Homologs in group_864

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03730 FBDBKF_03730 95.2 Morganella morganii S1 nuoL hydrogenase 4 subunit D
EHELCC_06805 EHELCC_06805 95.2 Morganella morganii S2 nuoL hydrogenase 4 subunit D
NLDBIP_07130 NLDBIP_07130 95.2 Morganella morganii S4 nuoL hydrogenase 4 subunit D
LHKJJB_06665 LHKJJB_06665 95.2 Morganella morganii S3 nuoL hydrogenase 4 subunit D
HKOGLL_04265 HKOGLL_04265 95.2 Morganella morganii S5 nuoL hydrogenase 4 subunit D
PMI_RS12485 PMI_RS12485 81.7 Proteus mirabilis HI4320 - hydrogenase 4 subunit D

Distribution of the homologs in the orthogroup group_864

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_864

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P77416 0.0 672 69 0 479 3 hyfD Hydrogenase-4 component D Escherichia coli (strain K12)
P33607 1.14e-55 198 35 12 420 1 nuoL NADH-quinone oxidoreductase subunit L Escherichia coli (strain K12)
Q9RGZ5 2.14e-51 189 34 14 460 1 mrpA Na(+)/H(+) antiporter subunit A Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q8CPU8 1.28e-50 187 37 9 344 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQL0 1.28e-50 187 37 9 344 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q32238 1.7e-50 186 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Flaveria ramosissima
P31971 1.88e-50 185 32 14 437 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q32384 3.16e-50 186 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Helianthus annuus
Q9PMA7 6.86e-50 182 30 12 459 3 nuoL NADH-quinone oxidoreductase subunit L Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q32551 7.71e-50 184 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mutisia acuminata
B2LMQ1 1.72e-49 183 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Guizotia abyssinica
Q31849 1.83e-49 183 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ambrosia trifida
P51098 2.12e-49 183 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Athroisma gracile
P51095 2.34e-49 183 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adenocaulon himalaicum
Q32007 2.88e-49 183 32 12 372 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cichorium intybus
Q32091 2.93e-49 183 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carthamus tinctorius
Q9K2S2 4e-49 183 34 13 414 1 mrpA Na(+)/H(+) antiporter subunit A Bacillus subtilis (strain 168)
P51099 4.83e-49 182 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atractylodes lancea
Q4L4W7 6.8e-49 182 32 12 426 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus haemolyticus (strain JCSC1435)
Q32126 9.13e-49 181 31 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dampiera diversifolia
P51097 1.14e-48 181 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Symphyotrichum cordifolium
Q8NXT2 2.05e-48 181 31 14 458 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MW2)
Q6GBK7 2.05e-48 181 31 14 458 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MSSA476)
P51096 2.76e-48 180 31 10 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anisothrix integra
Q32539 2.9e-48 180 32 12 372 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lactuca sativa
Q49W91 6.13e-48 180 34 13 403 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q0G9R5 6.77e-48 179 31 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Daucus carota
Q2QD43 7.33e-48 179 32 11 369 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cucumis sativus
Q0Q2K0 8.85e-48 179 31 14 458 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus
A8Z144 8.85e-48 179 31 14 458 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300 / TCH1516)
A6QET3 8.85e-48 179 31 14 458 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Newman)
Q5HI45 8.85e-48 179 31 14 458 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain COL)
Q2G2U8 8.85e-48 179 31 14 458 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ15 8.85e-48 179 31 14 458 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300)
Q859V1 9.47e-48 178 31 11 379 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anthoceros angustus
Q9TKV7 2.12e-47 176 32 9 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nephroselmis olivacea
Q9I0J1 2.13e-47 176 33 19 485 3 nuoL NADH-quinone oxidoreductase subunit L Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q68RV9 2.34e-47 177 31 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Panax ginseng
Q55429 2.37e-47 177 31 12 434 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q99VZ2 2.51e-47 178 30 13 458 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain N315)
Q932F5 2.51e-47 178 30 13 458 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQH5 2.51e-47 178 30 13 458 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH9)
A6TZ99 2.51e-47 178 30 13 458 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH1)
A7WZ76 2.51e-47 178 30 13 458 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q52978 2.84e-47 179 34 10 412 3 phaAB Probable K(+)/H(+) antiporter subunit A/B Rhizobium meliloti (strain 1021)
A0A382 2.94e-47 177 32 10 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Coffea arabica
Q9TLC2 4.41e-47 177 31 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Tecoma stans
Q49VG9 1.01e-46 176 32 15 450 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2L960 1.06e-46 176 31 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium hirsutum
Q9M3J4 1.19e-46 176 32 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Spinacia oleracea
Q2YST2 1.2e-46 176 30 14 458 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A7Y3K7 1.51e-46 175 31 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ipomoea purpurea
P51100 1.53e-46 175 31 11 369 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gerbera jamesonii
A0ZZ82 1.79e-46 175 31 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium barbadense
Q2VED3 2.14e-46 175 31 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum tuberosum
Q8S8V0 2.35e-46 174 31 10 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atropa belladonna
Q2MIE0 2.38e-46 174 31 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum bulbocastanum
Q9ZNG6 2.89e-46 175 37 10 340 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus
P60675 2.89e-46 175 37 10 340 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain N315)
P60674 2.89e-46 175 37 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRD0 2.89e-46 175 37 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH9)
A6U059 2.89e-46 175 37 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH1)
A7X0G4 2.89e-46 175 37 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YWT4 3.09e-46 175 38 11 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NXF6 3.12e-46 175 37 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MW2)
A8Z059 3.12e-46 175 37 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GAX4 3.12e-46 175 37 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MSSA476)
A6QFG2 3.12e-46 175 37 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Newman)
Q5HHD3 3.12e-46 175 37 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain COL)
Q2FZV1 3.12e-46 175 37 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIC3 3.12e-46 175 37 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300)
Q32516 3.43e-46 174 31 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum lycopersicum
Q3C1N9 3.84e-46 174 31 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana sylvestris
P06265 4.07e-46 174 31 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tabacum
A4GGE3 4.19e-46 174 32 9 352 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Phaseolus vulgaris
Q33113 4.38e-46 173 31 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Sesamum indicum
B1X491 4.62e-46 173 31 15 437 3 ndhF1 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 1 Paulinella chromatophora
Q33BX5 5.36e-46 174 31 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tomentosiformis
Q9MUK8 5.96e-46 172 31 10 363 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mesostigma viride
Q6EW03 6.55e-46 173 30 9 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nymphaea alba
Q6GID6 6.78e-46 174 37 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MRSA252)
Q09FR3 8.22e-46 173 31 12 378 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nandina domestica
Q31952 8.99e-46 172 30 10 378 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Capsicum baccatum
Q6GJ47 1.03e-45 173 32 12 411 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MRSA252)
Q32131 2.26e-45 171 31 10 369 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Digitalis grandiflora
Q9TLA3 2.36e-45 172 31 12 378 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ligustrum vulgare
B0Z5H4 2.56e-45 172 33 12 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera parviflora
B0Z590 2.56e-45 172 33 12 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera glazioviana
B0Z506 2.56e-45 172 33 12 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera biennis
B0Z4S2 2.56e-45 172 33 12 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera argillicola
Q9MTI4 2.69e-45 172 33 12 377 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera elata subsp. hookeri
A1XG02 3.3e-45 171 29 8 367 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nuphar advena
Q9MVL6 3.74e-45 171 30 10 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Malvaviscus arboreus
Q8W8H5 4.88e-45 171 32 11 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Psilotum nudum
P15958 6.19e-45 171 30 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vicia faba
Q9BBP6 6.49e-45 171 30 10 375 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lotus japonicus
Q49KV1 6.56e-45 171 32 11 372 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Eucalyptus globulus subsp. globulus
Q06GK2 7.87e-45 170 31 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Piper cenocladum
Q4L443 9.91e-45 171 32 14 479 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus haemolyticus (strain JCSC1435)
B5LMS9 2.1e-44 169 29 10 380 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cicer arietinum
P57262 2.2e-44 167 35 9 340 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
A4QLP4 2.42e-44 169 33 9 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lobularia maritima
Q32440 2.44e-44 169 32 11 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Hordeum vulgare
Q5HRB2 2.95e-44 169 31 10 393 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q09FZ9 3.19e-44 169 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Platanus occidentalis
Q8CQ50 3.27e-44 169 31 10 393 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A9L9E4 4.39e-44 168 33 12 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lemna minor
Q70XW6 6.85e-44 167 31 11 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Amborella trichopoda
A9LYE7 8.57e-44 167 31 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus var. americanus
Q1ACF3 8.89e-44 166 30 14 425 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chara vulgaris
A4QKP2 9.34e-44 167 32 9 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Capsella bursa-pastoris
Q0ZIX1 9.44e-44 167 30 10 378 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vitis vinifera
Q3V4Y7 9.63e-44 167 31 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus
B3TN96 9.95e-44 167 32 11 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Brachypodium distachyon
A1XGU4 1.14e-43 167 32 12 374 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ranunculus macranthus
Q92G97 1.16e-43 166 29 16 500 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia conorii (strain ATCC VR-613 / Malish 7)
B1NWJ6 1.21e-43 167 31 11 378 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Manihot esculenta
Q32880 1.32e-43 166 32 11 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Poa pratensis
Q2PMM9 1.5e-43 167 31 11 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Glycine max
Q1RKE6 1.61e-43 166 29 16 509 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia bellii (strain RML369-C)
A1EA56 1.92e-43 166 32 11 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Agrostis stolonifera
Q33066 2.53e-43 166 31 11 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Sorghum bicolor
B2XWI8 2.57e-43 166 31 15 454 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Fagopyrum esculentum subsp. ancestrale
B1A981 2.59e-43 166 32 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carica papaya
A4QJX9 2.82e-43 166 31 8 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Olimarabidopsis pumila
Q9MVK2 2.88e-43 166 30 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Pachira aquatica
A4QK67 2.92e-43 166 31 7 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabis hirsuta
A4QKF4 3.02e-43 166 31 7 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Barbarea verna
P56752 3.3e-43 166 31 7 364 1 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabidopsis thaliana
A4QLF6 3.74e-43 166 31 7 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lepidium virginicum
Q0G9H2 3.87e-43 166 31 12 378 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Liriodendron tulipifera
P46620 3.99e-43 166 31 11 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zea mays
B1VKJ3 4.39e-43 165 32 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cryptomeria japonica
Q4UK27 4.43e-43 164 27 15 504 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q06GU9 4.85e-43 165 32 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Drimys granadensis
Q32RH9 4.99e-43 165 33 10 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zygnema circumcarinatum
Q9XAR5 5.19e-43 164 32 12 444 3 nuoL NADH-quinone oxidoreductase subunit L Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q06R83 5.8e-43 165 31 9 346 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Jasminum nudiflorum
Q6ENQ0 5.99e-43 165 31 11 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum officinarum
Q6L3E3 6.41e-43 165 31 11 373 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum hybrid
A8Y9D4 6.6e-43 165 31 11 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lolium perenne
A4QL68 7.36e-43 165 31 7 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Draba nemorosa
A6MMI0 7.83e-43 164 29 10 378 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chloranthus spicatus
A6MM84 9.23e-43 164 29 16 455 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Buxus microphylla
A6MMR6 1.12e-42 164 31 11 378 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dioscorea elephantipes
A2T379 1.26e-42 164 32 11 357 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Angiopteris evecta
P0C328 1.32e-42 164 31 12 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. japonica
P0C327 1.32e-42 164 31 12 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. indica
P0C326 1.32e-42 164 31 12 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa
Q6ENB0 1.32e-42 164 31 12 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza nivara
Q09MC9 1.38e-42 164 29 13 440 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Citrus sinensis
A4GYW4 1.56e-42 164 31 10 372 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus trichocarpa
Q9ZCG1 1.61e-42 163 27 13 499 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia prowazekii (strain Madrid E)
Q95H46 2.18e-42 163 31 11 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Triticum aestivum
Q68VV7 2.36e-42 162 27 8 430 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q6YXQ6 2.58e-42 163 31 9 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Physcomitrium patens
Q14FB0 4.16e-42 162 31 10 372 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus alba
A4QLY2 4.53e-42 162 31 8 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nasturtium officinale
A8SEF0 9.24e-42 161 31 11 378 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ceratophyllum demersum
Q7YJT6 9.79e-42 161 31 11 372 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Calycanthus floridus var. glaucus
A4QKY1 1.6e-41 161 31 8 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Crucihimalaya wallichii
Q09WX1 1.61e-41 161 30 10 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Morus indica
Q32S06 3.53e-41 159 31 9 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Staurastrum punctulatum
Q8K9X7 3.69e-41 159 29 10 414 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q85FH9 7.67e-41 159 31 9 351 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adiantum capillus-veneris
Q5SCZ9 1.02e-40 159 31 12 376 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Huperzia lucidula
P9WIW1 1.06e-40 157 35 6 338 1 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW0 1.06e-40 157 35 6 338 3 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
F1SVK0 1.34e-40 157 34 11 377 1 fpoL F(420)H(2) dehydrogenase subunit L Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
A6H5N8 1.37e-40 158 30 10 353 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cycas taitungensis
Q9TL56 2.46e-40 157 31 11 379 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carpenteria californica
A6MMZ2 2.82e-40 157 31 11 369 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Illicium oligandrum
P06264 3.12e-40 157 29 14 423 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Marchantia polymorpha
Q8M9U5 4.66e-40 156 30 8 353 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chaetosphaeridium globosum
Q06FL7 7.24e-40 156 30 12 380 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Pelargonium hortorum
Q19V60 2.54e-39 154 29 10 375 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chlorokybus atmophyticus
P29388 3.75e-39 153 32 17 414 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Arabidopsis thaliana
A4QJP7 4.45e-39 154 31 7 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema grandiflorum
A4QJG3 4.49e-39 154 31 7 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema cordifolium
Q37680 3.73e-38 150 31 14 426 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Triticum aestivum
P10330 8.3e-38 149 31 15 426 2 ND5 NADH-ubiquinone oxidoreductase chain 5 Oenothera berteroana
P50367 1.61e-37 149 31 8 338 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhizopus stolonifer
Q35099 1.61e-37 148 31 10 339 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Metridium senile
P05510 2.36e-37 149 29 10 407 3 ndh-5 NADH-ubiquinone oxidoreductase chain 5 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q85T01 7.91e-37 147 31 11 343 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
P50366 1.2e-36 146 31 12 424 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Phytophthora infestans
Q01561 1.74e-36 145 32 10 353 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Trichophyton rubrum
Q8HHD2 3e-36 145 29 13 423 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryphonectria parasitica
P50939 3.6e-36 145 30 13 418 3 nuoL NADH-quinone oxidoreductase subunit L Rhodobacter capsulatus
Q56227 4.74e-36 144 34 8 309 1 nqo12 NADH-quinone oxidoreductase subunit 12 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
O79437 6.75e-36 144 28 9 376 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oryctolagus cuniculus
Q89AT6 7.65e-36 144 30 8 354 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P26849 8.38e-36 144 31 9 346 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Marchantia polymorpha
Q6QU67 8.53e-36 144 28 12 431 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Aspergillus niger
P48920 2.74e-35 142 31 8 341 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Chondrus crispus
P50365 3.52e-35 142 31 7 345 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Allomyces macrogynus
Q9ZZY1 6.55e-35 140 29 7 344 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hippopotamus amphibius
Q34879 8.3e-35 140 29 7 329 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lemur catta
Q8SHP7 9.16e-35 141 32 9 335 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Hypocrea jecorina
Q0H8X0 1.01e-34 140 31 8 347 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Ustilago maydis (strain 521 / FGSC 9021)
Q576B4 1.46e-34 140 28 9 383 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos indicus
P20679 1.91e-34 140 27 12 415 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
P11628 4.12e-34 139 28 13 431 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Emericella nidulans
Q76LN2 6.66e-34 138 31 6 293 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rousettus amplexicaudatus
P24978 7.52e-34 137 29 7 344 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera physalus
Q8CQ47 7.74e-34 136 29 13 467 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q6V9D9 8.77e-34 138 29 11 381 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Talaromyces marneffei
Q95918 8.87e-34 137 32 6 292 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Polypterus ornatipinnis
Q953I4 9.02e-34 137 27 12 455 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Episoriculus fumidus
P41299 9.93e-34 137 29 7 336 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera musculus
O47815 1.01e-33 137 30 10 343 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Geomys personatus
O78756 1.09e-33 137 29 7 336 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ovis aries
Q96069 1.19e-33 137 28 7 329 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rhinoceros unicornis
P03916 1.68e-33 137 31 5 285 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan paniscus
P38602 1.85e-33 136 30 7 336 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Halichoerus grypus
P48919 2.64e-33 135 31 12 348 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Candida parapsilosis
Q34313 2.82e-33 136 27 15 426 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium discoideum
P03920 2.96e-33 136 28 9 383 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos taurus
P29924 3.29e-33 136 30 14 438 3 nqo12 NADH-quinone oxidoreductase chain 12 Paracoccus denitrificans
Q5HRA9 3.59e-33 134 29 13 466 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q0Q2J7 3.77e-33 134 28 14 486 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus
Q8NXT1 3.83e-33 134 28 14 486 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MW2)
A8Z147 3.83e-33 134 28 14 486 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBK4 3.83e-33 134 28 14 486 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MSSA476)
A6QET6 3.83e-33 134 28 14 486 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Newman)
Q5HI42 3.83e-33 134 28 14 486 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain COL)
Q2YSV4 3.83e-33 134 28 14 486 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQH8 3.83e-33 134 28 14 486 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH9)
Q2G212 3.83e-33 134 28 14 486 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ12 3.83e-33 134 28 14 486 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300)
A6TZA2 3.83e-33 134 28 14 486 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH1)
Q35648 4.01e-33 135 27 10 403 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan troglodytes
Q9B8C9 4.54e-33 135 31 12 348 3 NAD5 NADH-ubiquinone oxidoreductase chain 5 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q00542 4.82e-33 135 29 7 336 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Phoca vitulina
Q2LCP6 6.65e-33 135 27 14 423 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium citrinum
O03205 7.33e-33 135 28 8 338 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ceratotherium simum
P03917 9.93e-33 134 30 6 319 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gorilla gorilla gorilla
Q9ZZ44 1.1e-32 134 29 11 357 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Squalus acanthias
Q7A725 1.17e-32 133 28 13 485 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain N315)
Q99VY9 1.17e-32 133 28 13 485 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7WZ79 1.17e-32 133 28 13 485 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q9K1B0 1.41e-32 134 27 10 418 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P11661 1.53e-32 134 28 8 343 3 Mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Rattus norvegicus
Q95885 1.66e-32 134 28 8 339 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Papio hamadryas
P50368 1.87e-32 134 30 8 330 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Schizophyllum commune
Q9TDR1 2.55e-32 133 28 8 338 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Sus scrofa
P03919 2.91e-32 133 29 7 336 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hylobates lar
Q9JX92 3.68e-32 133 27 10 418 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P33510 5.07e-32 132 30 10 333 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Anopheles quadrimaculatus
Q8W9M6 5.21e-32 132 30 5 285 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dugong dugon
O79411 5.21e-32 132 28 13 406 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Scyliorhinus canicula
O63908 7.2e-32 132 28 7 330 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Glis glis
Q6GJ44 7.71e-32 130 27 14 486 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MRSA252)
P34195 8.53e-32 132 31 7 300 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Formosania lacustris
P03921 9.54e-32 132 27 7 343 1 Mtnd5 NADH-ubiquinone oxidoreductase chain 5 Mus musculus
P18932 1.28e-31 131 27 15 444 1 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Drosophila melanogaster
Q1HK80 1.71e-31 131 28 8 374 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus
Q37372 2.19e-31 131 32 7 302 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Acanthamoeba castellanii
O21335 2.35e-31 130 28 8 373 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dasypus novemcinctus
Q35543 2.76e-31 130 29 10 363 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Petromyzon marinus
P48656 3e-31 130 30 7 329 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus caballus
P51899 3.37e-31 127 29 11 335 3 ND5 NADH-ubiquinone oxidoreductase chain 5 (Fragment) Anopheles arabiensis
Q9ZZM3 5.15e-31 129 30 8 303 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Salmo salar
P48921 5.52e-31 129 27 10 391 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Felis catus
P92669 6.15e-31 129 28 14 392 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Osphranter robustus
Q9ZZ57 8.86e-31 129 28 7 338 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus familiaris
Q2I3G4 1.01e-30 129 28 8 340 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Elephas maximus
Q9TA19 1.65e-30 128 28 8 340 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Loxodonta africana
P92485 1.65e-30 128 29 8 338 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus asinus
Q38PR2 1.87e-30 128 28 8 340 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Mammuthus primigenius
P92699 2.18e-30 127 31 4 285 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo abelii
P03915 2.81e-30 127 31 5 285 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Homo sapiens
P48176 2.92e-30 127 30 7 300 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oncorhynchus mykiss
P24979 2.92e-30 127 29 8 343 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Cyprinus carpio
P18940 3.03e-30 127 31 7 286 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gallus gallus
P34854 3.77e-30 127 29 11 335 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Anopheles gambiae
P03922 5.16e-30 126 26 13 435 3 mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Xenopus laevis
O03174 5.3e-30 126 29 11 355 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Latimeria chalumnae
Q4JQH7 5.38e-30 126 30 7 301 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Tetraodon nigroviridis
O78688 6.33e-30 126 29 9 341 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Carassius auratus
P55782 6.74e-30 126 29 10 344 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gadus morhua
P08739 7.51e-30 125 31 9 329 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Chlamydomonas reinhardtii
Q94RJ2 1.04e-29 125 30 6 286 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Chimaera monstrosa
P41309 1.8e-29 125 28 6 297 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Didelphis virginiana
Q9RGZ2 2.58e-29 123 27 12 421 1 mrpD Na(+)/H(+) antiporter subunit D Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
P03918 3.21e-29 124 31 5 285 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo pygmaeus
B0FWD3 4.43e-29 124 29 6 326 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Aedes aegypti
B1I6I5 5e-29 122 27 14 401 3 nuoN NADH-quinone oxidoreductase subunit N Desulforudis audaxviator (strain MP104C)
O79678 7.74e-29 123 31 9 295 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pelomedusa subrufa
Q36428 2e-28 122 29 7 329 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Locusta migratoria
P07706 3.01e-28 121 27 7 369 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Drosophila yakuba
A9RAH0 3.87e-28 121 30 10 343 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
O47430 8.22e-28 120 30 6 288 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Branchiostoma floridae
P12776 2.32e-27 119 32 8 273 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paracentrotus lividus
O79422 2.67e-27 118 30 7 288 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Branchiostoma lanceolatum
P77437 4.77e-27 117 31 10 357 3 hyfF Hydrogenase-4 component F Escherichia coli (strain K12)
P60687 5.19e-27 117 28 17 482 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MW2)
P60686 5.19e-27 117 28 17 482 1 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus
Q6GAX7 5.19e-27 117 28 17 482 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MSSA476)
P60685 5.19e-27 117 28 17 482 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain N315)
P60684 5.19e-27 117 28 17 482 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QFF9 5.19e-27 117 28 17 482 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Newman)
A5IRC7 5.19e-27 117 28 17 482 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH9)
Q2G2H7 5.19e-27 117 28 17 482 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6U056 5.19e-27 117 28 17 482 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH1)
A7X0F9 5.19e-27 117 28 17 482 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
P23482 5.7e-27 118 27 6 357 1 hyfB Hydrogenase-4 component B Escherichia coli (strain K12)
Q2YWT7 1.06e-26 116 28 17 482 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q4L446 1.16e-26 115 27 7 361 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus haemolyticus (strain JCSC1435)
Q9B6D3 1.17e-26 117 28 9 336 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Yarrowia lipolytica (strain CLIB 122 / E 150)
O79556 1.32e-26 116 27 8 334 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lycodon semicarinatus
A8Z056 1.81e-26 115 28 17 482 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300 / TCH1516)
Q2FIC6 1.81e-26 115 28 17 482 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300)
Q5HHD6 2.05e-26 115 28 17 482 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain COL)
Q8CPV1 2.07e-26 115 28 13 441 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
O05229 2.16e-26 115 26 11 424 1 mrpD Na(+)/H(+) antiporter subunit D Bacillus subtilis (strain 168)
P34855 2.41e-26 115 28 9 323 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Apis mellifera ligustica
P48918 2.42e-26 115 30 8 338 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Albinaria caerulea
Q49VH2 2.84e-26 114 28 7 361 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5HQL3 3.31e-26 114 28 13 441 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GID9 3.82e-26 114 28 17 482 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MRSA252)
Q37710 3.99e-26 114 30 7 306 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Artemia franciscana
Q00232 4.34e-26 114 30 12 336 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Mytilus edulis
A9QPJ1 5.7e-26 113 27 12 459 3 hyfF Hydrogenase-4 component F homolog Methylacidiphilum infernorum (isolate V4)
Q9G2W8 6.62e-26 114 30 8 296 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Myxine glutinosa
Q36459 7.07e-26 114 26 10 355 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ornithorhynchus anatinus
P11993 2.22e-25 113 30 10 309 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Patiria pectinifera
Q35813 2.63e-25 112 27 9 330 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Struthio camelus
Q9MIY0 7.24e-25 111 28 9 317 3 mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Danio rerio
Q37024 1.12e-24 110 29 9 305 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Wickerhamomyces canadensis
Q32905 1.41e-24 101 40 2 127 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Pisum sativum
Q4L4W4 3.44e-24 108 27 18 472 3 mnhD Na+/H+-antiporter, MnhD subunit Staphylococcus haemolyticus (strain JCSC1435)
Q9ZYM7 5.38e-24 108 27 7 323 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhipicephalus sanguineus
F1SVH9 8.21e-23 104 25 8 335 1 fpoM F(420)H(2) dehydrogenase subunit M Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P15552 1.17e-22 104 30 10 310 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Strongylocentrotus purpuratus
Q92G96 2.46e-22 103 28 8 334 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia conorii (strain ATCC VR-613 / Malish 7)
B2J565 2.78e-22 103 30 13 329 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q1RKE5 3.01e-22 102 28 9 338 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia bellii (strain RML369-C)
P15584 5e-22 102 27 9 400 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paramecium tetraurelia
Q5DUY0 5.4e-22 103 28 8 299 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Nyctotherus ovalis
Q34947 6.03e-22 102 27 12 388 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Lumbricus terrestris
A6LXP5 5.08e-21 99 28 8 311 3 nuoN NADH-quinone oxidoreductase subunit N Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
O67342 5.97e-21 99 29 14 339 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Aquifex aeolicus (strain VF5)
P9WIW5 6.61e-21 99 29 10 362 1 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW4 6.61e-21 99 29 10 362 3 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9ZCG0 7.62e-21 98 27 13 405 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia prowazekii (strain Madrid E)
Q49W88 1.18e-20 98 26 10 423 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A1JLL1 1.19e-20 98 28 10 313 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8KX56 1.44e-20 98 27 20 477 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
F1SVL2 1.63e-20 97 28 16 408 1 fpoN F(420)H(2) dehydrogenase subunit N Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P72823 1.95e-20 97 29 9 300 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B1X5V5 3.21e-20 97 27 10 377 3 ndhF2 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 2 Paulinella chromatophora
B0JHK5 3.46e-20 96 28 13 335 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A5FQX9 3.73e-20 96 29 13 358 3 nuoN NADH-quinone oxidoreductase subunit N Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q1DDD3 3.99e-20 96 26 16 405 3 nuoN NADH-quinone oxidoreductase subunit N Myxococcus xanthus (strain DK1622)
P24884 4.39e-20 96 29 12 330 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Ascaris suum
B2VIN7 6.12e-20 95 28 16 366 3 nuoN NADH-quinone oxidoreductase subunit N Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q8YQ78 6.8e-20 95 27 11 347 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7NGP8 9.07e-20 95 28 19 466 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q4UK26 9.43e-20 95 28 8 334 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
B1XJL9 9.47e-20 95 28 9 307 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q3ASV8 1.18e-19 95 28 13 358 3 nuoN NADH-quinone oxidoreductase subunit N Chlorobium chlorochromatii (strain CaD3)
Q3MCB9 1.26e-19 95 27 11 347 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A9R6K9 1.42e-19 94 27 12 363 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis bv. Antiqua (strain Angola)
B1JGM5 1.58e-19 94 27 12 363 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q669B2 1.58e-19 94 27 12 363 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TM24 1.58e-19 94 27 12 363 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis (strain Pestoides F)
Q1CHR3 1.58e-19 94 27 12 363 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CJ84 1.58e-19 94 27 12 363 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis
B2K809 1.58e-19 94 27 12 363 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C6C1 1.58e-19 94 27 12 363 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGR6 1.58e-19 94 27 12 363 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q31696 1.73e-19 91 30 4 192 3 ND5 NADH-ubiquinone oxidoreductase chain 5 (Fragment) Anopheles quadriannulatus
A8GH04 4.38e-19 93 27 10 313 3 nuoN NADH-quinone oxidoreductase subunit N Serratia proteamaculans (strain 568)
B7K1G4 4.67e-19 93 27 13 334 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Rippkaea orientalis (strain PCC 8801 / RF-1)
Q7N2J9 1.11e-18 92 28 12 323 3 nuoN NADH-quinone oxidoreductase subunit N Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P24896 1.32e-18 92 28 8 275 3 nduo-5 NADH-ubiquinone oxidoreductase chain 5 Caenorhabditis elegans
B9LGS9 1.45e-18 92 27 14 382 3 nuoN NADH-quinone oxidoreductase subunit N Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
Q68VV6 1.53e-18 91 28 6 264 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P50974 1.54e-18 91 25 11 392 3 nuoM NADH-quinone oxidoreductase subunit M Rhodobacter capsulatus
C6DA34 1.65e-18 91 28 13 319 3 nuoN NADH-quinone oxidoreductase subunit N Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B8JAZ0 1.89e-18 91 28 9 330 3 nuoN NADH-quinone oxidoreductase subunit N Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q5N5T8 2.24e-18 91 28 13 326 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P29801 2.24e-18 91 28 13 326 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
C0QR92 2.29e-18 91 23 11 379 3 nuoN NADH-quinone oxidoreductase subunit N Persephonella marina (strain DSM 14350 / EX-H1)
A4J650 2.68e-18 90 28 10 316 3 nuoN NADH-quinone oxidoreductase subunit N Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q9MUQ6 2.77e-18 90 27 11 331 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Mesostigma viride
Q2NSL1 3.01e-18 90 25 12 362 3 nuoN NADH-quinone oxidoreductase subunit N Sodalis glossinidius (strain morsitans)
Q7V2N8 3.31e-18 90 27 13 366 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
B7KEZ9 4.75e-18 90 27 12 335 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Gloeothece citriformis (strain PCC 7424)
Q02CT1 4.97e-18 90 27 12 345 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Solibacter usitatus (strain Ellin6076)
Q1QSU4 7.61e-18 89 28 17 409 3 nuoN NADH-quinone oxidoreductase subunit N Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q6D2S9 8.91e-18 89 27 10 314 3 nuoN NADH-quinone oxidoreductase subunit N Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5N5W1 1e-17 89 27 7 284 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31NA0 1e-17 89 27 7 284 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q1GTL2 1.2e-17 89 28 10 304 3 nuoN NADH-quinone oxidoreductase subunit N Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A5GMZ5 1.64e-17 88 27 12 360 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain WH7803)
A2BV95 2.14e-17 88 27 13 366 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain MIT 9515)
Q2RJT7 2.21e-17 88 27 18 425 3 nuoN NADH-quinone oxidoreductase subunit N Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
P32421 2.25e-17 88 25 8 346 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4-1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8DHX4 2.41e-17 88 27 7 296 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A9MJA9 2.47e-17 87 25 19 406 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5YKJ2 2.55e-17 87 28 12 302 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B5FPF7 2.66e-17 87 25 19 406 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella dublin (strain CT_02021853)
C1AZG0 3.22e-17 87 28 12 319 3 nuoN NADH-quinone oxidoreductase subunit N Rhodococcus opacus (strain B4)
Q3MB63 3.29e-17 87 30 13 329 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q5PN71 3.33e-17 87 25 16 406 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZNE4 3.39e-17 87 25 19 406 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9N592 3.39e-17 87 25 19 406 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5R2Z7 3.39e-17 87 25 19 406 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella enteritidis PT4 (strain P125109)
B5EZJ7 3.39e-17 87 25 19 406 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella agona (strain SL483)
Q57M40 3.95e-17 87 26 19 406 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella choleraesuis (strain SC-B67)
A9B488 4.13e-17 87 28 9 250 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q8Z530 4.25e-17 87 25 19 406 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella typhi
B4TPJ8 4.25e-17 87 25 19 406 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella schwarzengrund (strain CVM19633)
B4SYY7 4.25e-17 87 25 19 406 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella newport (strain SL254)
B4TBI2 4.25e-17 87 25 19 406 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella heidelberg (strain SL476)
B4EZ47 4.94e-17 87 27 17 366 3 nuoN NADH-quinone oxidoreductase subunit N Proteus mirabilis (strain HI4320)
A2BPR7 6.01e-17 87 26 12 361 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain AS9601)
Q8DMR6 6.03e-17 87 27 16 425 1 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q3M9C7 6.26e-17 87 25 9 351 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P04540 6.63e-17 87 30 9 243 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Trypanosoma brucei brucei
B2TW57 6.73e-17 86 25 14 401 3 nuoN NADH-quinone oxidoreductase subunit N Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q6YXR9 7.26e-17 86 28 10 313 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Physcomitrium patens
A7NL15 7.75e-17 86 30 8 265 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B9L178 7.92e-17 86 27 14 394 3 nuoN NADH-quinone oxidoreductase subunit N Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
A3PBF7 8.46e-17 86 26 12 360 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain MIT 9301)
B0JS85 8.68e-17 86 28 8 285 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q0TFH0 8.97e-17 86 24 11 401 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O6:K15:H31 (strain 536 / UPEC)
C0Q051 9.05e-17 86 25 19 406 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella paratyphi C (strain RKS4594)
Q3AGZ9 9.26e-17 86 27 19 423 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9605)
B1X5D6 9.69e-17 86 28 16 369 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, organellar chromatophore Paulinella chromatophora
Q31HC4 9.7e-17 86 27 9 287 1 dabB Probable inorganic carbon transporter subunit DabB Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q5SCY2 1.1e-16 85 30 9 271 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Huperzia lucidula
Q8YMQ0 1.17e-16 85 30 13 329 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A8G3E9 1.29e-16 85 26 10 341 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain MIT 9215)
Q8YZV7 1.35e-16 85 25 9 351 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3B063 1.41e-16 85 27 19 426 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9902)
Q31CA0 1.46e-16 85 26 10 341 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain MIT 9312)
Q3AWJ7 1.5e-16 85 27 12 363 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain CC9902)
A8M609 1.63e-16 85 31 11 259 3 nuoN NADH-quinone oxidoreductase subunit N Salinispora arenicola (strain CNS-205)
B5RCE1 1.67e-16 85 25 19 406 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella gallinarum (strain 287/91 / NCTC 13346)
A8ADW3 1.71e-16 85 26 16 362 3 nuoN NADH-quinone oxidoreductase subunit N Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B8FRJ7 1.88e-16 85 30 10 276 3 nuoN NADH-quinone oxidoreductase subunit N Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q0C1D1 1.9e-16 85 26 14 364 3 nuoN NADH-quinone oxidoreductase subunit N Hyphomonas neptunium (strain ATCC 15444)
B7MXV5 2.11e-16 85 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O81 (strain ED1a)
Q1R9E1 2.21e-16 85 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain UTI89 / UPEC)
Q8FFK3 2.21e-16 85 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1ADC4 2.21e-16 85 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O1:K1 / APEC
Q111U1 2.32e-16 85 29 14 331 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Trichodesmium erythraeum (strain IMS101)
Q7U413 2.51e-16 85 27 18 423 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Parasynechococcus marenigrum (strain WH8102)
Q0I8A7 2.61e-16 85 26 12 370 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain CC9311)
Q3YZT4 2.84e-16 84 24 13 400 3 nuoN NADH-quinone oxidoreductase subunit N Shigella sonnei (strain Ss046)
B1IXR6 3.02e-16 84 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A9B6Y0 3.12e-16 84 29 7 307 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q31YI5 3.22e-16 84 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Shigella boydii serotype 4 (strain Sb227)
Q83QT2 3.4e-16 84 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Shigella flexneri
A4WCQ5 3.58e-16 84 27 15 347 3 nuoN NADH-quinone oxidoreductase subunit N Enterobacter sp. (strain 638)
Q7VDE7 3.78e-16 84 28 15 396 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
B7NNV5 3.82e-16 84 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B1LLM9 3.92e-16 84 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain SMS-3-5 / SECEC)
B6I7M6 3.92e-16 84 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain SE11)
P0AFF0 3.92e-16 84 24 13 401 1 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain K12)
A8A2E5 3.92e-16 84 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O9:H4 (strain HS)
C4ZUB9 3.92e-16 84 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain K12 / MC4100 / BW2952)
B7M5V5 3.92e-16 84 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O8 (strain IAI1)
B5YXR6 3.92e-16 84 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AFF1 3.92e-16 84 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O157:H7
B7LAT8 3.92e-16 84 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain 55989 / EAEC)
B7UFT4 3.92e-16 84 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZP90 3.92e-16 84 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O139:H28 (strain E24377A / ETEC)
A7NPD6 5.66e-16 84 26 11 374 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q32DR3 5.77e-16 83 24 13 401 3 nuoN NADH-quinone oxidoreductase subunit N Shigella dysenteriae serotype 1 (strain Sd197)
A6TBW2 5.77e-16 83 25 16 361 3 nuoN NADH-quinone oxidoreductase subunit N Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XNW6 6.14e-16 83 25 16 361 3 nuoN NADH-quinone oxidoreductase subunit N Klebsiella pneumoniae (strain 342)
Q6MGN8 7.78e-16 83 28 9 264 3 nuoN NADH-quinone oxidoreductase subunit N Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
A7MHT8 8.18e-16 83 25 15 364 3 nuoN NADH-quinone oxidoreductase subunit N Cronobacter sakazakii (strain ATCC BAA-894)
Q2JWW3 9.62e-16 83 27 11 353 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-3-3Ab)
Q2S2K9 1.01e-15 83 27 11 339 3 nuoN NADH-quinone oxidoreductase subunit N Salinibacter ruber (strain DSM 13855 / M31)
A4XV14 1.09e-15 82 30 11 321 3 nuoN NADH-quinone oxidoreductase subunit N Pseudomonas mendocina (strain ymp)
Q3AC87 1.11e-15 82 27 7 258 3 nuoN NADH-quinone oxidoreductase subunit N Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q46GY3 1.24e-15 82 26 11 363 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain NATL2A)
Q7U538 1.28e-15 82 26 14 371 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Parasynechococcus marenigrum (strain WH8102)
Q8KX53 1.31e-15 82 26 10 310 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P29925 1.39e-15 82 26 10 340 3 nqo13 NADH-quinone oxidoreductase chain 13 Paracoccus denitrificans
Q2JPJ1 1.43e-15 82 28 13 369 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
C4K3W3 1.96e-15 82 24 15 384 3 nuoN NADH-quinone oxidoreductase subunit N Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
P72714 2.1e-15 82 29 9 262 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A0LJL8 3.05e-15 81 29 6 229 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q2JUG6 3.14e-15 81 28 14 411 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain JA-3-3Ab)
Q8DKY0 3.79e-15 81 28 11 307 1 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A5GP41 3.82e-15 81 29 11 262 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain WH7803)
A7ZBF3 4.07e-15 81 28 13 318 3 nuoN NADH-quinone oxidoreductase subunit N Campylobacter concisus (strain 13826)
B0C4B4 4.23e-15 81 25 12 348 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Acaryochloris marina (strain MBIC 11017)
B1WUS5 4.36e-15 81 27 13 336 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q89AT4 4.54e-15 80 23 13 367 3 nuoN NADH-quinone oxidoreductase subunit N Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8M9U1 5.24e-15 80 25 6 320 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chaetosphaeridium globosum
B8IUV9 5.61e-15 80 28 16 315 3 nuoN NADH-quinone oxidoreductase subunit N Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
A7H9U1 5.71e-15 80 26 11 329 3 nuoN NADH-quinone oxidoreductase subunit N Anaeromyxobacter sp. (strain Fw109-5)
Q7VFT5 5.84e-15 80 25 17 428 3 nuoN NADH-quinone oxidoreductase subunit N Helicobacter hepaticus (strain ATCC 51449 / 3B1)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS11140
Feature type CDS
Gene -
Product hydrogenase 4 subunit D
Location 367568 - 369010 (strand: 1)
Length 1443 (nucleotides) / 480 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000002
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_864
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00361 Proton-conducting membrane transporter
PF00662 NADH-Ubiquinone oxidoreductase (complex I), chain 5 N-terminus

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1009 Energy production and conversion (C) C Membrane H+-translocase/NADH:ubiquinone oxidoreductase subunit 5 (chain L)/Multisubunit Na+/H+ antiporter, MnhA subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K12139 hydrogenase-4 component D [EC:1.-.-.-] - -

Protein Sequence

MLENIALATLIIPFIGALLVSFLPTRMAPWLSTLVALLASLGTAALGWIYLDGGKVATTIELVQAGDVALFGFTIDGVSTLIAFAVVFLGFLICLYSTGYLTEGNREHAHGPTRRYYAFLLIFIGAMAGVVLSSTILGQLLFFEITGGCSWALIGYYQTEKAQRSAMKALLITHVGSLGLFMAAATLFISTGTFALSAIGQLDDAQSLIVFGGILFAAWGKSAQLPLQAWLPDAMEAPTPVSAYLHAASMVKVGVYIFARGIMSSDHVPEIIGWVGVVMAVITMIYGFMMYLPQKDMKRLLAWSTITQLAYIFLALSLSIFGSKEAFDGGIAYIFNHAFAKSLFFLVAGALSYSCGTRMLPRLRGLAKRYPLLGAGFCVAALAIAGVPPLNGFFSKFPIFAAGFALSEQFWIFAPIMVLVLIESVASFAWLLYWFGKVVPGEPSEDVANGAPVPWAMQWVIGLLIIMSFGSSVIAVSWLS

Flanking regions ( +/- flanking 50bp)

CGGCGCTCGGATTCGTGTTCTATCTCACCGGTCTGTAAGGAGCGACAAGCATGTTAGAAAATATTGCACTGGCGACCCTGATTATTCCGTTTATCGGGGCGTTGCTGGTCAGTTTCCTGCCGACGCGCATGGCTCCGTGGCTGAGTACATTAGTCGCGCTGCTGGCGTCTCTCGGTACGGCAGCTCTCGGCTGGATTTATCTCGACGGCGGTAAGGTTGCCACAACTATTGAACTGGTTCAGGCCGGTGATGTGGCGCTGTTTGGTTTCACCATTGATGGTGTAAGTACCCTGATAGCCTTCGCGGTGGTCTTCCTCGGCTTCCTGATTTGCCTGTACTCCACCGGTTACCTGACAGAAGGCAACCGCGAGCACGCGCACGGACCGACCCGCCGTTATTACGCCTTCCTGCTGATTTTTATCGGTGCGATGGCAGGTGTGGTGCTGTCCTCCACGATTTTAGGACAGTTATTGTTTTTTGAAATCACCGGAGGCTGTTCCTGGGCACTGATTGGTTATTATCAGACAGAAAAAGCGCAGCGTTCTGCGATGAAAGCCCTGCTGATAACCCATGTCGGTTCACTCGGTTTGTTCATGGCGGCAGCAACACTGTTTATCAGTACCGGTACTTTCGCACTGAGTGCGATTGGTCAGTTGGATGACGCACAGAGCCTGATTGTCTTCGGCGGGATTTTATTCGCGGCATGGGGCAAATCAGCGCAGTTACCATTACAAGCCTGGTTACCGGATGCGATGGAAGCACCAACACCGGTGAGTGCGTATCTGCACGCCGCGTCGATGGTCAAAGTCGGGGTGTATATCTTTGCCCGCGGCATTATGTCGTCAGACCATGTGCCGGAGATTATCGGCTGGGTCGGCGTCGTAATGGCTGTTATCACCATGATCTATGGTTTCATGATGTATCTGCCGCAAAAAGATATGAAACGTCTGCTGGCGTGGTCAACTATCACGCAACTGGCGTATATCTTCCTGGCACTGTCTCTGTCTATCTTCGGCTCTAAAGAAGCATTCGACGGCGGTATCGCGTACATCTTTAACCATGCGTTTGCAAAAAGCCTGTTCTTCCTGGTTGCCGGTGCGCTCAGCTACAGCTGCGGGACCCGTATGCTGCCCCGTTTGCGCGGTCTGGCAAAACGCTATCCGTTACTGGGTGCGGGTTTTTGTGTGGCAGCATTGGCGATTGCCGGTGTACCGCCGCTTAATGGTTTCTTCAGTAAATTTCCTATCTTCGCGGCAGGCTTCGCGTTATCTGAACAGTTCTGGATCTTCGCGCCAATCATGGTGCTGGTGTTGATCGAATCTGTTGCCAGTTTCGCCTGGCTGCTCTACTGGTTCGGGAAAGTCGTACCGGGTGAGCCAAGTGAAGATGTGGCCAATGGCGCGCCTGTGCCGTGGGCGATGCAGTGGGTTATCGGCCTGCTGATCATCATGTCCTTCGGCTCAAGTGTTATTGCCGTCAGCTGGCTCAGTTAAGGGAGAGAAAGTATGACTGGTTCAATTATTGTGAATAACCTGGCGGGGCT