Homologs in group_795

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_06805 EHELCC_06805 100.0 Morganella morganii S2 nuoL hydrogenase 4 subunit D
NLDBIP_07130 NLDBIP_07130 100.0 Morganella morganii S4 nuoL hydrogenase 4 subunit D
LHKJJB_06665 LHKJJB_06665 100.0 Morganella morganii S3 nuoL hydrogenase 4 subunit D
HKOGLL_04265 HKOGLL_04265 100.0 Morganella morganii S5 nuoL hydrogenase 4 subunit D
F4V73_RS11140 F4V73_RS11140 95.2 Morganella psychrotolerans - hydrogenase 4 subunit D
PMI_RS12485 PMI_RS12485 81.2 Proteus mirabilis HI4320 - hydrogenase 4 subunit D

Distribution of the homologs in the orthogroup group_795

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_795

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P77416 0.0 667 69 0 478 3 hyfD Hydrogenase-4 component D Escherichia coli (strain K12)
P33607 5.27e-54 194 35 12 424 1 nuoL NADH-quinone oxidoreductase subunit L Escherichia coli (strain K12)
Q32384 6.94e-51 187 32 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Helianthus annuus
Q9RGZ5 7.17e-51 188 35 14 438 1 mrpA Na(+)/H(+) antiporter subunit A Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q32091 9.25e-51 187 32 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carthamus tinctorius
Q32238 1.12e-50 187 32 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Flaveria ramosissima
Q8CPU8 1.99e-50 187 37 9 344 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQL0 1.99e-50 187 37 9 344 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q31849 2.15e-50 186 32 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ambrosia trifida
P51095 2.47e-50 186 32 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adenocaulon himalaicum
Q32007 3.64e-50 185 33 11 366 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cichorium intybus
P51098 4.31e-50 185 32 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Athroisma gracile
Q32126 4.47e-50 185 32 10 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dampiera diversifolia
Q32551 4.8e-50 185 32 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mutisia acuminata
B2LMQ1 8.36e-50 184 32 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Guizotia abyssinica
Q49W91 8.5e-50 185 35 13 403 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P31971 1.28e-49 183 32 14 437 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P51099 2.3e-49 183 32 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atractylodes lancea
P51097 2.91e-49 183 32 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Symphyotrichum cordifolium
Q9PMA7 3.2e-49 181 29 12 459 3 nuoL NADH-quinone oxidoreductase subunit L Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q4L4W7 3.43e-49 183 34 11 397 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus haemolyticus (strain JCSC1435)
Q0G9R5 4.72e-49 182 32 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Daucus carota
P51096 6.29e-49 182 31 10 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anisothrix integra
Q32539 6.41e-49 182 32 11 366 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lactuca sativa
Q9K2S2 1.85e-48 181 36 9 346 1 mrpA Na(+)/H(+) antiporter subunit A Bacillus subtilis (strain 168)
Q68RV9 2.38e-48 180 32 10 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Panax ginseng
Q2L960 2.65e-48 180 32 12 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium hirsutum
Q859V1 3.6e-48 179 30 13 425 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anthoceros angustus
A0ZZ82 4.16e-48 179 32 12 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium barbadense
Q9TKV7 4.69e-48 178 32 9 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nephroselmis olivacea
Q9TLC2 5.03e-48 179 31 10 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Tecoma stans
A0A382 5.69e-48 179 33 10 365 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Coffea arabica
Q2VED3 5.74e-48 179 32 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum tuberosum
Q2MIE0 8.02e-48 179 32 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum bulbocastanum
Q9M3J4 9.73e-48 179 33 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Spinacia oleracea
Q8S8V0 1.02e-47 178 31 10 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atropa belladonna
P51100 1.08e-47 178 31 11 369 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gerbera jamesonii
Q32516 1.18e-47 178 31 10 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum lycopersicum
P06265 1.24e-47 178 31 10 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tabacum
Q3C1N9 1.3e-47 178 31 10 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana sylvestris
Q33BX5 1.42e-47 178 32 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tomentosiformis
Q6EW03 2.34e-47 177 30 9 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nymphaea alba
Q2QD43 2.45e-47 177 32 11 369 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cucumis sativus
Q2YWT4 3.16e-47 177 38 11 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NXF6 3.32e-47 177 38 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MW2)
A8Z059 3.32e-47 177 38 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GAX4 3.32e-47 177 38 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MSSA476)
A6QFG2 3.32e-47 177 38 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Newman)
Q5HHD3 3.32e-47 177 38 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain COL)
Q2FZV1 3.32e-47 177 38 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIC3 3.32e-47 177 38 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300)
P60675 3.38e-47 177 38 10 340 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain N315)
P60674 3.38e-47 177 38 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRD0 3.38e-47 177 38 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH9)
A6U059 3.38e-47 177 38 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH1)
A7X0G4 3.38e-47 177 38 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q9ZNG6 3.45e-47 177 38 10 340 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus
Q9TLA3 4e-47 177 30 8 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ligustrum vulgare
Q31952 4e-47 176 31 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Capsicum baccatum
Q52978 4.44e-47 178 34 10 412 3 phaAB Probable K(+)/H(+) antiporter subunit A/B Rhizobium meliloti (strain 1021)
Q6GID6 7.29e-47 177 38 10 340 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MRSA252)
Q33113 7.9e-47 175 31 11 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Sesamum indicum
Q9MUK8 8.81e-47 175 32 10 363 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mesostigma viride
A1XG02 9e-47 176 29 8 367 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nuphar advena
Q32131 1.07e-46 175 31 11 369 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Digitalis grandiflora
Q9MVL6 1.08e-46 175 31 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Malvaviscus arboreus
Q55429 1.22e-46 175 31 10 395 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A7Y3K7 1.26e-46 175 31 10 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ipomoea purpurea
Q49VG9 1.73e-46 176 32 13 408 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A4GGE3 2.72e-46 174 31 8 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Phaseolus vulgaris
P15958 4.44e-46 174 31 10 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vicia faba
Q09FR3 6.83e-46 173 30 10 372 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nandina domestica
Q8NXT2 7.65e-46 174 31 12 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MW2)
Q6GBK7 7.65e-46 174 31 12 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MSSA476)
A9L9E4 1.03e-45 173 34 13 363 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lemna minor
Q8W8H5 1.07e-45 173 32 13 384 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Psilotum nudum
Q06GK2 1.72e-45 172 31 10 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Piper cenocladum
B1X491 2.1e-45 171 32 9 364 3 ndhF1 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 1 Paulinella chromatophora
Q9I0J1 2.44e-45 170 33 18 475 3 nuoL NADH-quinone oxidoreductase subunit L Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q49KV1 2.86e-45 171 33 12 372 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Eucalyptus globulus subsp. globulus
Q0Q2K0 3.08e-45 172 31 12 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus
A8Z144 3.08e-45 172 31 12 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300 / TCH1516)
A6QET3 3.08e-45 172 31 12 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Newman)
Q5HI45 3.08e-45 172 31 12 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain COL)
Q2G2U8 3.08e-45 172 31 12 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ15 3.08e-45 172 31 12 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300)
Q9BBP6 3.41e-45 171 30 9 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lotus japonicus
B0Z5H4 3.85e-45 171 32 11 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera parviflora
B0Z590 3.85e-45 171 32 11 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera glazioviana
B0Z506 3.85e-45 171 32 11 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera biennis
B0Z4S2 3.85e-45 171 32 11 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera argillicola
Q9MTI4 4.08e-45 171 32 11 371 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera elata subsp. hookeri
B5LMS9 4.17e-45 171 30 10 374 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cicer arietinum
Q8CQ50 4.85e-45 171 31 10 385 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P57262 5.3e-45 169 35 8 336 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q09FZ9 5.59e-45 171 32 12 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Platanus occidentalis
Q99VZ2 5.72e-45 171 30 11 437 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain N315)
Q932F5 5.72e-45 171 30 11 437 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQH5 5.72e-45 171 30 11 437 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH9)
A6TZ99 5.72e-45 171 30 11 437 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH1)
A7WZ76 5.72e-45 171 30 11 437 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q5HRB2 5.88e-45 171 31 10 385 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9MVK2 6.6e-45 170 31 12 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Pachira aquatica
Q32RH9 7.42e-45 170 34 13 363 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zygnema circumcarinatum
Q92G97 9.91e-45 169 28 15 498 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia conorii (strain ATCC VR-613 / Malish 7)
B1VKJ3 1.32e-44 170 31 10 354 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cryptomeria japonica
Q32440 1.47e-44 169 32 10 367 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Hordeum vulgare
Q3V4Y7 1.62e-44 169 31 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus
A9LYE7 1.64e-44 169 31 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus var. americanus
Q4UK27 2.03e-44 168 27 15 498 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q06R83 2.33e-44 169 32 9 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Jasminum nudiflorum
Q2YST2 2.78e-44 169 30 11 437 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q33066 3.01e-44 169 31 9 365 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Sorghum bicolor
B1NWJ6 3.09e-44 169 31 11 374 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Manihot esculenta
Q2PMM9 3.36e-44 169 31 11 374 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Glycine max
Q9XAR5 3.69e-44 167 33 10 440 3 nuoL NADH-quinone oxidoreductase subunit L Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A4QKP2 4.13e-44 168 32 9 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Capsella bursa-pastoris
Q0ZIX1 4.13e-44 168 31 10 372 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vitis vinifera
A4QLP4 4.3e-44 168 32 9 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lobularia maritima
Q32880 4.46e-44 168 31 9 365 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Poa pratensis
B3TN96 4.49e-44 168 32 11 365 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Brachypodium distachyon
B1A981 5.22e-44 168 32 12 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carica papaya
Q70XW6 5.22e-44 168 31 9 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Amborella trichopoda
P46620 5.94e-44 168 31 9 365 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zea mays
Q6GJ47 6.36e-44 168 32 10 390 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MRSA252)
Q1ACF3 6.55e-44 167 31 11 409 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chara vulgaris
P0C328 7.96e-44 167 32 11 365 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. japonica
P0C327 7.96e-44 167 32 11 365 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. indica
P0C326 7.96e-44 167 32 11 365 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa
Q6ENB0 7.96e-44 167 32 11 365 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza nivara
Q4L443 8.17e-44 168 33 11 399 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus haemolyticus (strain JCSC1435)
Q6ENQ0 8.27e-44 167 31 9 365 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum officinarum
Q6L3E3 8.51e-44 167 31 9 365 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum hybrid
A4GYW4 9.18e-44 167 32 10 366 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus trichocarpa
B2XWI8 9.47e-44 167 33 11 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Fagopyrum esculentum subsp. ancestrale
A1XGU4 1.32e-43 167 32 10 368 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ranunculus macranthus
A1EA56 1.35e-43 167 31 9 365 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Agrostis stolonifera
Q06GU9 1.49e-43 167 32 12 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Drimys granadensis
A4QJX9 1.55e-43 167 31 8 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Olimarabidopsis pumila
Q09MC9 1.93e-43 166 31 10 366 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Citrus sinensis
A8Y9D4 2.12e-43 166 31 9 365 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lolium perenne
P56752 2.3e-43 166 31 8 364 1 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabidopsis thaliana
A4QK67 2.41e-43 166 31 8 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabis hirsuta
Q14FB0 2.66e-43 166 31 9 366 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus alba
A4QLF6 3.53e-43 166 31 8 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lepidium virginicum
Q95H46 4.29e-43 165 31 9 365 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Triticum aestivum
A4QKF4 4.54e-43 165 31 8 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Barbarea verna
Q0G9H2 4.57e-43 165 30 11 372 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Liriodendron tulipifera
Q1RKE6 4.6e-43 164 28 14 498 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia bellii (strain RML369-C)
A4QL68 5.14e-43 165 31 8 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Draba nemorosa
A6MM84 8.22e-43 164 32 12 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Buxus microphylla
Q32S06 8.67e-43 164 30 7 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Staurastrum punctulatum
A4QLY2 1.09e-42 164 31 8 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nasturtium officinale
Q6YXQ6 1.36e-42 164 32 12 352 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Physcomitrium patens
A6MMI0 1.54e-42 164 30 10 372 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chloranthus spicatus
A6MMR6 1.67e-42 164 31 10 372 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dioscorea elephantipes
A2T379 1.73e-42 164 32 10 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Angiopteris evecta
Q09WX1 2.68e-42 163 32 12 370 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Morus indica
Q8K9X7 9.09e-42 160 30 10 415 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q7YJT6 1.01e-41 161 31 11 372 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Calycanthus floridus var. glaucus
A8SEF0 1.27e-41 161 31 10 372 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ceratophyllum demersum
A4QKY1 1.29e-41 161 31 8 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Crucihimalaya wallichii
A6MMZ2 1.66e-41 161 32 12 369 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Illicium oligandrum
A6H5N8 2.69e-41 160 30 10 369 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cycas taitungensis
P9WIW1 2.76e-41 159 35 6 338 1 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW0 2.76e-41 159 35 6 338 3 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q5SCZ9 3.87e-41 160 30 14 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Huperzia lucidula
Q9ZCG1 4.05e-41 159 29 6 354 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia prowazekii (strain Madrid E)
P06264 5.19e-41 159 30 13 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Marchantia polymorpha
Q8M9U5 5.27e-41 159 30 8 353 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chaetosphaeridium globosum
Q9TL56 1.03e-40 159 31 10 369 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carpenteria californica
Q85FH9 1.04e-40 158 31 8 351 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adiantum capillus-veneris
Q06FL7 1.52e-40 158 30 11 374 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Pelargonium hortorum
F1SVK0 1.86e-40 157 33 11 377 1 fpoL F(420)H(2) dehydrogenase subunit L Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q19V60 5.58e-40 155 29 9 373 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chlorokybus atmophyticus
Q68VV7 1.14e-39 155 27 8 430 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A4QJG3 2.51e-39 154 31 8 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema cordifolium
A4QJP7 3.18e-39 154 31 8 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema grandiflorum
P50367 3.94e-39 153 33 8 334 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhizopus stolonifer
P29388 5.55e-38 150 31 17 414 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Arabidopsis thaliana
Q85T01 9.08e-38 149 31 9 343 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q56227 1.73e-37 148 33 7 309 1 nqo12 NADH-quinone oxidoreductase subunit 12 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q37680 5.1e-37 147 32 10 345 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Triticum aestivum
P50366 5.2e-37 147 32 10 353 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Phytophthora infestans
Q35099 5.43e-37 147 31 10 338 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Metridium senile
P50939 8.5e-37 147 30 15 431 3 nuoL NADH-quinone oxidoreductase subunit L Rhodobacter capsulatus
Q89AT6 1.57e-36 145 30 8 354 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q0H8X0 2.72e-36 145 32 8 347 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Ustilago maydis (strain 521 / FGSC 9021)
Q01561 3.06e-36 145 32 10 353 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Trichophyton rubrum
P10330 5.08e-36 144 30 14 416 2 ND5 NADH-ubiquinone oxidoreductase chain 5 Oenothera berteroana
Q9ZZY1 1.25e-35 142 29 7 344 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hippopotamus amphibius
P26849 1.73e-35 143 30 9 346 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Marchantia polymorpha
Q8SHP7 4.02e-35 142 32 8 335 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Hypocrea jecorina
Q576B4 8.18e-35 140 30 6 334 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos indicus
Q34879 8.22e-35 140 29 7 329 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lemur catta
Q9K1B0 1.41e-34 140 28 12 419 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P24978 1.42e-34 140 29 7 344 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera physalus
P41299 1.91e-34 139 29 7 336 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera musculus
P05510 1.93e-34 140 28 11 408 3 ndh-5 NADH-ubiquinone oxidoreductase chain 5 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
O79437 2.22e-34 139 29 7 344 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oryctolagus cuniculus
Q9JX92 2.88e-34 139 28 10 418 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q76LN2 3.37e-34 139 31 6 293 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rousettus amplexicaudatus
O78756 4.7e-34 138 29 7 329 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ovis aries
P50365 5.05e-34 138 31 7 346 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Allomyces macrogynus
P48919 5.95e-34 137 32 12 348 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Candida parapsilosis
Q9B8C9 6.55e-34 137 33 12 348 3 NAD5 NADH-ubiquinone oxidoreductase chain 5 Candida albicans (strain SC5314 / ATCC MYA-2876)
P29924 9.97e-34 138 31 15 413 3 nqo12 NADH-quinone oxidoreductase chain 12 Paracoccus denitrificans
P48920 1.01e-33 138 31 8 341 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Chondrus crispus
O47815 1.21e-33 137 30 11 356 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Geomys personatus
P03920 1.26e-33 137 29 6 334 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos taurus
Q6V9D9 1.49e-33 137 30 10 367 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Talaromyces marneffei
P38602 1.84e-33 137 30 8 332 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Halichoerus grypus
Q34313 2.66e-33 136 27 19 501 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium discoideum
Q6QU67 2.76e-33 136 30 9 361 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Aspergillus niger
O03205 2.99e-33 136 28 7 329 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ceratotherium simum
P03916 4.94e-33 135 31 5 285 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan paniscus
Q00542 5.72e-33 135 30 9 341 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Phoca vitulina
Q96069 7.26e-33 135 28 7 329 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rhinoceros unicornis
P03917 7.32e-33 135 30 6 319 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gorilla gorilla gorilla
Q95918 8.13e-33 135 31 6 298 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Polypterus ornatipinnis
Q8HHD2 1.31e-32 134 30 8 342 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryphonectria parasitica
Q8CQ47 1.32e-32 133 28 13 467 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q35648 1.55e-32 134 31 5 285 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan troglodytes
P20679 1.64e-32 134 30 7 334 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
Q2LCP6 1.77e-32 134 27 18 493 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium citrinum
Q953I4 1.78e-32 134 28 10 390 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Episoriculus fumidus
P03919 2.11e-32 133 29 6 327 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hylobates lar
Q37372 2.66e-32 134 32 6 301 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Acanthamoeba castellanii
Q8NXT1 2.7e-32 132 28 15 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MW2)
A8Z147 2.7e-32 132 28 15 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBK4 2.7e-32 132 28 15 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MSSA476)
A6QET6 2.7e-32 132 28 15 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Newman)
Q5HI42 2.7e-32 132 28 15 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain COL)
Q2YSV4 2.7e-32 132 28 15 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQH8 2.7e-32 132 28 15 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH9)
Q2G212 2.7e-32 132 28 15 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ12 2.7e-32 132 28 15 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300)
A6TZA2 2.7e-32 132 28 15 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH1)
Q0Q2J7 2.84e-32 132 28 15 487 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus
P18932 3.01e-32 132 28 12 389 1 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Drosophila melanogaster
Q9TDR1 3.09e-32 133 28 7 335 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Sus scrofa
Q95885 3.21e-32 133 28 7 329 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Papio hamadryas
P50368 3.29e-32 133 30 7 330 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Schizophyllum commune
P11628 6.07e-32 132 30 10 358 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Emericella nidulans
Q5HRA9 6.48e-32 131 28 13 466 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8W9M6 6.8e-32 132 31 5 285 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dugong dugon
Q7A725 7.2e-32 130 27 14 486 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain N315)
Q99VY9 7.2e-32 130 27 14 486 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7WZ79 7.2e-32 130 27 14 486 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
P51899 7.59e-32 129 30 11 335 3 ND5 NADH-ubiquinone oxidoreductase chain 5 (Fragment) Anopheles arabiensis
P33510 7.94e-32 131 29 9 333 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Anopheles quadrimaculatus
P03921 8.19e-32 132 28 7 343 1 Mtnd5 NADH-ubiquinone oxidoreductase chain 5 Mus musculus
P11661 1.64e-31 131 28 8 343 3 Mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Rattus norvegicus
P34195 1.74e-31 131 31 7 300 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Formosania lacustris
Q6GJ44 2.08e-31 129 28 16 488 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MRSA252)
O63908 2.99e-31 130 27 8 339 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Glis glis
P18940 4.85e-31 129 31 7 286 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gallus gallus
Q2I3G4 5.02e-31 129 28 8 340 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Elephas maximus
Q1HK80 6.67e-31 129 28 8 374 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus
P48921 7.33e-31 129 27 9 382 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Felis catus
Q9TA19 8.13e-31 129 28 8 340 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Loxodonta africana
Q9ZZ44 1.01e-30 129 30 7 294 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Squalus acanthias
Q9ZZM3 1.11e-30 129 28 10 364 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Salmo salar
Q38PR2 1.13e-30 128 28 8 340 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Mammuthus primigenius
P08739 1.18e-30 128 32 9 329 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Chlamydomonas reinhardtii
P92669 1.25e-30 128 27 13 393 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Osphranter robustus
P34854 1.26e-30 128 30 10 335 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Anopheles gambiae
O79411 1.36e-30 128 31 7 299 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Scyliorhinus canicula
O21335 1.8e-30 128 28 8 371 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dasypus novemcinctus
P48656 2.27e-30 127 29 7 329 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus caballus
P48176 2.92e-30 127 28 10 364 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oncorhynchus mykiss
Q9ZZ57 3.48e-30 127 29 7 338 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus familiaris
P24979 4.07e-30 127 30 6 298 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Cyprinus carpio
P03915 4.33e-30 127 31 5 285 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Homo sapiens
O78688 4.42e-30 127 29 9 341 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Carassius auratus
Q35543 5.13e-30 126 29 9 341 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Petromyzon marinus
P92699 8.14e-30 126 32 4 285 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo abelii
P41309 8.4e-30 126 28 8 342 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Didelphis virginiana
P92485 1.13e-29 125 29 8 338 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus asinus
P55782 1.2e-29 125 29 9 326 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gadus morhua
Q94RJ2 1.79e-29 125 30 6 286 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Chimaera monstrosa
Q4JQH7 2.33e-29 124 30 6 298 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Tetraodon nigroviridis
P03922 2.83e-29 124 27 12 407 3 mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Xenopus laevis
O03174 4.38e-29 124 28 11 361 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Latimeria chalumnae
B0FWD3 4.65e-29 124 29 8 332 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Aedes aegypti
Q9B6D3 6.08e-29 124 28 9 358 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Yarrowia lipolytica (strain CLIB 122 / E 150)
P03918 1.05e-28 122 31 5 285 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo pygmaeus
P07706 1.5e-28 122 28 9 372 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Drosophila yakuba
B1I6I5 3.22e-28 120 27 14 386 3 nuoN NADH-quinone oxidoreductase subunit N Desulforudis audaxviator (strain MP104C)
O47430 5.72e-28 120 29 7 311 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Branchiostoma floridae
Q9RGZ2 6.94e-28 119 30 5 290 1 mrpD Na(+)/H(+) antiporter subunit D Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
O79678 7.21e-28 120 29 12 342 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pelomedusa subrufa
P12776 7.22e-28 120 33 8 273 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paracentrotus lividus
O79422 2.28e-27 119 29 8 311 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Branchiostoma lanceolatum
A9RAH0 2.28e-27 119 31 13 351 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P23482 2.29e-27 119 26 10 417 1 hyfB Hydrogenase-4 component B Escherichia coli (strain K12)
P34855 2.56e-27 118 28 9 325 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Apis mellifera ligustica
P77437 2.71e-27 118 31 10 357 3 hyfF Hydrogenase-4 component F Escherichia coli (strain K12)
Q36428 3e-27 118 27 8 340 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Locusta migratoria
Q00232 3.13e-27 118 30 11 333 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Mytilus edulis
Q4L446 6.7e-27 116 27 8 362 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus haemolyticus (strain JCSC1435)
O05229 9.3e-27 116 27 7 343 1 mrpD Na(+)/H(+) antiporter subunit D Bacillus subtilis (strain 168)
O79556 9.92e-27 117 27 9 350 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lycodon semicarinatus
A9QPJ1 1.43e-26 115 27 15 459 3 hyfF Hydrogenase-4 component F homolog Methylacidiphilum infernorum (isolate V4)
Q37710 2.67e-26 115 31 7 306 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Artemia franciscana
Q49VH2 3.91e-26 114 28 8 361 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P48918 4.62e-26 114 30 9 350 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Albinaria caerulea
Q36459 4.71e-26 115 26 10 354 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ornithorhynchus anatinus
Q9G2W8 9.66e-26 114 31 8 296 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Myxine glutinosa
P11993 1.99e-25 113 30 10 309 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Patiria pectinifera
Q35813 3.56e-25 112 27 10 331 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Struthio camelus
Q37024 3.68e-25 112 29 9 305 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Wickerhamomyces canadensis
Q32905 4.42e-25 103 41 2 126 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Pisum sativum
P60687 6.72e-25 110 30 10 322 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MW2)
P60686 6.72e-25 110 30 10 322 1 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus
Q6GAX7 6.72e-25 110 30 10 322 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MSSA476)
P60685 6.72e-25 110 30 10 322 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain N315)
P60684 6.72e-25 110 30 10 322 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QFF9 6.72e-25 110 30 10 322 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Newman)
Q2YWT7 6.72e-25 110 30 10 322 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IRC7 6.72e-25 110 30 10 322 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH9)
Q2G2H7 6.72e-25 110 30 10 322 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6U056 6.72e-25 110 30 10 322 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH1)
A7X0F9 6.72e-25 110 30 10 322 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q5HHD6 6.78e-25 110 30 10 322 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain COL)
Q9MIY0 1.68e-24 110 27 9 318 3 mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Danio rerio
A8Z056 1.93e-24 109 30 10 322 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300 / TCH1516)
Q2FIC6 1.93e-24 109 30 10 322 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300)
Q8CPV1 2.1e-24 109 27 12 438 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q6GID9 2.35e-24 109 30 10 322 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MRSA252)
Q5HQL3 2.66e-24 108 27 12 438 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4L4W4 2.11e-23 106 27 10 361 3 mnhD Na+/H+-antiporter, MnhD subunit Staphylococcus haemolyticus (strain JCSC1435)
P15552 2.36e-23 107 30 10 310 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Strongylocentrotus purpuratus
F1SVH9 3.84e-23 105 24 8 384 1 fpoM F(420)H(2) dehydrogenase subunit M Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q9ZYM7 1.75e-22 103 26 7 323 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhipicephalus sanguineus
P15584 6.34e-22 102 27 9 400 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paramecium tetraurelia
Q5DUY0 1.16e-21 102 28 8 300 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Nyctotherus ovalis
B2J565 1.87e-21 100 27 17 418 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q92G96 5.19e-21 99 27 8 334 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia conorii (strain ATCC VR-613 / Malish 7)
O67342 8.55e-21 98 29 14 339 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Aquifex aeolicus (strain VF5)
Q1RKE5 1.06e-20 98 26 9 338 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia bellii (strain RML369-C)
Q34947 1.43e-20 98 28 10 337 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Lumbricus terrestris
F1SVL2 1.76e-20 97 27 13 424 1 fpoN F(420)H(2) dehydrogenase subunit N Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q7NGP8 2.94e-20 97 28 19 468 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
P9WIW5 3.38e-20 97 26 15 486 1 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW4 3.38e-20 97 26 15 486 3 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A6LXP5 3.88e-20 96 28 10 313 3 nuoN NADH-quinone oxidoreductase subunit N Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
B0JHK5 8.06e-20 95 28 12 326 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q31696 8.93e-20 92 30 4 192 3 ND5 NADH-ubiquinone oxidoreductase chain 5 (Fragment) Anopheles quadriannulatus
Q9ZCG0 1.22e-19 95 26 13 405 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia prowazekii (strain Madrid E)
Q4UK26 1.3e-19 95 27 8 334 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
B9LGS9 1.86e-19 94 28 17 414 3 nuoN NADH-quinone oxidoreductase subunit N Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A5FQX9 1.97e-19 94 28 12 337 3 nuoN NADH-quinone oxidoreductase subunit N Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q8KX56 2.06e-19 94 26 15 417 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q5N5T8 3.68e-19 93 26 19 467 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P29801 3.68e-19 93 26 19 467 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B1XJL9 4.64e-19 93 26 15 421 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P24884 4.94e-19 93 29 12 330 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Ascaris suum
Q49W88 6e-19 92 26 12 424 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B7K1G4 7.83e-19 92 28 12 324 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Rippkaea orientalis (strain PCC 8801 / RF-1)
A1JLL1 8.91e-19 92 27 10 313 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q68VV6 9.11e-19 92 28 6 264 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q3ASV8 9.93e-19 92 27 15 389 3 nuoN NADH-quinone oxidoreductase subunit N Chlorobium chlorochromatii (strain CaD3)
P50974 1.01e-18 92 25 10 390 3 nuoM NADH-quinone oxidoreductase subunit M Rhodobacter capsulatus
B7KEZ9 1.23e-18 92 29 10 278 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Gloeothece citriformis (strain PCC 7424)
B1X5V5 1.31e-18 92 27 7 313 3 ndhF2 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 2 Paulinella chromatophora
Q9MUQ6 1.4e-18 92 26 11 365 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Mesostigma viride
Q8YQ78 1.57e-18 91 26 11 347 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A8GH04 2.19e-18 91 27 10 313 3 nuoN NADH-quinone oxidoreductase subunit N Serratia proteamaculans (strain 568)
Q3MCB9 2.4e-18 91 28 9 306 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B8JAZ0 3.57e-18 90 27 8 330 3 nuoN NADH-quinone oxidoreductase subunit N Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q02CT1 3.68e-18 90 27 12 345 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Solibacter usitatus (strain Ellin6076)
B2VIN7 4.95e-18 90 27 14 319 3 nuoN NADH-quinone oxidoreductase subunit N Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
P72823 5.44e-18 90 27 8 300 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P24896 6.33e-18 90 28 8 275 3 nduo-5 NADH-ubiquinone oxidoreductase chain 5 Caenorhabditis elegans
Q1DDD3 7.25e-18 89 25 15 403 3 nuoN NADH-quinone oxidoreductase subunit N Myxococcus xanthus (strain DK1622)
P04540 9.38e-18 89 30 9 245 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Trypanosoma brucei brucei
Q1GTL2 9.54e-18 89 28 10 304 3 nuoN NADH-quinone oxidoreductase subunit N Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
B5YKJ2 2.31e-17 87 28 12 301 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
C1AZG0 2.53e-17 88 28 12 319 3 nuoN NADH-quinone oxidoreductase subunit N Rhodococcus opacus (strain B4)
Q0C1D1 2.79e-17 87 25 17 435 3 nuoN NADH-quinone oxidoreductase subunit N Hyphomonas neptunium (strain ATCC 15444)
C6DA34 2.93e-17 87 26 10 319 3 nuoN NADH-quinone oxidoreductase subunit N Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q31HC4 3.61e-17 87 27 10 332 1 dabB Probable inorganic carbon transporter subunit DabB Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A9R6K9 3.95e-17 87 28 11 320 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis bv. Antiqua (strain Angola)
B4EZ47 4.31e-17 87 27 16 366 3 nuoN NADH-quinone oxidoreductase subunit N Proteus mirabilis (strain HI4320)
B1JGM5 4.4e-17 87 28 11 320 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q669B2 4.4e-17 87 28 11 320 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TM24 4.4e-17 87 28 11 320 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis (strain Pestoides F)
Q1CHR3 4.4e-17 87 28 11 320 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CJ84 4.4e-17 87 28 11 320 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis
B2K809 4.4e-17 87 28 11 320 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C6C1 4.4e-17 87 28 11 320 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGR6 4.4e-17 87 28 11 320 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q3MB63 4.72e-17 87 30 12 319 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A9B488 4.89e-17 87 28 9 250 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q3AGZ9 5.97e-17 87 26 21 487 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9605)
Q3B063 6.05e-17 87 26 21 490 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9902)
Q7V2N8 6.4e-17 86 26 13 379 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
P32421 7.3e-17 86 25 12 369 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4-1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8DHX4 8.02e-17 86 26 7 296 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A7NPD6 1.02e-16 86 27 13 376 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q8YMQ0 1.49e-16 85 30 12 319 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B2TW57 1.54e-16 85 26 11 357 3 nuoN NADH-quinone oxidoreductase subunit N Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q7N2J9 1.54e-16 85 27 12 323 3 nuoN NADH-quinone oxidoreductase subunit N Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6D2S9 1.61e-16 85 26 7 314 3 nuoN NADH-quinone oxidoreductase subunit N Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q46GY3 1.65e-16 85 26 12 382 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain NATL2A)
B1X5D6 1.74e-16 85 28 14 371 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, organellar chromatophore Paulinella chromatophora
C0QR92 1.8e-16 85 22 11 379 3 nuoN NADH-quinone oxidoreductase subunit N Persephonella marina (strain DSM 14350 / EX-H1)
A8M609 2.13e-16 85 30 11 259 3 nuoN NADH-quinone oxidoreductase subunit N Salinispora arenicola (strain CNS-205)
Q6YXR9 2.33e-16 85 26 8 313 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Physcomitrium patens
A2BV95 2.81e-16 84 26 13 379 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain MIT 9515)
Q0TFH0 2.97e-16 84 24 8 357 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q6MGN8 3.44e-16 84 29 10 263 3 nuoN NADH-quinone oxidoreductase subunit N Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q5PN71 3.55e-16 84 25 13 362 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5N5W1 3.67e-16 84 25 6 284 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31NA0 3.67e-16 84 25 6 284 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B8IUV9 3.77e-16 84 27 16 317 3 nuoN NADH-quinone oxidoreductase subunit N Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q3BRP2 3.81e-16 84 23 17 411 3 nuoN NADH-quinone oxidoreductase subunit N Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q1QSU4 4.03e-16 84 28 17 400 3 nuoN NADH-quinone oxidoreductase subunit N Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q2RJT7 4.49e-16 84 26 16 396 3 nuoN NADH-quinone oxidoreductase subunit N Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q11VC5 4.71e-16 84 24 11 366 3 nuoN NADH-quinone oxidoreductase subunit N Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q3AC87 5.43e-16 84 28 7 258 3 nuoN NADH-quinone oxidoreductase subunit N Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A5GMZ5 5.48e-16 84 27 14 362 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain WH7803)
A9B6Y0 5.73e-16 84 29 8 307 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
B5FPF7 6.66e-16 83 25 13 362 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella dublin (strain CT_02021853)
A8G3E9 7.2e-16 83 27 11 343 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain MIT 9215)
Q1R9E1 7.22e-16 83 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain UTI89 / UPEC)
Q8FFK3 7.22e-16 83 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1ADC4 7.22e-16 83 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O1:K1 / APEC
B7MXV5 7.62e-16 83 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O81 (strain ED1a)
Q8ZNE4 7.75e-16 83 25 13 362 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9N592 7.75e-16 83 25 13 362 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5R2Z7 7.75e-16 83 25 13 362 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella enteritidis PT4 (strain P125109)
B5EZJ7 7.75e-16 83 25 13 362 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella agona (strain SL483)
A2BPR7 7.88e-16 83 27 11 343 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain AS9601)
Q8Z530 8.18e-16 83 25 13 362 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella typhi
B4TPJ8 8.18e-16 83 25 13 362 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella schwarzengrund (strain CVM19633)
B4SYY7 8.18e-16 83 25 13 362 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella newport (strain SL254)
B4TBI2 8.18e-16 83 25 13 362 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella heidelberg (strain SL476)
A3PBF7 8.39e-16 83 27 11 343 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain MIT 9301)
A8ADW3 8.41e-16 83 25 13 362 3 nuoN NADH-quinone oxidoreductase subunit N Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q83QT2 8.79e-16 83 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Shigella flexneri
Q57M40 8.79e-16 83 25 13 362 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella choleraesuis (strain SC-B67)
Q7VFT5 9.01e-16 83 25 17 428 3 nuoN NADH-quinone oxidoreductase subunit N Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q3YZT4 9.03e-16 83 24 13 412 3 nuoN NADH-quinone oxidoreductase subunit N Shigella sonnei (strain Ss046)
A7NL15 9.53e-16 83 29 8 265 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q31YI5 1.01e-15 82 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Shigella boydii serotype 4 (strain Sb227)
A4WCQ5 1.01e-15 82 26 12 347 3 nuoN NADH-quinone oxidoreductase subunit N Enterobacter sp. (strain 638)
Q31CA0 1.02e-15 83 27 11 343 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain MIT 9312)
Q5SCY2 1.04e-15 83 28 7 267 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Huperzia lucidula
P16429 1.1e-15 83 24 10 395 1 hycC Formate hydrogenlyase subunit 3 Escherichia coli (strain K12)
A4J650 1.13e-15 82 27 10 316 3 nuoN NADH-quinone oxidoreductase subunit N Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q3M9C7 1.14e-15 83 25 9 351 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q7U413 1.15e-15 83 26 22 499 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Parasynechococcus marenigrum (strain WH8102)
B1IXR6 1.23e-15 82 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B8FRJ7 1.4e-15 82 29 9 273 3 nuoN NADH-quinone oxidoreductase subunit N Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B1LLM9 1.43e-15 82 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain SMS-3-5 / SECEC)
B6I7M6 1.43e-15 82 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain SE11)
P0AFF0 1.43e-15 82 24 10 357 1 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain K12)
A8A2E5 1.43e-15 82 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O9:H4 (strain HS)
C4ZUB9 1.43e-15 82 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain K12 / MC4100 / BW2952)
B7M5V5 1.43e-15 82 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O8 (strain IAI1)
B5YXR6 1.43e-15 82 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AFF1 1.43e-15 82 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O157:H7
B7LAT8 1.43e-15 82 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli (strain 55989 / EAEC)
B7UFT4 1.43e-15 82 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZP90 1.43e-15 82 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O139:H28 (strain E24377A / ETEC)
B7NNV5 1.47e-15 82 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B9L178 1.52e-15 82 26 14 382 3 nuoN NADH-quinone oxidoreductase subunit N Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
A9MJA9 1.55e-15 82 25 13 362 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
C0Q051 1.65e-15 82 25 13 362 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella paratyphi C (strain RKS4594)
A0LJL8 1.67e-15 82 28 6 228 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q2NSL1 1.74e-15 82 26 9 305 3 nuoN NADH-quinone oxidoreductase subunit N Sodalis glossinidius (strain morsitans)
Q8YZV7 2.01e-15 82 25 9 351 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A6TBW2 2.02e-15 82 24 13 361 3 nuoN NADH-quinone oxidoreductase subunit N Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q0I8A7 2.15e-15 82 25 12 386 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain CC9311)
Q32DR3 2.15e-15 82 24 10 357 3 nuoN NADH-quinone oxidoreductase subunit N Shigella dysenteriae serotype 1 (strain Sd197)
Q3AWJ7 2.17e-15 82 26 11 357 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain CC9902)
B5RCE1 2.31e-15 82 25 13 362 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q7VDE7 2.36e-15 82 26 13 367 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A7ZBF3 2.38e-15 82 28 13 318 3 nuoN NADH-quinone oxidoreductase subunit N Campylobacter concisus (strain 13826)
P29925 2.39e-15 82 25 16 418 3 nqo13 NADH-quinone oxidoreductase chain 13 Paracoccus denitrificans
B5XNW6 2.42e-15 81 24 13 361 3 nuoN NADH-quinone oxidoreductase subunit N Klebsiella pneumoniae (strain 342)
A7H9U1 2.68e-15 81 27 12 326 3 nuoN NADH-quinone oxidoreductase subunit N Anaeromyxobacter sp. (strain Fw109-5)
Q111U1 3.04e-15 81 30 12 319 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Trichodesmium erythraeum (strain IMS101)
Q8DMR6 3.26e-15 81 28 11 317 1 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q2S2K9 3.72e-15 81 24 15 399 3 nuoN NADH-quinone oxidoreductase subunit N Salinibacter ruber (strain DSM 13855 / M31)
A4XV14 4.79e-15 80 29 11 321 3 nuoN NADH-quinone oxidoreductase subunit N Pseudomonas mendocina (strain ymp)
A5GP41 4.9e-15 81 27 13 323 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain WH7803)
A7MHT8 7.08e-15 80 25 12 364 3 nuoN NADH-quinone oxidoreductase subunit N Cronobacter sakazakii (strain ATCC BAA-894)
Q32RW1 7.9e-15 80 27 7 233 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Staurastrum punctulatum
Q8M9U1 8.18e-15 80 25 6 320 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chaetosphaeridium globosum
Q3T4F3 8.4e-15 80 24 11 326 3 ND2 NADH-ubiquinone oxidoreductase chain 2 Rhizopus oryzae
Q01UN3 9e-15 80 28 12 342 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Solibacter usitatus (strain Ellin6076)
P72714 9.22e-15 80 30 6 201 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9RUA0 9.47e-15 80 28 14 327 3 nuoN NADH-quinone oxidoreductase subunit N Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
B0TH87 9.69e-15 79 31 4 185 3 nuoN NADH-quinone oxidoreductase subunit N Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q19V78 9.91e-15 80 25 13 388 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Chlorokybus atmophyticus
Q2RU27 1.11e-14 79 28 11 277 3 nuoN NADH-quinone oxidoreductase subunit N Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q7U538 1.18e-14 79 25 13 367 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Parasynechococcus marenigrum (strain WH8102)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_03730
Feature type CDS
Gene nuoL
Product hydrogenase 4 subunit D
Location 148427 - 149869 (strand: -1)
Length 1443 (nucleotides) / 480 (amino acids)

Contig

Accession contig_3
Length 210665 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_795
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00361 Proton-conducting membrane transporter
PF00662 NADH-Ubiquinone oxidoreductase (complex I), chain 5 N-terminus

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1009 Energy production and conversion (C) C Membrane H+-translocase/NADH:ubiquinone oxidoreductase subunit 5 (chain L)/Multisubunit Na+/H+ antiporter, MnhA subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K12139 hydrogenase-4 component D [EC:1.-.-.-] - -

Protein Sequence

MLENIALATLLIPFAGALLVSVLPTRMAPWLSTLVALLASLGTAALGWLYLDGGKTATTLELVQAGNIALFGFTVDGVSTLIAFAVVFLGFLICLYSTGYLTEGNREHAHGPTRRYYAFLLIFIGAMAGVVLSSTILGQLLFFEITGGCSWALIGYYQTEKAQRSAMKALLITHVGSLGLFMAAATLFISTGTFALSAINQLNEAQSLIVFGGILFAAWGKSAQLPLQAWLPDAMEAPTPVSAYLHAASMVKVGVYIFARSIMSSDHVPEIIGWVGVVMAVITLVYGFMMYLPQKDMKRLLAWSTITQLAYIFLALSLSIFGSKEAFDGGIAYIFNHAFAKSLFFLVAGALSYSCGTRMLPRLRGLSKRYPLLGVGFCVAALAIAGVPPLNGFFSKFPIFAAGFALSEQFWIFAPIMVLVLIESVASFAWLLYWFGKVVPGEPSEDVANGTPVPAAMQWVIGLLIVMSFCSSVIAVIWLG

Flanking regions ( +/- flanking 50bp)

TGCGCTCGGATTCGTGTTCTATCTCACCGGTCTGTAAGGAGCGATAAAGCATGTTAGAAAATATTGCACTGGCGACCCTGCTGATTCCGTTTGCCGGGGCGTTGCTGGTCAGTGTCCTGCCGACGCGCATGGCCCCGTGGCTGAGTACCTTAGTCGCGCTGCTGGCCTCTCTCGGTACGGCGGCACTGGGCTGGCTGTATCTCGACGGCGGTAAGACCGCCACCACACTGGAACTGGTTCAGGCCGGTAATATCGCGCTGTTCGGCTTTACCGTTGACGGCGTGAGCACTCTGATTGCGTTTGCGGTGGTGTTCCTCGGCTTCCTGATTTGTCTGTACTCCACCGGCTACCTGACTGAAGGTAACCGCGAGCACGCTCACGGGCCGACCCGCCGCTATTATGCCTTCCTGCTGATTTTTATCGGCGCGATGGCGGGCGTGGTGCTGTCATCCACGATTCTGGGGCAGTTACTGTTCTTTGAAATCACCGGTGGCTGTTCATGGGCGCTGATTGGTTACTACCAGACAGAAAAAGCCCAGCGTTCCGCAATGAAAGCGCTGCTGATCACACACGTGGGTTCCCTCGGCCTGTTTATGGCGGCGGCAACCCTGTTTATCAGCACCGGTACGTTTGCCCTGAGCGCGATTAACCAGCTGAATGAGGCACAAAGCCTGATCGTCTTCGGCGGGATCCTGTTTGCGGCATGGGGTAAATCAGCCCAGCTGCCGTTACAGGCCTGGCTGCCGGACGCGATGGAAGCGCCGACACCGGTGAGTGCGTATCTGCACGCCGCGTCTATGGTGAAAGTGGGCGTTTATATCTTTGCCCGCAGCATCATGTCCTCTGACCATGTACCGGAAATTATCGGCTGGGTCGGCGTGGTGATGGCCGTTATCACGCTGGTGTATGGTTTTATGATGTATCTGCCGCAGAAAGATATGAAACGTCTGCTGGCCTGGTCAACCATCACCCAGCTGGCGTATATCTTCCTTGCGCTGTCTCTGTCCATCTTCGGATCCAAAGAAGCCTTTGACGGCGGTATCGCGTACATCTTTAACCACGCGTTTGCCAAGAGTCTGTTCTTCCTGGTGGCCGGTGCGCTCAGCTACAGTTGCGGGACCCGTATGCTGCCGCGTCTGCGTGGTCTGTCAAAACGCTATCCGCTGCTGGGTGTCGGTTTCTGTGTGGCTGCGCTGGCGATTGCCGGGGTGCCGCCGCTTAACGGCTTCTTCAGTAAATTCCCGATTTTCGCGGCCGGTTTCGCGTTATCTGAACAGTTCTGGATCTTCGCGCCAATCATGGTGCTGGTGCTGATTGAATCTGTTGCCAGCTTTGCCTGGCTGCTCTACTGGTTCGGCAAAGTTGTGCCGGGCGAGCCGAGCGAAGACGTGGCAAACGGAACTCCGGTTCCGGCAGCAATGCAGTGGGTTATCGGCCTGCTGATTGTGATGTCGTTCTGTTCAAGTGTTATCGCCGTCATCTGGCTCGGTTAAGGGAGAGAAAGTATGACTGGTTCCATTATTGTGAACAATCTGGCGGGGCT