Homologs in group_1048

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05925 FBDBKF_05925 52.0 Morganella morganii S1 tilS tRNA(Ile)-lysidine synthase TilS/MesJ
EHELCC_08970 EHELCC_08970 52.0 Morganella morganii S2 tilS tRNA(Ile)-lysidine synthase TilS/MesJ
NLDBIP_09350 NLDBIP_09350 52.0 Morganella morganii S4 tilS tRNA(Ile)-lysidine synthase TilS/MesJ
LHKJJB_08405 LHKJJB_08405 52.0 Morganella morganii S3 tilS tRNA(Ile)-lysidine synthase TilS/MesJ
HKOGLL_07955 HKOGLL_07955 52.0 Morganella morganii S5 tilS tRNA(Ile)-lysidine synthase TilS/MesJ
F4V73_RS15970 F4V73_RS15970 50.9 Morganella psychrotolerans tilS tRNA lysidine(34) synthetase TilS

Distribution of the homologs in the orthogroup group_1048

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1048

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F252 0.0 912 100 0 441 3 tilS tRNA(Ile)-lysidine synthase Proteus mirabilis (strain HI4320)
Q7N8N0 1.21e-172 494 55 4 435 3 tilS tRNA(Ile)-lysidine synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A7FFI7 3.8e-152 442 52 4 437 3 tilS tRNA(Ile)-lysidine synthase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q8ZH50 6.2e-152 442 51 4 440 3 tilS tRNA(Ile)-lysidine synthase Yersinia pestis
Q667K7 6.33e-152 442 51 4 440 3 tilS tRNA(Ile)-lysidine synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
C4K338 4.35e-145 424 49 6 446 3 tilS tRNA(Ile)-lysidine synthase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
A8GIC1 9.69e-145 422 54 4 431 3 tilS tRNA(Ile)-lysidine synthase Serratia proteamaculans (strain 568)
C5B7T0 3.25e-142 416 52 4 429 3 tilS tRNA(Ile)-lysidine synthase Edwardsiella ictaluri (strain 93-146)
Q8ZRN5 1.05e-141 415 51 5 420 3 tilS tRNA(Ile)-lysidine synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9N0U0 1.22e-141 414 51 5 420 3 tilS tRNA(Ile)-lysidine synthase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SV18 1.32e-141 414 51 5 420 3 tilS tRNA(Ile)-lysidine synthase Salmonella newport (strain SL254)
Q8Z996 1.91e-141 414 51 5 420 3 tilS tRNA(Ile)-lysidine synthase Salmonella typhi
B5F8V0 4.36e-141 413 51 5 420 3 tilS tRNA(Ile)-lysidine synthase Salmonella agona (strain SL483)
B4TK64 1.46e-140 412 51 5 420 3 tilS tRNA(Ile)-lysidine synthase Salmonella heidelberg (strain SL476)
B4TYE9 1.59e-140 412 51 5 420 3 tilS tRNA(Ile)-lysidine synthase Salmonella schwarzengrund (strain CVM19633)
Q57T19 1.68e-140 412 51 5 420 3 tilS tRNA(Ile)-lysidine synthase Salmonella choleraesuis (strain SC-B67)
B5FJ36 2.23e-140 411 51 5 420 3 tilS tRNA(Ile)-lysidine synthase Salmonella dublin (strain CT_02021853)
Q5PD76 4.48e-140 410 51 5 420 3 tilS tRNA(Ile)-lysidine synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8FL00 2.34e-138 406 52 5 431 3 tilS tRNA(Ile)-lysidine synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q7UDQ6 6.14e-138 405 51 5 431 3 tilS tRNA(Ile)-lysidine synthase Shigella flexneri
P52097 1.91e-136 401 51 5 431 1 tilS tRNA(Ile)-lysidine synthase Escherichia coli (strain K12)
Q8X8W8 1.09e-135 399 52 5 429 3 tilS tRNA(Ile)-lysidine synthase Escherichia coli O157:H7
Q6D8C5 3.62e-135 398 52 5 428 3 tilS tRNA(Ile)-lysidine synthase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A4W6T3 2.84e-134 395 50 6 430 3 tilS tRNA(Ile)-lysidine synthase Enterobacter sp. (strain 638)
Q8DBE4 2.91e-120 360 46 2 412 3 tilS tRNA(Ile)-lysidine synthase Vibrio vulnificus (strain CMCP6)
Q7MIH8 1.12e-119 358 46 2 412 3 tilS tRNA(Ile)-lysidine synthase Vibrio vulnificus (strain YJ016)
Q9CNY2 8.49e-111 336 43 5 423 3 tilS tRNA(Ile)-lysidine synthase Pasteurella multocida (strain Pm70)
Q87MF4 1.48e-110 335 46 2 404 3 tilS tRNA(Ile)-lysidine synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MXZ8 8.93e-108 328 46 2 420 3 tilS tRNA(Ile)-lysidine synthase Vibrio campbellii (strain ATCC BAA-1116)
B7VIQ1 8.72e-107 326 44 7 426 3 tilS tRNA(Ile)-lysidine synthase Vibrio atlanticus (strain LGP32)
Q0I3D1 2.08e-106 324 43 6 416 3 tilS tRNA(Ile)-lysidine synthase Histophilus somni (strain 129Pt)
Q493B5 4.68e-106 326 39 10 485 3 tilS tRNA(Ile)-lysidine synthase Blochmanniella pennsylvanica (strain BPEN)
B0UUD3 6.43e-103 315 42 7 417 3 tilS tRNA(Ile)-lysidine synthase Histophilus somni (strain 2336)
A6VNE4 1.49e-102 315 40 6 426 3 tilS tRNA(Ile)-lysidine synthase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q6LN41 1.73e-102 315 44 3 403 3 tilS tRNA(Ile)-lysidine synthase Photobacterium profundum (strain SS9)
P44689 5.26e-102 313 41 10 439 3 tilS tRNA(Ile)-lysidine synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UA84 9.03e-102 313 41 8 432 3 tilS tRNA(Ile)-lysidine synthase Haemophilus influenzae (strain PittEE)
Q7VRC9 1.15e-101 316 38 9 485 3 tilS tRNA(Ile)-lysidine synthase Blochmanniella floridana
Q65UE9 2.23e-101 311 41 6 413 3 tilS tRNA(Ile)-lysidine synthase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q4QND8 1.16e-100 310 41 8 429 3 tilS tRNA(Ile)-lysidine synthase Haemophilus influenzae (strain 86-028NP)
A5UGS0 6.44e-100 308 40 6 429 3 tilS tRNA(Ile)-lysidine synthase Haemophilus influenzae (strain PittGG)
C3LPP6 2.46e-99 306 44 3 402 3 tilS tRNA(Ile)-lysidine synthase Vibrio cholerae serotype O1 (strain M66-2)
A5F623 2.46e-99 306 44 3 402 3 tilS tRNA(Ile)-lysidine synthase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9KPX0 1.64e-98 305 44 3 402 3 tilS tRNA(Ile)-lysidine synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q83BJ9 5.08e-94 293 40 8 414 3 tilS tRNA(Ile)-lysidine synthase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q8KA23 1.43e-92 290 35 6 420 3 tilS tRNA(Ile)-lysidine synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8D2F5 1.5e-86 273 39 3 344 3 tilS tRNA(Ile)-lysidine synthase Wigglesworthia glossinidia brevipalpis
A3N2I9 4.96e-86 272 41 7 418 3 tilS tRNA(Ile)-lysidine synthase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q7VPN7 3.79e-85 270 38 8 423 3 tilS tRNA(Ile)-lysidine synthase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B0BRD5 8.29e-85 269 39 6 418 3 tilS tRNA(Ile)-lysidine synthase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GYM3 8.29e-85 269 39 6 418 3 tilS tRNA(Ile)-lysidine synthase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
P57211 2.06e-82 263 34 6 433 3 tilS tRNA(Ile)-lysidine synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B1KNS7 1.94e-80 259 39 10 434 3 tilS tRNA(Ile)-lysidine synthase Shewanella woodyi (strain ATCC 51908 / MS32)
Q607F5 5.5e-78 251 37 9 424 3 tilS tRNA(Ile)-lysidine synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q89AX3 2.1e-76 248 32 7 424 3 tilS tRNA(Ile)-lysidine synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q5WYB4 1.47e-75 245 35 6 404 3 tilS tRNA(Ile)-lysidine synthase Legionella pneumophila (strain Lens)
Q5X6W4 3.62e-74 241 35 6 404 3 tilS tRNA(Ile)-lysidine synthase Legionella pneumophila (strain Paris)
Q5ZXE5 4.53e-74 241 35 6 404 3 tilS tRNA(Ile)-lysidine synthase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q9HXZ3 1.21e-73 240 38 10 407 3 tilS tRNA(Ile)-lysidine synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8EGF9 2.28e-71 235 36 11 435 3 tilS tRNA(Ile)-lysidine synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q3KH95 1.25e-67 225 37 14 444 3 tilS tRNA(Ile)-lysidine synthase Pseudomonas fluorescens (strain Pf0-1)
Q886M6 8.82e-67 223 38 11 405 3 tilS tRNA(Ile)-lysidine synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8P7L3 4.97e-66 220 36 7 404 3 tilS tRNA(Ile)-lysidine synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UWI7 4.97e-66 220 36 7 404 3 tilS tRNA(Ile)-lysidine synthase Xanthomonas campestris pv. campestris (strain 8004)
Q82VP4 2.12e-64 217 33 11 422 3 tilS tRNA(Ile)-lysidine synthase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q88MG3 2.57e-62 211 36 12 409 3 tilS tRNA(Ile)-lysidine synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q87BE2 4.78e-61 207 37 6 404 3 tilS tRNA(Ile)-lysidine synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q8PIY5 6.42e-61 207 36 8 423 3 tilS tRNA(Ile)-lysidine synthase Xanthomonas axonopodis pv. citri (strain 306)
Q0A7K1 7.86e-60 204 36 6 409 3 tilS tRNA(Ile)-lysidine synthase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q9PFJ8 5.4e-59 202 38 6 391 3 tilS tRNA(Ile)-lysidine synthase Xylella fastidiosa (strain 9a5c)
Q5R0Q7 9.91e-57 196 33 8 398 3 tilS tRNA(Ile)-lysidine synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q7NT72 1.66e-55 193 35 8 404 3 tilS tRNA(Ile)-lysidine synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B0TYH9 1.47e-52 184 32 13 420 3 tilS tRNA(Ile)-lysidine synthase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A0Q7B6 1.81e-51 181 29 8 426 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. novicida (strain U112)
Q0BMM2 2.24e-51 181 30 8 426 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A488 2.24e-51 181 30 8 426 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. holarctica (strain LVS)
A7NB76 2.24e-51 181 30 8 426 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B2SG31 2.31e-51 181 29 9 426 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. mediasiatica (strain FSC147)
A4IXE6 4.19e-51 180 29 8 426 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NFK3 4.19e-51 180 29 8 426 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14H05 4.19e-51 180 29 8 426 3 tilS tRNA(Ile)-lysidine synthase Francisella tularensis subsp. tularensis (strain FSC 198)
Q6F880 1.8e-46 169 31 9 419 3 tilS tRNA(Ile)-lysidine synthase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q5P2I9 2.57e-44 163 33 14 435 3 tilS tRNA(Ile)-lysidine synthase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q8Y074 3.27e-44 163 34 12 430 3 tilS tRNA(Ile)-lysidine synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q63ST1 4.58e-44 164 37 10 307 3 tilS tRNA(Ile)-lysidine synthase Burkholderia pseudomallei (strain K96243)
Q62J40 6.68e-44 163 37 10 307 3 tilS tRNA(Ile)-lysidine synthase Burkholderia mallei (strain ATCC 23344)
Q31G65 8.08e-44 161 30 14 424 3 tilS tRNA(Ile)-lysidine synthase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q4W568 8.93e-44 161 32 10 395 3 tilS1 tRNA(Ile)-lysidine synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JUE9 8.93e-44 161 32 10 395 3 tilS tRNA(Ile)-lysidine synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A1K3X8 5.99e-43 160 31 14 435 3 tilS tRNA(Ile)-lysidine synthase Azoarcus sp. (strain BH72)
Q5F8F6 3.07e-42 157 34 5 295 3 tilS tRNA(Ile)-lysidine synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A2SIL9 1.92e-39 150 32 9 406 3 tilS tRNA(Ile)-lysidine synthase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B3CLY6 1.49e-33 134 42 6 206 3 tilS tRNA(Ile)-lysidine synthase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q5L3T3 5.62e-32 130 32 4 231 1 tilS tRNA(Ile)-lysidine synthase Geobacillus kaustophilus (strain HTA426)
C0R4S1 2.51e-31 127 42 5 193 3 tilS tRNA(Ile)-lysidine synthase Wolbachia sp. subsp. Drosophila simulans (strain wRi)
A1VRB1 3.53e-31 125 32 7 275 3 tilS tRNA(Ile)-lysidine synthase Polaromonas naphthalenivorans (strain CJ2)
Q73FR9 4.37e-30 124 41 6 195 3 tilS tRNA(Ile)-lysidine synthase Wolbachia pipientis wMel
P37563 3.78e-28 119 32 8 244 1 tilS tRNA(Ile)-lysidine synthase Bacillus subtilis (strain 168)
Q5GTD2 9.61e-28 117 40 4 185 3 tilS tRNA(Ile)-lysidine synthase Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q839B3 1.3e-27 117 31 4 231 3 tilS tRNA(Ile)-lysidine synthase Enterococcus faecalis (strain ATCC 700802 / V583)
Q5XEL7 9.67e-27 114 30 7 292 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q8P322 1.06e-26 114 30 7 292 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pyogenes serotype M18 (strain MGAS8232)
A5WCA0 1.08e-26 115 29 10 332 3 tilS tRNA(Ile)-lysidine synthase Psychrobacter sp. (strain PRwf-1)
B7IFR8 1.28e-26 114 32 7 230 3 tilS tRNA(Ile)-lysidine synthase Thermosipho africanus (strain TCF52B)
Q9A201 2.29e-26 113 30 7 292 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pyogenes serotype M1
P0DG01 2.32e-26 113 30 7 292 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DG00 2.32e-26 113 30 7 292 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q92F56 3.35e-26 115 34 4 226 3 tilS/hprT Bifunctional protein TilS/HprT Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q81J84 4.91e-26 113 32 5 241 3 tilS tRNA(Ile)-lysidine synthase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q73FE5 5.01e-26 113 32 5 241 3 tilS tRNA(Ile)-lysidine synthase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q63HD6 6.8e-26 112 31 5 244 3 tilS tRNA(Ile)-lysidine synthase Bacillus cereus (strain ZK / E33L)
Q5WAE0 7.45e-26 112 32 6 258 3 tilS tRNA(Ile)-lysidine synthase Shouchella clausii (strain KSM-K16)
Q81VX7 7.77e-26 112 32 6 241 3 tilS tRNA(Ile)-lysidine synthase Bacillus anthracis
Q6HPV4 8.08e-26 112 32 6 241 3 tilS tRNA(Ile)-lysidine synthase Bacillus thuringiensis subsp. konkukian (strain 97-27)
A8M8I3 2.49e-25 108 33 4 252 3 tilS tRNA(Ile)-lysidine synthase Salinispora arenicola (strain CNS-205)
Q724J4 2.59e-24 109 29 7 294 3 tilS/hprT Bifunctional protein TilS/HprT Listeria monocytogenes serotype 4b (strain F2365)
Q97EB0 3.43e-24 107 31 7 213 3 tilS tRNA(Ile)-lysidine synthase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q899H5 1.85e-23 105 32 8 228 3 tilS tRNA(Ile)-lysidine synthase Clostridium tetani (strain Massachusetts / E88)
B1L8R5 2.93e-23 104 30 5 210 3 tilS tRNA(Ile)-lysidine synthase Thermotoga sp. (strain RQ2)
Q74C65 3.42e-23 105 33 5 227 3 tilS tRNA(Ile)-lysidine synthase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q8YAC7 5.34e-23 105 32 5 235 3 tilS/hprT Bifunctional protein TilS/HprT Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A6LBU3 5.39e-23 103 29 8 306 3 tilS tRNA(Ile)-lysidine synthase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q8KC15 7.79e-23 102 28 7 260 3 tilS tRNA(Ile)-lysidine synthase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
C0QU23 1.33e-22 103 24 12 423 3 tilS tRNA(Ile)-lysidine synthase Persephonella marina (strain DSM 14350 / EX-H1)
B1YGQ4 4.37e-22 101 31 4 209 3 tilS tRNA(Ile)-lysidine synthase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q8XHL1 4.73e-22 101 24 17 465 3 tilS tRNA(Ile)-lysidine synthase Clostridium perfringens (strain 13 / Type A)
Q8CQV3 5.45e-22 101 28 5 264 3 tilS tRNA(Ile)-lysidine synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRP5 5.45e-22 101 28 5 264 3 tilS tRNA(Ile)-lysidine synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8EU18 5.8e-22 101 33 5 197 3 tilS tRNA(Ile)-lysidine synthase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q0TMI0 6.03e-22 101 24 17 465 3 tilS tRNA(Ile)-lysidine synthase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q7MTC4 8.12e-22 100 33 7 208 3 tilS tRNA(Ile)-lysidine synthase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B2RMB4 1.7e-21 99 34 8 209 3 tilS tRNA(Ile)-lysidine synthase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q9WZ48 2.21e-21 99 29 5 210 3 tilS tRNA(Ile)-lysidine synthase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q88Z33 2.39e-21 99 26 4 268 3 tilS tRNA(Ile)-lysidine synthase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q72IF6 3.65e-21 99 32 7 237 3 tilS tRNA(Ile)-lysidine synthase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q5SI38 3.97e-21 99 32 7 237 3 tilS tRNA(Ile)-lysidine synthase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
A8B000 5.41e-21 98 32 7 221 3 tilS tRNA(Ile)-lysidine synthase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q8R7K9 5.85e-21 98 30 11 270 3 tilS tRNA(Ile)-lysidine synthase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q5P9R1 9.26e-21 97 35 4 190 3 tilS tRNA(Ile)-lysidine synthase Anaplasma marginale (strain St. Maries)
Q9KGH8 1.68e-20 97 30 5 247 3 tilS tRNA(Ile)-lysidine synthase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9ZGE2 1.92e-20 97 31 6 229 3 tilS tRNA(Ile)-lysidine synthase Heliobacterium mobile
Q6AJ19 2.37e-20 96 27 8 395 3 tilS tRNA(Ile)-lysidine synthase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A8F7F8 3.04e-20 96 33 6 193 3 tilS tRNA(Ile)-lysidine synthase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q72C25 3.19e-20 94 35 4 199 3 tilS tRNA(Ile)-lysidine synthase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A9BJK2 3.47e-20 94 27 5 214 3 tilS tRNA(Ile)-lysidine synthase Petrotoga mobilis (strain DSM 10674 / SJ95)
Q8YYB8 3.59e-20 94 34 6 223 3 tilS tRNA(Ile)-lysidine synthase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O67728 5.67e-20 93 30 8 243 1 tilS tRNA(Ile)-lysidine synthase Aquifex aeolicus (strain VF5)
C0MC74 9.12e-20 94 31 8 235 3 tilS tRNA(Ile)-lysidine synthase Streptococcus equi subsp. zooepidemicus (strain H70)
B4U5H9 9.12e-20 94 31 8 235 3 tilS tRNA(Ile)-lysidine synthase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
Q65PF4 9.9e-20 94 27 6 244 3 tilS tRNA(Ile)-lysidine synthase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q01QT2 2.51e-19 93 31 7 218 3 tilS tRNA(Ile)-lysidine synthase Solibacter usitatus (strain Ellin6076)
Q8DWM9 4.6e-19 92 29 7 278 3 tilS tRNA(Ile)-lysidine synthase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
C0MAT4 5.2e-19 92 31 8 235 3 tilS tRNA(Ile)-lysidine synthase Streptococcus equi subsp. equi (strain 4047)
Q67JG9 5.9e-19 92 31 7 244 3 tilS tRNA(Ile)-lysidine synthase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q5M6K9 6.11e-19 92 27 7 276 3 tilS tRNA(Ile)-lysidine synthase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M217 6.11e-19 92 27 7 276 3 tilS tRNA(Ile)-lysidine synthase Streptococcus thermophilus (strain CNRZ 1066)
Q2JRN8 7.16e-19 90 33 7 229 3 tilS tRNA(Ile)-lysidine synthase Synechococcus sp. (strain JA-3-3Ab)
Q65ZY6 8.43e-19 91 26 6 238 3 tilS tRNA(Ile)-lysidine synthase Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
B3CUJ5 1.3e-18 91 31 5 198 3 tilS tRNA(Ile)-lysidine synthase Orientia tsutsugamushi (strain Ikeda)
Q9RV23 1.44e-18 91 30 7 256 3 tilS tRNA(Ile)-lysidine synthase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A5CFP2 2.02e-18 90 30 4 197 3 tilS tRNA(Ile)-lysidine synthase Orientia tsutsugamushi (strain Boryong)
Q3ZYX5 2.08e-18 90 31 8 237 3 tilS tRNA(Ile)-lysidine synthase Dehalococcoides mccartyi (strain CBDB1)
Q8DIH2 2.52e-18 89 28 4 230 3 tilS tRNA(Ile)-lysidine synthase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9CJH4 2.78e-18 90 27 9 270 3 tilS tRNA(Ile)-lysidine synthase Lactococcus lactis subsp. lactis (strain IL1403)
Q5NLX8 3.84e-18 88 33 7 184 3 tilS tRNA(Ile)-lysidine synthase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q2JJ74 8.78e-18 87 33 6 219 3 tilS tRNA(Ile)-lysidine synthase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q8A7D1 1.37e-17 87 28 5 219 3 tilS tRNA(Ile)-lysidine synthase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A4XCT1 1.66e-17 86 36 4 187 3 tilS tRNA(Ile)-lysidine synthase Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
Q0SM64 1.76e-17 87 25 6 238 3 tilS tRNA(Ile)-lysidine synthase Borreliella afzelii (strain PKo)
A3CJX7 1.77e-17 87 30 4 207 3 tilS tRNA(Ile)-lysidine synthase Streptococcus sanguinis (strain SK36)
Q64WF9 1.94e-17 87 29 5 221 3 tilS tRNA(Ile)-lysidine synthase Bacteroides fragilis (strain YCH46)
B7J0N4 2.31e-17 87 26 6 231 3 tilS tRNA(Ile)-lysidine synthase Borreliella burgdorferi (strain ZS7)
O51728 2.31e-17 87 26 6 231 3 tilS tRNA(Ile)-lysidine synthase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q181G3 7.64e-17 85 28 8 199 3 tilS tRNA(Ile)-lysidine synthase Clostridioides difficile (strain 630)
Q8RHN5 8.67e-17 85 28 9 205 3 tilS tRNA(Ile)-lysidine synthase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q6ACP8 1.03e-16 84 32 6 219 3 tilS tRNA(Ile)-lysidine synthase Leifsonia xyli subsp. xyli (strain CTCB07)
Q5HIG6 1.12e-16 85 22 15 429 3 tilS tRNA(Ile)-lysidine synthase Staphylococcus aureus (strain COL)
Q5LNU7 1.35e-16 85 31 5 194 3 tilS tRNA(Ile)-lysidine synthase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A8GQJ7 1.44e-16 85 30 5 212 3 tilS tRNA(Ile)-lysidine synthase Rickettsia rickettsii (strain Sheila Smith)
B0BVY4 1.44e-16 85 30 5 212 3 tilS tRNA(Ile)-lysidine synthase Rickettsia rickettsii (strain Iowa)
Q6GJG2 1.61e-16 84 28 7 200 3 tilS tRNA(Ile)-lysidine synthase Staphylococcus aureus (strain MRSA252)
Q8NXZ4 1.67e-16 84 21 14 426 3 tilS tRNA(Ile)-lysidine synthase Staphylococcus aureus (strain MW2)
Q6GBX9 1.67e-16 84 21 14 426 3 tilS tRNA(Ile)-lysidine synthase Staphylococcus aureus (strain MSSA476)
Q7A7A6 1.89e-16 84 28 7 200 3 tilS tRNA(Ile)-lysidine synthase Staphylococcus aureus (strain N315)
Q99W94 1.89e-16 84 28 7 200 3 tilS tRNA(Ile)-lysidine synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7W859 2.16e-16 83 29 5 289 3 tilS tRNA(Ile)-lysidine synthase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WLK7 2.16e-16 83 29 5 289 3 tilS tRNA(Ile)-lysidine synthase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q5N517 2.57e-16 83 29 4 233 3 tilS tRNA(Ile)-lysidine synthase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q6MLS8 3.16e-16 82 32 6 204 3 tilS tRNA(Ile)-lysidine synthase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
C4K162 3.79e-16 84 30 4 198 3 tilS tRNA(Ile)-lysidine synthase Rickettsia peacockii (strain Rustic)
Q92JK0 5.71e-16 83 30 4 202 3 tilS tRNA(Ile)-lysidine synthase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q4UN67 6.7e-16 82 30 4 192 3 tilS tRNA(Ile)-lysidine synthase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A8GLX9 7.4e-16 82 30 4 192 3 tilS tRNA(Ile)-lysidine synthase Rickettsia akari (strain Hartford)
Q7UZL1 7.87e-16 81 28 5 219 3 tilS tRNA(Ile)-lysidine synthase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
C3PM75 8.98e-16 82 30 4 202 3 tilS tRNA(Ile)-lysidine synthase Rickettsia africae (strain ESF-5)
Q9PL79 9.4e-16 81 27 7 258 3 tilS tRNA(Ile)-lysidine synthase Chlamydia muridarum (strain MoPn / Nigg)
A8F0E8 1.25e-15 82 30 3 182 3 tilS tRNA(Ile)-lysidine synthase Rickettsia massiliae (strain Mtu5)
Q6YR87 1.4e-15 82 28 5 219 3 tilS tRNA(Ile)-lysidine synthase Onion yellows phytoplasma (strain OY-M)
Q9Z6R2 1.41e-15 80 28 9 258 3 tilS tRNA(Ile)-lysidine synthase Chlamydia pneumoniae
Q7VX92 1.42e-15 80 30 5 274 3 tilS tRNA(Ile)-lysidine synthase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q2GC97 2.34e-15 80 31 4 183 3 tilS tRNA(Ile)-lysidine synthase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
C1D1Q9 2.39e-15 81 33 9 214 3 tilS tRNA(Ile)-lysidine synthase Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
Q7UNE1 2.65e-15 80 27 8 245 3 tilS tRNA(Ile)-lysidine synthase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q73N15 2.72e-15 81 27 6 213 3 tilS tRNA(Ile)-lysidine synthase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q9ZEA3 3.32e-15 80 32 6 194 3 tilS tRNA(Ile)-lysidine synthase Rickettsia prowazekii (strain Madrid E)
Q68XR8 5.04e-15 80 30 3 182 3 tilS tRNA(Ile)-lysidine synthase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q046D9 9.13e-15 79 31 8 226 3 tilS tRNA(Ile)-lysidine synthase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q8FMG0 1.09e-14 78 30 9 232 3 tilS tRNA(Ile)-lysidine synthase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q7V987 1.16e-14 78 27 7 289 3 tilS tRNA(Ile)-lysidine synthase Prochlorococcus marinus (strain MIT 9313)
Q1RGN9 1.71e-14 78 29 3 182 3 tilS tRNA(Ile)-lysidine synthase Rickettsia bellii (strain RML369-C)
A8GY99 1.71e-14 78 29 3 182 3 tilS tRNA(Ile)-lysidine synthase Rickettsia bellii (strain OSU 85-389)
Q6NAQ6 1.97e-14 77 31 3 189 3 tilS tRNA(Ile)-lysidine synthase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q2NIN4 2.15e-14 78 30 3 186 3 tilS tRNA(Ile)-lysidine synthase Aster yellows witches'-broom phytoplasma (strain AYWB)
C0ZNS6 2.58e-14 77 29 9 270 3 tilS tRNA(Ile)-lysidine synthase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q7V9L9 5.07e-14 76 25 8 289 3 tilS tRNA(Ile)-lysidine synthase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q0C5V2 8.21e-14 75 28 5 206 3 tilS tRNA(Ile)-lysidine synthase Hyphomonas neptunium (strain ATCC 15444)
Q9PMK7 1.15e-13 75 26 6 225 3 tilS tRNA(Ile)-lysidine synthase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9XBG6 2.12e-13 74 31 5 192 3 tilS tRNA(Ile)-lysidine synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5HSX8 2.34e-13 74 26 6 225 3 tilS tRNA(Ile)-lysidine synthase Campylobacter jejuni (strain RM1221)
B2S2X0 2.51e-13 75 28 6 218 3 tilS tRNA(Ile)-lysidine synthase Treponema pallidum subsp. pallidum (strain SS14)
O83388 2.51e-13 75 28 6 218 3 tilS tRNA(Ile)-lysidine synthase Treponema pallidum (strain Nichols)
Q6MDI6 3.08e-13 74 27 4 209 3 tilS tRNA(Ile)-lysidine synthase Protochlamydia amoebophila (strain UWE25)
Q74LA3 3.5e-13 74 31 7 228 3 tilS tRNA(Ile)-lysidine synthase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
B2IQZ8 4.86e-13 73 26 9 280 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain CGSP14)
B5E578 4.86e-13 73 26 9 280 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae serotype 19F (strain G54)
Q47KU2 6.1e-13 73 30 6 259 3 tilS tRNA(Ile)-lysidine synthase Thermobifida fusca (strain YX)
B1I6Y3 8.49e-13 73 23 9 306 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain Hungary19A-6)
C1CNP4 9.12e-13 73 23 9 306 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain Taiwan19F-14)
C1CN76 1.03e-12 73 23 9 306 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain P1031)
Q6NF90 1.08e-12 72 32 6 202 3 tilS tRNA(Ile)-lysidine synthase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q8U9L7 1.29e-12 72 28 4 209 3 tilS tRNA(Ile)-lysidine synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6B8L1 1.49e-12 71 29 5 195 3 tilS tRNA(Ile)-lysidine synthase, chloroplastic Gracilaria tenuistipitata var. liui
O84847 1.67e-12 71 24 6 255 3 tilS tRNA(Ile)-lysidine synthase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q9MUR3 1.67e-12 71 27 7 227 3 tilS tRNA(Ile)-lysidine synthase, chloroplastic Mesostigma viride
Q97TC5 1.89e-12 72 23 9 306 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
C1CH91 1.99e-12 72 26 9 280 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain JJA)
C1C992 2.01e-12 72 23 9 306 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain 70585)
Q7VGR5 2.43e-12 72 24 9 249 3 tilS tRNA(Ile)-lysidine synthase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
B8ZJI9 2.45e-12 72 23 9 306 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q46ID9 2.63e-12 71 26 8 228 3 tilS tRNA(Ile)-lysidine synthase Prochlorococcus marinus (strain NATL2A)
Q3KKJ9 2.69e-12 70 24 6 255 3 tilS tRNA(Ile)-lysidine synthase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
B0BAU8 2.81e-12 70 24 6 255 3 tilS tRNA(Ile)-lysidine synthase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B969 2.81e-12 70 24 6 255 3 tilS tRNA(Ile)-lysidine synthase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q7MR31 3.34e-12 70 27 7 214 3 tilS tRNA(Ile)-lysidine synthase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q8DRP9 3.94e-12 71 23 9 306 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04N53 3.94e-12 71 23 9 306 3 tilS tRNA(Ile)-lysidine synthase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A2C5B5 5.23e-12 70 26 8 223 3 tilS tRNA(Ile)-lysidine synthase Prochlorococcus marinus (strain NATL1A)
O69538 6.02e-12 70 32 9 257 3 tilS tRNA(Ile)-lysidine synthase Mycobacterium leprae (strain TN)
Q9ZLB5 6.94e-12 70 26 6 220 3 tilS tRNA(Ile)-lysidine synthase Helicobacter pylori (strain J99 / ATCC 700824)
P74192 1.76e-11 68 26 7 278 3 tilS tRNA(Ile)-lysidine synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8M9Y1 3.62e-11 67 31 9 225 3 tilS tRNA(Ile)-lysidine synthase, chloroplastic Chaetosphaeridium globosum
Q8G3S4 4.01e-11 68 26 7 237 3 tilS tRNA(Ile)-lysidine synthase Bifidobacterium longum (strain NCC 2705)
Q8E2H4 4.06e-11 68 28 8 224 3 tilS tRNA(Ile)-lysidine synthase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E7Y2 4.06e-11 68 28 8 224 3 tilS tRNA(Ile)-lysidine synthase Streptococcus agalactiae serotype III (strain NEM316)
B8IP16 5.33e-11 67 29 6 201 3 tilS tRNA(Ile)-lysidine synthase Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q7UA26 1.03e-10 66 28 5 279 3 tilS tRNA(Ile)-lysidine synthase Parasynechococcus marenigrum (strain WH8102)
B7GP48 1.7e-10 66 26 6 208 3 tilS tRNA(Ile)-lysidine synthase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
Q6MUI9 1.83e-10 65 26 5 191 3 tilS tRNA(Ile)-lysidine synthase Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q822B9 2.42e-10 65 26 3 189 3 tilS tRNA(Ile)-lysidine synthase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
B3DR08 2.79e-10 65 26 7 237 3 tilS tRNA(Ile)-lysidine synthase Bifidobacterium longum (strain DJO10A)
Q04XC4 7.47e-10 64 28 7 209 3 tilS tRNA(Ile)-lysidine synthase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04W48 7.47e-10 64 28 7 209 3 tilS tRNA(Ile)-lysidine synthase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q7NNL0 8.22e-10 63 32 5 201 3 tilS tRNA(Ile)-lysidine synthase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q98F87 1.02e-09 63 24 6 261 3 tilS tRNA(Ile)-lysidine synthase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1XDA4 2.07e-09 62 26 9 238 3 tilS tRNA(Ile)-lysidine synthase, chloroplastic Neopyropia yezoensis
Q72W10 2.49e-09 62 28 6 192 3 tilS tRNA(Ile)-lysidine synthase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q6F0E4 3.01e-09 62 24 7 193 3 tilS tRNA(Ile)-lysidine synthase Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
C1BA63 3.32e-09 61 30 6 199 3 tilS tRNA(Ile)-lysidine synthase Rhodococcus opacus (strain B4)
C1A873 4.02e-09 62 27 7 236 3 tilS tRNA(Ile)-lysidine synthase Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
Q10441 4.59e-09 62 26 12 278 3 SPAC12B10.08c Probable tRNA(Ile)-lysidine synthase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q92JY3 5.07e-09 61 25 5 196 3 tilS tRNA(Ile)-lysidine synthase Rhizobium meliloti (strain 1021)
Q8F9P6 6.04e-09 61 27 6 192 3 tilS tRNA(Ile)-lysidine synthase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q6M2E8 7.75e-09 60 30 5 188 3 tilS tRNA(Ile)-lysidine synthase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q5L5B2 8.96e-09 60 25 4 189 3 tilS tRNA(Ile)-lysidine synthase Chlamydia abortus (strain DSM 27085 / S26/3)
O25428 9.55e-09 60 25 6 209 3 tilS tRNA(Ile)-lysidine synthase Helicobacter pylori (strain ATCC 700392 / 26695)
Q83I94 1.03e-08 60 35 5 137 3 tilS tRNA(Ile)-lysidine synthase Tropheryma whipplei (strain TW08/27)
Q83I94 0.000189 47 30 1 98 3 tilS tRNA(Ile)-lysidine synthase Tropheryma whipplei (strain TW08/27)
A5ERG8 1.16e-08 60 29 2 187 3 tilS tRNA(Ile)-lysidine synthase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q83MT2 1.24e-08 60 35 5 137 3 tilS tRNA(Ile)-lysidine synthase Tropheryma whipplei (strain Twist)
Q83MT2 0.000197 47 30 1 98 3 tilS tRNA(Ile)-lysidine synthase Tropheryma whipplei (strain Twist)
Q255L6 1.85e-08 59 26 4 189 3 tilS tRNA(Ile)-lysidine synthase Chlamydia felis (strain Fe/C-56)
C5BYK3 3.68e-08 58 29 6 215 3 tilS tRNA(Ile)-lysidine synthase Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
Q82EF1 4.1e-08 58 30 4 214 3 tilS tRNA(Ile)-lysidine synthase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9X8I6 1.13e-07 57 29 4 214 3 tilS tRNA(Ile)-lysidine synthase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q1ACK8 1.76e-07 56 29 6 168 3 tilS tRNA(Ile)-lysidine synthase, chloroplastic Chara vulgaris
Q32RJ9 3.53e-07 55 24 5 253 3 tilS tRNA(Ile)-lysidine synthase, chloroplastic Zygnema circumcarinatum
Q6AB49 5.29e-07 54 24 4 221 3 tilS tRNA(Ile)-lysidine synthase Cutibacterium acnes (strain DSM 16379 / KPA171202)
B8DWC0 6.51e-07 55 27 6 191 3 tilS tRNA(Ile)-lysidine synthase Bifidobacterium animalis subsp. lactis (strain AD011)
B0U453 1.02e-06 53 28 8 195 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xylella fastidiosa (strain M12)
Q9PFT8 1.07e-06 53 27 6 195 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xylella fastidiosa (strain 9a5c)
Q0S8E7 1.42e-06 53 31 4 160 3 tilS tRNA(Ile)-lysidine synthase Rhodococcus jostii (strain RHA1)
Q87B85 1.9e-06 53 28 8 193 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I7H1 1.9e-06 53 28 8 193 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Xylella fastidiosa (strain M23)
Q744A3 2.67e-06 52 29 13 295 3 tilS tRNA(Ile)-lysidine synthase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q5FQB6 6.59e-06 52 31 1 113 3 tilS tRNA(Ile)-lysidine synthase Gluconobacter oxydans (strain 621H)
P51383 6.84e-06 51 27 9 222 3 tilS tRNA(Ile)-lysidine synthase, chloroplastic Porphyra purpurea
A6WY85 8.01e-06 51 26 5 225 3 tilS tRNA(Ile)-lysidine synthase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q5Z2W1 1.12e-05 50 40 1 81 3 tilS tRNA(Ile)-lysidine synthase Nocardia farcinica (strain IFM 10152)
Q7NAI9 1.96e-05 49 23 10 298 3 tilS tRNA(Ile)-lysidine synthase Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
P9WG53 3.13e-05 49 32 4 153 1 tilS tRNA(Ile)-lysidine synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG52 3.13e-05 49 32 4 153 3 tilS tRNA(Ile)-lysidine synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67152 3.13e-05 49 32 4 153 3 tilS tRNA(Ile)-lysidine synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A9WWG9 4.3e-05 49 27 6 195 3 tilS tRNA(Ile)-lysidine synthase Brucella suis (strain ATCC 23445 / NCTC 10510)
A9M7J1 4.3e-05 49 27 6 195 3 tilS tRNA(Ile)-lysidine synthase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q8FZ11 4.34e-05 49 27 6 195 3 tilS tRNA(Ile)-lysidine synthase Brucella suis biovar 1 (strain 1330)
Q8YIV0 4.34e-05 49 27 6 195 3 tilS tRNA(Ile)-lysidine synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0REV5 4.34e-05 49 27 6 195 3 tilS tRNA(Ile)-lysidine synthase Brucella melitensis biotype 2 (strain ATCC 23457)
A5VS49 4.66e-05 49 27 6 195 3 tilS tRNA(Ile)-lysidine synthase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q57BI8 4.66e-05 49 27 6 195 3 tilS tRNA(Ile)-lysidine synthase Brucella abortus biovar 1 (strain 9-941)
Q2YQH6 4.66e-05 49 27 6 195 3 tilS tRNA(Ile)-lysidine synthase Brucella abortus (strain 2308)
B2S7D1 4.66e-05 49 27 6 195 3 tilS tRNA(Ile)-lysidine synthase Brucella abortus (strain S19)
Q8EWQ7 4.98e-05 48 23 9 252 3 tilS tRNA(Ile)-lysidine synthase Malacoplasma penetrans (strain HF-2)
B0UGN1 0.000275 46 26 5 193 3 tilS tRNA(Ile)-lysidine synthase Methylobacterium sp. (strain 4-46)
Q94480 0.000354 46 25 4 162 2 ctu1 Cytoplasmic tRNA 2-thiolation protein 1 Dictyostelium discoideum
Q3A6S7 0.000404 45 25 7 207 3 ttcA tRNA-cytidine(32) 2-sulfurtransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS11195
Feature type CDS
Gene tilS
Product tRNA lysidine(34) synthetase TilS
Location 2462294 - 2463619 (strand: -1)
Length 1326 (nucleotides) / 441 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1048
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01171 PP-loop family
PF09179 TilS substrate binding domain
PF11734 TilS substrate C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0037 Translation, ribosomal structure and biogenesis (J) J tRNA(Ile)-lysidine synthase TilS/MesJ

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04075 tRNA(Ile)-lysidine synthase [EC:6.3.4.19] - -

Protein Sequence

MELKNCPLINEIKRQIGSHTHILVGFSGGVDSTVLLHGLVCLRDKYQLPLELTAIYVHHGLNSKADDWLTHCEHFCHNWQVSFISERVQVNGKEGGIEQGAREARYQAYRQYLQPNQVLVTAQHQDDQAETFLLALKRGSGPAGLSSMPAKMPFEQGYLLRPLLNITREQIEAYAHEHGLLWIEDDSNQDDRYDRNFLRLHVMPLLTQRWPHFSQAVTRSAALCGEQEALLDELLDVELQQLIDEHQSLDINLLSRCSEIKRNALLRRWFAKCNKSMPSRSQLSRLWQEVALAKADAEPRLRFFQDEVRRYQQRLYLVPVMEELTDRVIEWSLSQPLILPNQLGILAVSRDSGKTICRAPLADEKVTVRFGLTASSLRIVGRDLARSSKKIWQELNIAPWQRTRIPLIYYNDTLIAAVNTFVTLEGNATTEQSITIEWQAS

Flanking regions ( +/- flanking 50bp)

ATGGAAAGGCTTAACATAACCCATTGAATTCCTCGATAACTGATAATGCTATGGAACTGAAAAATTGTCCTCTTATTAACGAAATTAAACGACAAATTGGCTCTCATACTCATATTTTAGTGGGTTTTAGTGGTGGAGTTGATTCAACCGTTTTATTGCATGGGTTGGTTTGCTTACGTGATAAATATCAACTTCCTTTAGAATTAACGGCAATTTATGTTCATCATGGATTGAATTCAAAAGCCGATGATTGGCTCACGCATTGCGAACATTTTTGTCATAACTGGCAGGTCAGTTTTATCAGTGAAAGAGTACAAGTCAATGGGAAAGAAGGGGGGATTGAGCAGGGTGCCAGAGAAGCGCGCTATCAAGCTTATCGCCAATATTTACAGCCTAATCAAGTTTTAGTGACGGCACAACATCAAGATGATCAAGCGGAAACTTTCCTATTAGCGCTTAAACGCGGTAGTGGACCGGCAGGGTTGTCTTCAATGCCTGCAAAAATGCCTTTTGAACAAGGGTATTTATTACGACCATTACTTAATATTACACGTGAACAAATCGAAGCTTATGCACATGAGCACGGTTTATTATGGATTGAGGATGATAGTAATCAAGATGATCGCTATGATCGCAATTTCTTACGTTTACATGTTATGCCTCTATTGACTCAGCGCTGGCCACATTTTTCTCAAGCAGTTACTCGTAGTGCCGCACTGTGTGGTGAACAAGAAGCGCTCTTAGATGAGTTACTCGATGTAGAATTGCAGCAATTGATTGATGAGCATCAGAGTTTAGATATCAATTTATTGTCCCGCTGTAGCGAAATAAAACGTAATGCATTGTTGCGTCGTTGGTTTGCTAAATGTAATAAAAGCATGCCATCAAGATCTCAATTGTCGCGGCTATGGCAAGAAGTTGCTTTAGCTAAAGCAGATGCAGAGCCACGGTTACGTTTTTTCCAAGATGAAGTTAGGCGTTATCAACAACGCCTCTATCTTGTGCCAGTTATGGAAGAACTAACGGATAGGGTTATCGAATGGTCATTATCACAACCTTTAATTTTGCCTAATCAGTTAGGGATATTAGCGGTGAGTCGTGATAGCGGTAAAACAATCTGCAGAGCACCGTTAGCAGATGAAAAAGTGACGGTTCGTTTTGGCTTAACGGCTTCATCTTTACGTATTGTTGGGCGAGATTTGGCCAGATCAAGCAAGAAAATTTGGCAAGAGCTTAATATTGCCCCATGGCAAAGAACTCGTATCCCATTGATTTATTATAACGATACATTAATTGCAGCGGTTAATACTTTTGTGACTTTAGAGGGAAATGCAACAACAGAACAAAGTATAACAATTGAGTGGCAAGCGTCGTAAACAACCGCCAATTACGGCGGTTGTTTATGTAAATAGTTATTCAGATTTGA