0Z590 5.11e-45 171 33 12 389 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera glazioviana
B0Z506 5.11e-45 171 33 12 389 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera biennis
B0Z4S2 5.11e-45 171 33 12 389 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera argillicola
A9L9E4 5.16e-45 171 33 9 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lemna minor
Q6EW03 5.46e-45 171 31 11 374 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nymphaea alba
Q9MTI4 6.04e-45 171 33 12 389 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera elata subsp. hookeri
Q09FR3 6.73e-45 171 31 11 379 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nandina domestica
Q06GK2 7.81e-45 170 31 10 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Piper cenocladum
P57262 8.06e-45 169 33 9 364 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q49KV1 8.24e-45 170 33 10 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Eucalyptus globulus subsp. globulus
Q9TLA3 9e-45 170 31 12 379 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ligustrum vulgare
Q32131 9.16e-45 170 31 10 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Digitalis grandiflora
A1XG02 1.53e-44 169 32 10 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nuphar advena
Q9MVL6 1.89e-44 169 31 10 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Malvaviscus arboreus
Q9I0J1 6.6e-44 166 32 12 433 3 nuoL NADH-quinone oxidoreductase subunit L Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q32S06 1.05e-43 166 33 9 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Staurastrum punctulatum
Q9MVK2 1.35e-43 166 30 10 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Pachira aquatica
B3TN96 1.77e-43 166 33 12 387 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Brachypodium distachyon
Q32440 2.29e-43 166 32 12 387 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Hordeum vulgare
A4QLP4 2.35e-43 166 33 9 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lobularia maritima
Q52978 2.63e-43 167 30 13 494 3 phaAB Probable K(+)/H(+) antiporter subunit A/B Rhizobium meliloti (strain 1021)
P15958 2.69e-43 166 30 11 378 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vicia faba
Q6YXQ6 3.19e-43 166 31 8 384 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Physcomitrium patens
Q70XW6 3.33e-43 166 32 11 374 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Amborella trichopoda
Q32880 3.99e-43 165 33 10 368 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Poa pratensis
A9LYE7 5.27e-43 165 32 10 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus var. americanus
Q3V4Y7 5.64e-43 165 32 10 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus
Q06R83 5.98e-43 165 31 12 394 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Jasminum nudiflorum
Q9BBP6 6.54e-43 165 31 11 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lotus japonicus
Q0G9H2 6.67e-43 165 30 11 396 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Liriodendron tulipifera
A4QKP2 6.89e-43 165 32 10 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Capsella bursa-pastoris
P46620 6.94e-43 165 32 10 368 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zea mays
B1NWJ6 7.29e-43 165 31 10 379 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Manihot esculenta
A2T379 8.74e-43 165 34 11 360 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Angiopteris evecta
A4GYW4 8.75e-43 165 31 10 369 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus trichocarpa
Q33066 1.07e-42 164 32 12 387 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Sorghum bicolor
B5LMS9 1.14e-42 164 30 11 378 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cicer arietinum
A1EA56 1.21e-42 164 32 12 387 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Agrostis stolonifera
Q09FZ9 1.56e-42 164 31 11 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Platanus occidentalis
Q06GU9 1.58e-42 164 32 12 379 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Drimys granadensis
A4QL68 1.86e-42 164 32 9 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Draba nemorosa
A6MMR6 1.9e-42 164 31 11 396 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dioscorea elephantipes
P0C328 2e-42 163 32 12 385 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. japonica
P0C327 2e-42 163 32 12 385 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. indica
P0C326 2e-42 163 32 12 385 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa
Q6ENB0 2e-42 163 32 12 385 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza nivara
Q6L3E3 2.07e-42 163 32 12 387 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum hybrid
A4QJX9 2.13e-42 163 32 8 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Olimarabidopsis pumila
Q14FB0 2.14e-42 164 31 10 369 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus alba
P56752 2.18e-42 163 32 9 364 1 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabidopsis thaliana
Q6ENQ0 2.33e-42 163 32 12 387 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum officinarum
Q0ZIX1 2.39e-42 163 31 11 379 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vitis vinifera
A8Y9D4 2.56e-42 163 33 10 368 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lolium perenne
A4QKF4 2.67e-42 163 32 8 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Barbarea verna
Q95H46 3.16e-42 163 32 12 387 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Triticum aestivum
B1A981 3.26e-42 163 32 9 367 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carica papaya
Q8NXT2 3.35e-42 163 31 12 415 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MW2)
Q6GBK7 3.35e-42 163 31 12 415 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MSSA476)
A4QLF6 4.11e-42 162 32 9 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lepidium virginicum
Q7YJT6 4.11e-42 162 33 11 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Calycanthus floridus var. glaucus
Q2PMM9 4.13e-42 162 31 11 378 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Glycine max
Q5HRB2 5.2e-42 162 30 11 412 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CQ50 5.67e-42 162 30 11 412 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q85FH9 6.74e-42 162 33 8 351 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adiantum capillus-veneris
Q1ACF3 7.03e-42 161 32 10 366 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chara vulgaris
Q09MC9 7.86e-42 162 32 9 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Citrus sinensis
A4QLY2 7.93e-42 162 32 9 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nasturtium officinale
A6MMI0 8.14e-42 162 31 11 379 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chloranthus spicatus
A4QKY1 1.13e-41 161 32 9 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Crucihimalaya wallichii
Q6GJ47 1.24e-41 162 31 11 392 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MRSA252)
Q8K9X7 1.33e-41 160 34 7 318 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q0Q2K0 1.56e-41 161 31 12 415 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus
A8Z144 1.56e-41 161 31 12 415 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300 / TCH1516)
A6QET3 1.56e-41 161 31 12 415 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Newman)
Q5HI45 1.56e-41 161 31 12 415 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain COL)
Q2G2U8 1.56e-41 161 31 12 415 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ15 1.56e-41 161 31 12 415 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300)
A1XGU4 1.72e-41 160 32 10 367 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ranunculus macranthus
Q49VG9 1.72e-41 161 31 12 402 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A4QK67 1.8e-41 160 32 9 363 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabis hirsuta
Q85T01 2.51e-41 159 30 14 436 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
P06264 2.55e-41 160 29 13 421 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Marchantia polymorpha
A8SEF0 2.62e-41 160 31 13 441 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ceratophyllum demersum
Q99VZ2 2.79e-41 160 31 12 415 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain N315)
Q932F5 2.79e-41 160 31 12 415 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQH5 2.79e-41 160 31 12 415 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH9)
A6TZ99 2.79e-41 160 31 12 415 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH1)
A7WZ76 2.79e-41 160 31 12 415 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q19V60 4.16e-41 159 29 9 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chlorokybus atmophyticus
Q4L443 4.9e-41 160 32 15 413 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus haemolyticus (strain JCSC1435)
B2XWI8 1.14e-40 159 32 11 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Fagopyrum esculentum subsp. ancestrale
A6MM84 1.23e-40 158 31 11 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Buxus microphylla
Q2YST2 1.25e-40 159 30 11 411 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q09WX1 1.32e-40 158 30 11 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Morus indica
F1SVK0 1.43e-40 157 32 15 437 1 fpoL F(420)H(2) dehydrogenase subunit L Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
A6H5N8 2.05e-40 157 31 9 362 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cycas taitungensis
Q8M9U5 2.1e-40 157 31 8 354 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chaetosphaeridium globosum
Q06FL7 4.48e-40 157 30 12 392 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Pelargonium hortorum
P50367 8.81e-40 155 30 13 427 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhizopus stolonifer
A6MMZ2 9.15e-40 156 31 10 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Illicium oligandrum
Q9TL56 1.34e-39 155 31 10 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carpenteria californica
Q5SCZ9 2.55e-39 154 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Huperzia lucidula
Q35099 1.76e-38 151 29 14 421 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Metridium senile
A4QJG3 3.98e-38 151 31 8 361 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema cordifolium
A4QJP7 5.4e-38 150 31 7 361 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema grandiflorum
P9WIW1 1.53e-37 149 31 11 409 1 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW0 1.53e-37 149 31 11 409 3 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q37680 2.16e-36 145 30 13 422 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Triticum aestivum
Q0H8X0 2.32e-36 145 30 12 407 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Ustilago maydis (strain 521 / FGSC 9021)
P29388 6.33e-36 144 30 14 418 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Arabidopsis thaliana
P05510 9.03e-36 144 27 10 406 3 ndh-5 NADH-ubiquinone oxidoreductase chain 5 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q35648 1.35e-35 142 32 5 285 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan troglodytes
Q34313 2.18e-35 142 27 16 431 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium discoideum
Q34879 3.37e-35 141 25 10 445 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lemur catta
Q953I4 4.97e-35 141 30 9 376 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Episoriculus fumidus
Q9JX92 5.14e-35 142 29 15 427 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8SHP7 6.18e-35 141 31 8 334 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Hypocrea jecorina
P03916 6.68e-35 140 32 5 285 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan paniscus
P20679 9.28e-35 140 28 10 406 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
P10330 1.01e-34 140 29 14 422 2 ND5 NADH-ubiquinone oxidoreductase chain 5 Oenothera berteroana
Q9K1B0 1.28e-34 140 29 15 427 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P50366 1.78e-34 140 30 10 354 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Phytophthora infestans
O79437 1.92e-34 139 28 9 376 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oryctolagus cuniculus
P03917 2.29e-34 139 30 5 316 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gorilla gorilla gorilla
P26849 3.22e-34 139 29 14 430 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Marchantia polymorpha
Q76LN2 3.38e-34 139 31 5 291 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rousettus amplexicaudatus
Q89AT6 4.25e-34 139 31 7 346 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q2LCP6 4.42e-34 139 26 13 428 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium citrinum
Q576B4 6.29e-34 138 27 9 408 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos indicus
O21335 6.35e-34 138 27 11 440 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dasypus novemcinctus
Q01561 6.88e-34 138 28 13 409 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Trichophyton rubrum
P03919 7.1e-34 138 28 9 384 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hylobates lar
Q8HHD2 8.95e-34 138 27 10 414 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryphonectria parasitica
P92669 9.04e-34 137 29 8 346 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Osphranter robustus
Q56227 9.13e-34 137 32 7 310 1 nqo12 NADH-quinone oxidoreductase subunit 12 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
O47815 1.03e-33 137 30 10 355 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Geomys personatus
P50365 2.21e-33 137 31 7 345 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Allomyces macrogynus
Q95918 3.14e-33 136 30 8 341 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Polypterus ornatipinnis
B1I6I5 3.27e-33 135 29 14 400 3 nuoN NADH-quinone oxidoreductase subunit N Desulforudis audaxviator (strain MP104C)
P50939 3.57e-33 136 30 15 423 3 nuoL NADH-quinone oxidoreductase subunit L Rhodobacter capsulatus
Q9ZZY1 4.22e-33 135 27 7 358 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hippopotamus amphibius
Q9TDR1 4.73e-33 135 29 5 291 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Sus scrofa
P24979 5e-33 135 30 7 345 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Cyprinus carpio
P24978 5.46e-33 135 28 8 352 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera physalus
Q6QU67 5.52e-33 135 27 10 406 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Aspergillus niger
Q96069 5.56e-33 135 29 8 329 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rhinoceros unicornis
Q95885 6.23e-33 135 27 9 383 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Papio hamadryas
Q9ZZM3 6.25e-33 135 28 10 404 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Salmo salar
P48176 7.21e-33 135 28 8 363 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oncorhynchus mykiss
O78756 7.34e-33 135 30 5 291 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ovis aries
P03920 7.48e-33 135 29 8 366 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos taurus
O63908 1.11e-32 134 25 12 461 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Glis glis
Q35543 1.52e-32 134 28 12 407 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Petromyzon marinus
P41299 1.73e-32 134 30 5 298 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera musculus
P18932 1.85e-32 133 27 13 416 1 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Drosophila melanogaster
P48920 1.88e-32 134 31 11 386 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Chondrus crispus
P11661 1.94e-32 134 27 11 412 3 Mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Rattus norvegicus
P50368 2.2e-32 134 29 10 362 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Schizophyllum commune
Q8W9M6 2.34e-32 133 31 5 285 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dugong dugon
P33510 2.45e-32 133 31 10 330 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Anopheles quadrimaculatus
P38602 2.56e-32 133 29 6 327 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Halichoerus grypus
P92699 3.27e-32 133 34 5 285 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo abelii
P34195 3.81e-32 133 30 7 326 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Formosania lacustris
P03921 4.34e-32 132 29 6 327 1 Mtnd5 NADH-ubiquinone oxidoreductase chain 5 Mus musculus
P08739 5.98e-32 132 32 9 329 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Chlamydomonas reinhardtii
O79411 7.06e-32 132 32 6 298 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Scyliorhinus canicula
P03915 7.77e-32 132 32 5 285 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Homo sapiens
Q00542 9.04e-32 132 28 6 327 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Phoca vitulina
Q6V9D9 1.03e-31 132 29 9 364 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Talaromyces marneffei
O03205 1.05e-31 131 29 7 327 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ceratotherium simum
Q94RJ2 1.17e-31 131 31 6 286 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Chimaera monstrosa
P51899 1.56e-31 128 30 13 334 3 ND5 NADH-ubiquinone oxidoreductase chain 5 (Fragment) Anopheles arabiensis
Q9B8C9 1.58e-31 130 31 11 348 3 NAD5 NADH-ubiquinone oxidoreductase chain 5 Candida albicans (strain SC5314 / ATCC MYA-2876)
O03174 1.65e-31 131 29 6 298 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Latimeria chalumnae
P23482 2.01e-31 131 26 9 435 1 hyfB Hydrogenase-4 component B Escherichia coli (strain K12)
O78688 2.1e-31 130 30 8 339 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Carassius auratus
Q9ZZ44 2.7e-31 130 32 6 292 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Squalus acanthias
P41309 2.73e-31 130 29 7 310 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Didelphis virginiana
P11628 3.72e-31 130 27 12 414 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Emericella nidulans
P29924 3.74e-31 130 31 16 423 3 nqo12 NADH-quinone oxidoreductase chain 12 Paracoccus denitrificans
P48656 5.46e-31 129 32 5 291 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus caballus
P48919 7.08e-31 129 30 12 344 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Candida parapsilosis
P03918 8.14e-31 129 28 8 404 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo pygmaeus
Q37372 8.59e-31 129 31 10 326 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Acanthamoeba castellanii
O79678 8.89e-31 129 32 9 298 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pelomedusa subrufa
Q7A725 1.15e-30 127 28 14 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain N315)
Q99VY9 1.15e-30 127 28 14 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7WZ79 1.15e-30 127 28 14 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2I3G4 1.55e-30 128 27 8 351 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Elephas maximus
P55782 2.12e-30 127 31 6 298 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gadus morhua
Q9TA19 2.32e-30 127 27 8 351 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Loxodonta africana
P34854 2.68e-30 127 30 13 334 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Anopheles gambiae
Q8NXT1 2.71e-30 126 27 13 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MW2)
A8Z147 2.71e-30 126 27 13 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBK4 2.71e-30 126 27 13 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MSSA476)
A6QET6 2.71e-30 126 27 13 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Newman)
Q5HI42 2.71e-30 126 27 13 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain COL)
Q2YSV4 2.71e-30 126 27 13 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQH8 2.71e-30 126 27 13 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH9)
Q2G212 2.71e-30 126 27 13 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ12 2.71e-30 126 27 13 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300)
A6TZA2 2.71e-30 126 27 13 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH1)
P92485 3.05e-30 127 32 5 291 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus asinus
Q0Q2J7 3.17e-30 126 27 13 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus
Q4JQH7 3.39e-30 127 28 10 363 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Tetraodon nigroviridis
Q6GJ44 4.74e-30 125 27 13 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MRSA252)
Q36428 4.93e-30 126 29 7 337 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Locusta migratoria
Q1HK80 5.06e-30 126 27 8 372 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus
P48921 5.56e-30 126 29 6 327 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Felis catus
Q38PR2 5.85e-30 126 27 8 351 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Mammuthus primigenius
P03922 9.23e-30 125 29 8 363 3 mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Xenopus laevis
Q9ZZ57 1.37e-29 125 27 8 372 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus familiaris
P07706 2.27e-29 124 29 9 372 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Drosophila yakuba
O79422 3.24e-29 124 31 9 313 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Branchiostoma lanceolatum
P18940 3.86e-29 124 31 7 286 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gallus gallus
B0FWD3 1.27e-28 122 30 10 333 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Aedes aegypti
Q36459 1.29e-28 122 28 9 352 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ornithorhynchus anatinus
A9RAH0 1.63e-28 122 30 9 339 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
O47430 3.61e-28 121 31 9 313 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Branchiostoma floridae
Q00232 8.57e-28 120 30 10 331 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Mytilus edulis
P12776 9.25e-28 120 32 7 265 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paracentrotus lividus
Q9B6D3 3.86e-27 118 27 13 365 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q8CQ47 6.97e-27 116 27 14 468 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRA9 7.9e-27 116 27 14 468 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9RGZ2 1.08e-26 116 27 11 414 1 mrpD Na(+)/H(+) antiporter subunit D Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q9MIY0 2.19e-26 115 27 7 332 3 mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Danio rerio
Q49VH2 3.4e-26 114 28 7 361 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P48918 4.07e-26 114 29 9 338 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Albinaria caerulea
P34855 7.69e-26 114 28 9 325 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Apis mellifera ligustica
Q9ZYM7 8.2e-26 114 28 8 324 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhipicephalus sanguineus
O79556 9.73e-26 114 24 9 420 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lycodon semicarinatus
Q37024 1.27e-25 114 27 11 359 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Wickerhamomyces canadensis
A9QPJ1 1.47e-25 112 27 12 424 3 hyfF Hydrogenase-4 component F homolog Methylacidiphilum infernorum (isolate V4)
Q35813 1.86e-25 113 27 9 329 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Struthio camelus
Q4L446 2.1e-25 112 27 8 378 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus haemolyticus (strain JCSC1435)
Q9G2W8 5.68e-25 111 29 7 293 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Myxine glutinosa
P77437 6.35e-25 111 31 10 340 3 hyfF Hydrogenase-4 component F Escherichia coli (strain K12)
P11993 1.3e-24 110 27 11 359 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Patiria pectinifera
O05229 1.77e-24 109 25 7 339 1 mrpD Na(+)/H(+) antiporter subunit D Bacillus subtilis (strain 168)
Q32905 1.86e-24 101 42 3 128 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Pisum sativum
Q37710 3.73e-24 108 28 5 299 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Artemia franciscana
Q8CPV1 4.65e-24 108 27 6 324 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQL3 4.83e-24 108 27 6 324 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q2YWT7 1.52e-23 106 28 7 323 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q5HHD6 1.65e-23 106 28 7 323 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain COL)
P60687 1.7e-23 106 28 7 323 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MW2)
P60686 1.7e-23 106 28 7 323 1 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus
Q6GAX7 1.7e-23 106 28 7 323 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MSSA476)
P60685 1.7e-23 106 28 7 323 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain N315)
P60684 1.7e-23 106 28 7 323 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QFF9 1.7e-23 106 28 7 323 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Newman)
A5IRC7 1.7e-23 106 28 7 323 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH9)
Q2G2H7 1.7e-23 106 28 7 323 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6U056 1.7e-23 106 28 7 323 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH1)
A7X0F9 1.7e-23 106 28 7 323 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
A8Z056 4.62e-23 105 27 7 323 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300 / TCH1516)
Q2FIC6 4.62e-23 105 27 7 323 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300)
P15584 4.71e-23 105 25 11 431 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paramecium tetraurelia
Q6GID9 4.75e-23 105 27 7 323 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MRSA252)
F1SVH9 2.07e-22 103 26 6 334 1 fpoM F(420)H(2) dehydrogenase subunit M Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
B2J565 2.09e-22 103 30 13 313 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q4L4W4 4.04e-22 102 27 9 373 3 mnhD Na+/H+-antiporter, MnhD subunit Staphylococcus haemolyticus (strain JCSC1435)
Q4UK26 2.75e-21 100 31 7 264 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q68VV6 2.76e-21 100 30 6 264 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZCG0 3.61e-21 99 30 7 264 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia prowazekii (strain Madrid E)
B7K1G4 8.17e-21 98 28 9 320 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Rippkaea orientalis (strain PCC 8801 / RF-1)
P15552 8.87e-21 99 30 11 316 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Strongylocentrotus purpuratus
Q1RKE5 1.01e-20 98 29 7 268 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia bellii (strain RML369-C)
B4EZ47 1.23e-20 98 29 13 329 3 nuoN NADH-quinone oxidoreductase subunit N Proteus mirabilis (strain HI4320)
Q31696 1.24e-20 94 32 5 190 3 ND5 NADH-ubiquinone oxidoreductase chain 5 (Fragment) Anopheles quadriannulatus
A7NPD6 1.58e-20 97 28 13 374 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q92G96 1.72e-20 97 30 6 264 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q5DUY0 3.75e-20 97 28 9 300 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Nyctotherus ovalis
B1XJL9 4.3e-20 96 27 9 334 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q34947 4.75e-20 96 26 8 364 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Lumbricus terrestris
Q49W88 9.62e-20 95 26 6 342 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7NGP8 2.37e-19 94 29 12 348 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
F1SVL2 2.44e-19 94 27 12 384 1 fpoN F(420)H(2) dehydrogenase subunit N Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q57M40 3.61e-19 93 28 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella choleraesuis (strain SC-B67)
P9WIW5 4.15e-19 93 25 15 487 1 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW4 4.15e-19 93 25 15 487 3 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P50974 6.16e-19 93 25 10 365 3 nuoM NADH-quinone oxidoreductase subunit M Rhodobacter capsulatus
P29925 7.27e-19 92 24 10 358 3 nqo13 NADH-quinone oxidoreductase chain 13 Paracoccus denitrificans
Q5PN71 8.18e-19 92 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5FPF7 8.63e-19 92 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella dublin (strain CT_02021853)
A8ADW3 8.87e-19 92 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q1GTL2 1.02e-18 92 28 12 333 3 nuoN NADH-quinone oxidoreductase subunit N Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q8ZNE4 1.06e-18 92 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9N592 1.06e-18 92 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5R2Z7 1.06e-18 92 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella enteritidis PT4 (strain P125109)
B5EZJ7 1.06e-18 92 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella agona (strain SL483)
B5RCE1 1.07e-18 92 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q8Z530 1.08e-18 92 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella typhi
B4TPJ8 1.08e-18 92 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella schwarzengrund (strain CVM19633)
B4SYY7 1.08e-18 92 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella newport (strain SL254)
B4TBI2 1.08e-18 92 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella heidelberg (strain SL476)
A5FQX9 1.24e-18 92 26 11 356 3 nuoN NADH-quinone oxidoreductase subunit N Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
A9MJA9 1.59e-18 91 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q9MUQ6 1.8e-18 91 27 11 365 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Mesostigma viride
P24884 2.01e-18 91 29 13 329 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Ascaris suum
Q5N5T8 2.27e-18 91 30 11 308 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P29801 2.27e-18 91 30 11 308 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
C0Q051 2.38e-18 90 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella paratyphi C (strain RKS4594)
B5YKJ2 2.45e-18 90 27 15 376 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q8KX56 2.49e-18 91 26 19 461 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
B9LGS9 3.52e-18 90 27 19 411 3 nuoN NADH-quinone oxidoreductase subunit N Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
Q0TFH0 4.5e-18 90 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1JLL1 4.58e-18 90 27 8 322 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B0JHK5 4.72e-18 90 28 10 328 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A0LJL8 6.79e-18 89 26 10 368 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
P72823 7.48e-18 89 25 11 359 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B2TW57 8.1e-18 89 27 11 326 3 nuoN NADH-quinone oxidoreductase subunit N Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q02CT1 9.23e-18 89 25 14 397 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Solibacter usitatus (strain Ellin6076)
Q1R9E1 1.01e-17 89 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain UTI89 / UPEC)
Q8FFK3 1.01e-17 89 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1ADC4 1.01e-17 89 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O1:K1 / APEC
B7MXV5 1.03e-17 89 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O81 (strain ED1a)
Q31YI5 1.08e-17 89 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Shigella boydii serotype 4 (strain Sb227)
Q83QT2 1.37e-17 88 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Shigella flexneri
B1IXR6 1.39e-17 88 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7MHT8 1.39e-17 88 27 10 323 3 nuoN NADH-quinone oxidoreductase subunit N Cronobacter sakazakii (strain ATCC BAA-894)
Q3YZT4 1.76e-17 88 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Shigella sonnei (strain Ss046)
B1LLM9 1.76e-17 88 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain SMS-3-5 / SECEC)
B6I7M6 1.76e-17 88 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain SE11)
P0AFF0 1.76e-17 88 27 10 326 1 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain K12)
A8A2E5 1.76e-17 88 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O9:H4 (strain HS)
C4ZUB9 1.76e-17 88 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain K12 / MC4100 / BW2952)
B7M5V5 1.76e-17 88 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O8 (strain IAI1)
B5YXR6 1.76e-17 88 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AFF1 1.76e-17 88 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O157:H7
B7LAT8 1.76e-17 88 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain 55989 / EAEC)
B7UFT4 1.76e-17 88 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZP90 1.76e-17 88 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O139:H28 (strain E24377A / ETEC)
A4WCQ5 1.79e-17 88 27 12 328 3 nuoN NADH-quinone oxidoreductase subunit N Enterobacter sp. (strain 638)
B7NNV5 1.79e-17 88 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q6YXR9 1.96e-17 88 30 11 270 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Physcomitrium patens
B1X5D6 2.08e-17 88 28 8 305 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, organellar chromatophore Paulinella chromatophora
Q32DR3 2.23e-17 88 27 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Shigella dysenteriae serotype 1 (strain Sd197)
B7KEZ9 2.5e-17 88 29 9 278 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Gloeothece citriformis (strain PCC 7424)
Q1DDD3 3.33e-17 87 27 17 384 3 nuoN NADH-quinone oxidoreductase subunit N Myxococcus xanthus (strain DK1622)
Q2S2K9 3.72e-17 87 26 15 370 3 nuoN NADH-quinone oxidoreductase subunit N Salinibacter ruber (strain DSM 13855 / M31)
A6LXP5 3.79e-17 87 27 10 318 3 nuoN NADH-quinone oxidoreductase subunit N Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q5N5W1 4.01e-17 87 27 9 314 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31NA0 4.01e-17 87 27 9 314 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P72714 5.48e-17 87 30 8 250 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q83BR8 6.37e-17 86 26 14 357 3 nuoN NADH-quinone oxidoreductase subunit N Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q0C1D1 6.77e-17 86 26 16 371 3 nuoN NADH-quinone oxidoreductase subunit N Hyphomonas neptunium (strain ATCC 15444)
B5XNW6 7.38e-17 86 26 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Klebsiella pneumoniae (strain 342)
A8GH04 8.84e-17 86 26 8 322 3 nuoN NADH-quinone oxidoreductase subunit N Serratia proteamaculans (strain 568)
Q32RW1 9.93e-17 86 27 7 270 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Staurastrum punctulatum
B8JAZ0 9.98e-17 86 27 9 318 3 nuoN NADH-quinone oxidoreductase subunit N Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
C6DA34 1.13e-16 85 27 11 325 3 nuoN NADH-quinone oxidoreductase subunit N Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A9R6K9 1.25e-16 85 27 9 324 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis bv. Antiqua (strain Angola)
P04540 1.32e-16 86 31 10 245 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Trypanosoma brucei brucei
Q5SCY2 1.39e-16 85 30 7 269 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Huperzia lucidula
B1JGM5 1.4e-16 85 27 9 324 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q669B2 1.4e-16 85 27 9 324 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TM24 1.4e-16 85 27 9 324 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis (strain Pestoides F)
Q1CHR3 1.4e-16 85 27 9 324 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CJ84 1.4e-16 85 27 9 324 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis
B2K809 1.4e-16 85 27 9 324 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C6C1 1.4e-16 85 27 9 324 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGR6 1.4e-16 85 27 9 324 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1ZUK1 1.44e-16 85 23 14 445 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
A4J650 1.66e-16 85 27 11 316 3 nuoN NADH-quinone oxidoreductase subunit N Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q6ANN6 1.71e-16 85 28 7 302 3 nuoN NADH-quinone oxidoreductase subunit N Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q7V2N8 1.75e-16 85 27 11 380 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q111U1 1.82e-16 85 30 12 319 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Trichodesmium erythraeum (strain IMS101)
B9L178 2.25e-16 85 28 15 373 3 nuoN NADH-quinone oxidoreductase subunit N Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
Q3MB63 2.31e-16 85 30 12 318 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A6TBW2 3.17e-16 84 26 10 326 3 nuoN NADH-quinone oxidoreductase subunit N Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A9B6Y0 3.71e-16 84 28 8 320 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
B8IUV9 3.72e-16 84 27 16 330 3 nuoN NADH-quinone oxidoreductase subunit N Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q6D2S9 4.22e-16 84 27 10 325 3 nuoN NADH-quinone oxidoreductase subunit N Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B2VIN7 4.38e-16 84 28 15 327 3 nuoN NADH-quinone oxidoreductase subunit N Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q46GY3 4.52e-16 84 28 11 352 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain NATL2A)
A5GMZ5 4.77e-16 84 29 10 342 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain WH7803)
Q8YMQ0 5.27e-16 84 30 12 318 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A2BV95 5.72e-16 84 27 13 381 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain MIT 9515)
C0QR92 5.76e-16 84 24 17 384 3 nuoN NADH-quinone oxidoreductase subunit N Persephonella marina (strain DSM 14350 / EX-H1)
A9B488 7.57e-16 83 24 9 338 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q32RP6 7.75e-16 83 28 13 312 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Zygnema circumcarinatum
Q01UN3 8.14e-16 83 29 10 307 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Solibacter usitatus (strain Ellin6076)
B0JS85 8.25e-16 83 27 11 324 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
D0KZ79 8.98e-16 83 26 10 345 3 dabB1 Probable inorganic carbon transporter subunit DabB1 Halothiobacillus neapolitanus (strain ATCC 23641 / c2)
Q8DHX4 9.23e-16 83 25 9 333 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q2NSL1 9.47e-16 83 26 9 312 3 nuoN NADH-quinone oxidoreductase subunit N Sodalis glossinidius (strain morsitans)
A7HY36 9.92e-16 83 25 8 317 3 nuoN NADH-quinone oxidoreductase subunit N Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
P32421 1.08e-15 83 25 9 320 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4-1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q3ASV8 1.1e-15 83 26 13 390 3 nuoN NADH-quinone oxidoreductase subunit N Chlorobium chlorochromatii (strain CaD3)
O67342 1.26e-15 82 30 8 263 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Aquifex aeolicus (strain VF5)
Q11VC5 1.28e-15 82 24 11 395 3 nuoN NADH-quinone oxidoreductase subunit N Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
P24896 1.45e-15 82 27 9 273 3 nduo-5 NADH-ubiquinone oxidoreductase chain 5 Caenorhabditis elegans
A7NL15 1.52e-15 82 29 9 265 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B1X5V5 1.78e-15 82 25 8 330 3 ndhF2 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 2 Paulinella chromatophora
A3PBF7 1.88e-15 82 27 12 354 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain MIT 9301)
Q7VDE7 1.94e-15 82 28 12 361 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q2RJT7 2.27e-15 82 26 16 414 3 nuoN NADH-quinone oxidoreductase subunit N Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q0I8A7 2.55e-15 82 28 11 351 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain CC9311)
Q7N2J9 2.7e-15 81 25 12 361 3 nuoN NADH-quinone oxidoreductase subunit N Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8YQ78 3.04e-15 81 24 10 349 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q6MGN8 3.39e-15 81 24 12 356 3 nuoN NADH-quinone oxidoreductase subunit N Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
B8FRJ7 3.79e-15 81 29 10 279 3 nuoN NADH-quinone oxidoreductase subunit N Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q8DMR6 3.94e-15 81 29 10 316 1 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q3MCB9 4.54e-15 81 24 10 349 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q58705 4.56e-15 80 28 7 289 4 MJ1309 Uncharacterized protein MJ1309 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A7ZBF3 6.72e-15 80 24 14 382 3 nuoN NADH-quinone oxidoreductase subunit N Campylobacter concisus (strain 13826)
P16429 6.86e-15 80 27 8 272 1 hycC Formate hydrogenlyase subunit 3 Escherichia coli (strain K12)
Q3M9C7 7.1e-15 80 26 9 336 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A8G3E9 7.3e-15 80 27 12 354 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain MIT 9215)
A2BPR7 7.5e-15 80 27 12 354 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain AS9601)
C1AZG0 9.25e-15 80 27 11 328 3 nuoN NADH-quinone oxidoreductase subunit N Rhodococcus opacus (strain B4)
Q85FH5 9.54e-15 80 26 5 295 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Adiantum capillus-veneris
Q31CA0 1.01e-14 80 27 11 352 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain MIT 9312)
A4XV14 1.03e-14 80 29 11 322 3 nuoN NADH-quinone oxidoreductase subunit N Pseudomonas mendocina (strain ymp)
B1WUS5 1.1e-14 80 28 10 320 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Crocosphaera subtropica (strain ATCC 51142 / BH68)
P26848 1.31e-14 79 26 9 277 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Marchantia polymorpha
Q9TKV8 1.77e-14 79 23 7 297 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nephroselmis olivacea
A2T383 1.78e-14 79 25 8 299 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Angiopteris evecta
A7H9U1 1.87e-14 79 26 12 359 3 nuoN NADH-quinone oxidoreductase subunit N Anaeromyxobacter sp. (strain Fw109-5)
B1XHP2 1.96e-14 79 23 14 444 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q3AGZ9 2.1e-14 79 27 18 455 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9605)
Q3B063 2.21e-14 79 29 11 290 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9902)
A2C7C1 2.61e-14 79 30 11 310 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain MIT 9303)
Q7V626 2.85e-14 78 30 11 310 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain MIT 9313)
B0C4B4 2.95e-14 78 25 11 348 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Acaryochloris marina (strain MBIC 11017)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS12485
Feature type CDS
Gene -
Product hydrogenase 4 subunit D
Location 2767767 - 2769215 (strand: -1)
Length 1449 (nucleotides) / 482 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_795
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00361 Proton-conducting membrane transporter
PF00662 NADH-Ubiquinone oxidoreductase (complex I), chain 5 N-terminus

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1009 Energy production and conversion (C) C Membrane H+-translocase/NADH:ubiquinone oxidoreductase subunit 5 (chain L)/Multisubunit Na+/H+ antiporter, MnhA subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K12139 hydrogenase-4 component D [EC:1.-.-.-] - -

Protein Sequence

MIAMENIALATLLIPFAGALITSILPNRMAKWLCTLFALLATLGTVVLGWQFLAEGKVDTTITLVQYGDVALFGFTIDRVSTLIAFAVVFLGLLVSFYSTGYLTNGNREHPHDGTRRYYAFLLIFIGAMAGLVLSSTILGQLLFFEITGGCSWALIGYYQSEKSLRSAMKALLITHVASIGLYLAAATLFVSTGSFELTAIATLDEPTKLIVFGGILFAAWGKSAQLPLQAWLPDAMEAPTPVSAYLHAASMVKVGVYIFARAIISAGDVPHIIGWVGIAMAVITLIYGFMMYLPQKDMKRLLAWSTITQLSYIFLALSISIFGPREAFNGGVAYIFNHAFAKSLFFLVAGALSYSCGTRMLPRLKGLINKYPLLGVGFCVAALAIAGVPPLNGFFSKFPIFAAGFELSSVFWVMTPIMVLVLIESVASFTWFIYWFGRVVPGEPSKEVAQGQPVPMAMQIVIGILIIMSFASSVIAVTWLG

Flanking regions ( +/- flanking 50bp)

GTGTTGCGGCACTGGCTTTTGTTTTCTATTTAACTGGTCTATAAGGAGCGATGATTGCAATGGAAAATATAGCTCTTGCGACCTTACTCATCCCATTTGCAGGGGCGTTAATTACGTCCATACTGCCAAATCGGATGGCGAAGTGGTTATGTACACTGTTCGCTTTATTAGCCACATTAGGTACTGTTGTTTTAGGTTGGCAGTTCCTCGCTGAAGGTAAAGTCGATACCACAATTACGCTAGTACAATATGGTGATGTTGCGCTATTTGGTTTTACCATTGATCGCGTCAGTACCTTAATTGCTTTTGCCGTTGTGTTCTTAGGATTACTCGTCAGTTTTTATTCAACGGGTTATCTCACTAACGGTAACCGTGAGCATCCTCATGATGGGACTCGTCGTTATTATGCTTTCCTGTTGATCTTTATTGGTGCTATGGCAGGTTTAGTACTGTCATCTACCATTTTAGGGCAACTGCTGTTTTTTGAAATTACCGGTGGTTGTTCTTGGGCATTAATTGGTTATTACCAATCAGAGAAGTCATTGCGTTCGGCAATGAAGGCATTGTTAATTACTCATGTTGCGTCAATCGGTCTGTATCTTGCAGCTGCAACCTTGTTTGTAAGTACGGGTTCGTTTGAACTAACTGCGATAGCAACATTAGATGAGCCAACAAAACTGATTGTCTTTGGCGGTATTCTGTTTGCTGCTTGGGGTAAATCAGCACAGCTTCCTTTACAAGCTTGGTTACCTGATGCAATGGAAGCACCAACACCTGTAAGTGCTTACTTACACGCTGCGTCAATGGTTAAAGTGGGTGTGTATATCTTTGCTCGTGCCATTATTTCAGCCGGTGATGTCCCTCATATCATTGGTTGGGTGGGGATCGCCATGGCGGTTATCACTCTGATTTATGGCTTTATGATGTATCTGCCACAAAAAGATATGAAACGTCTGTTAGCATGGTCAACCATTACACAGCTTTCTTATATCTTCCTCGCGTTATCTATCTCAATCTTTGGACCTCGTGAAGCCTTTAATGGTGGTGTGGCTTATATCTTTAACCACGCTTTTGCTAAAAGTTTGTTCTTCTTAGTCGCAGGTGCTCTGAGTTATAGCTGTGGTACTCGTATGTTACCGCGCTTAAAAGGGTTAATTAATAAATATCCATTGCTGGGTGTGGGCTTTTGTGTTGCTGCGTTAGCGATTGCAGGTGTACCACCACTCAATGGTTTCTTTAGTAAATTCCCTATCTTTGCAGCAGGCTTTGAATTATCGAGTGTGTTCTGGGTAATGACACCTATTATGGTTCTGGTACTGATTGAATCTGTTGCAAGTTTCACTTGGTTTATCTACTGGTTTGGCCGTGTGGTGCCAGGAGAACCAAGTAAAGAAGTTGCGCAAGGACAACCGGTTCCTATGGCAATGCAAATTGTGATTGGAATACTGATTATTATGTCTTTCGCATCCAGTGTTATTGCTGTGACTTGGCTAGGATAAGGGGATAAATCATGACTGGAGCACTTATTGTTAATAATTTAGCGGGGTTA