Homologs in group_792

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03150 FBDBKF_03150 79.7 Morganella morganii S1 cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
EHELCC_07385 EHELCC_07385 79.7 Morganella morganii S2 cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
NLDBIP_07710 NLDBIP_07710 79.7 Morganella morganii S4 cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
LHKJJB_07245 LHKJJB_07245 79.7 Morganella morganii S3 cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
HKOGLL_03685 HKOGLL_03685 79.7 Morganella morganii S5 cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
F4V73_RS11770 F4V73_RS11770 79.5 Morganella psychrotolerans cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit

Distribution of the homologs in the orthogroup group_792

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_792

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F234 0.0 1202 100 0 576 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Proteus mirabilis (strain HI4320)
Q7N8L5 0.0 985 79 0 576 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B1JK04 0.0 960 77 0 576 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FLY9 0.0 960 77 0 576 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66ED3 0.0 960 77 0 576 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K566 0.0 960 77 0 576 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A4TPY6 0.0 957 76 0 576 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pestis (strain Pestoides F)
Q1CLS7 0.0 957 76 0 576 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZBN7 0.0 957 76 0 576 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pestis
Q1C3Z1 0.0 957 76 0 576 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pestis bv. Antiqua (strain Antiqua)
A1JJS3 0.0 952 76 0 576 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B7UHH5 0.0 949 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q8FEI8 0.0 948 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8A3P4 0.0 948 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O9:H4 (strain HS)
Q1R7T5 0.0 947 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain UTI89 / UPEC)
Q0TEA3 0.0 947 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AEU9 0.0 947 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O1:K1 / APEC
B7MYR1 0.0 947 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O81 (strain ED1a)
B7MKN0 0.0 947 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O45:K1 (strain S88 / ExPEC)
P17846 0.0 947 76 1 571 1 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain K12)
C4ZZR7 0.0 947 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain K12 / MC4100 / BW2952)
B2TZH1 0.0 947 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LWN9 0.0 947 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B6I6F7 0.0 947 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain SE11)
B7N6Z7 0.0 947 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7LXH6 0.0 947 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O8 (strain IAI1)
B7NTA0 0.0 947 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z3C6 0.0 947 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X7U2 0.0 947 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O157:H7
B7LEI2 0.0 947 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain 55989 / EAEC)
A7ZQK6 0.0 947 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O139:H28 (strain E24377A / ETEC)
C6CLS0 0.0 946 76 0 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Dickeya chrysanthemi (strain Ech1591)
B1LQ86 0.0 946 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain SMS-3-5 / SECEC)
C6UCN7 0.0 946 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain B / REL606)
C5W865 0.0 946 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain B / BL21-DE3)
Q3YY95 0.0 945 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shigella sonnei (strain Ss046)
Q83QE0 0.0 945 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shigella flexneri
Q31XM5 0.0 944 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shigella boydii serotype 4 (strain Sb227)
B1IU78 0.0 944 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0T1I7 0.0 942 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shigella flexneri serotype 5b (strain 8401)
A8G9X7 0.0 942 75 0 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Serratia proteamaculans (strain 568)
A6TD48 0.0 942 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A7MJ64 0.0 942 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Cronobacter sakazakii (strain ATCC BAA-894)
Q32CG4 0.0 941 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shigella dysenteriae serotype 1 (strain Sd197)
C6DDH3 0.0 941 76 0 565 3 cysI2 Sulfite reductase [NADPH] hemoprotein beta-component 2 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8ANX0 0.0 940 75 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5XV25 0.0 939 76 1 571 3 cysI1 Sulfite reductase [NADPH] hemoprotein beta-component 1 Klebsiella pneumoniae (strain 342)
Q6D1A2 0.0 939 76 0 565 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A9N2E5 0.0 935 75 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
P17845 0.0 934 75 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5F430 0.0 934 75 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella agona (strain SL483)
B5FTU2 0.0 933 75 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella dublin (strain CT_02021853)
A4WDW0 0.0 933 75 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Enterobacter sp. (strain 638)
B4TTX8 0.0 932 75 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella schwarzengrund (strain CVM19633)
C6CAW9 0.0 932 75 0 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Musicola paradisiaca (strain Ech703)
C0PXC5 0.0 931 75 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella paratyphi C (strain RKS4594)
B4T474 0.0 931 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella newport (strain SL254)
B5QW35 0.0 931 75 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella enteritidis PT4 (strain P125109)
A9MF17 0.0 931 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4TFY4 0.0 930 75 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella heidelberg (strain SL476)
B5RDS0 0.0 930 75 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q57KH8 0.0 930 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella choleraesuis (strain SC-B67)
Q8Z459 0.0 930 75 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella typhi
B5BEZ8 0.0 929 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella paratyphi A (strain AKU_12601)
Q5PEH8 0.0 929 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B2VG06 0.0 920 75 1 565 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C4L9J8 0.0 858 70 1 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q6LM59 0.0 854 70 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Photobacterium profundum (strain SS9)
B4RYS6 0.0 853 68 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q5NRM2 0.0 852 68 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q2NVN3 0.0 849 69 0 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Sodalis glossinidius (strain morsitans)
Q7MHA6 0.0 848 69 2 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio vulnificus (strain YJ016)
Q8DCK1 0.0 846 69 2 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio vulnificus (strain CMCP6)
Q15NK1 0.0 845 68 0 566 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B6ELM5 0.0 842 68 1 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Aliivibrio salmonicida (strain LFI1238)
Q87L91 0.0 842 68 2 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A5F3I5 0.0 838 68 2 575 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B7VI85 0.0 838 68 1 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio atlanticus (strain LGP32)
A7MSZ7 0.0 838 69 2 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio campbellii (strain ATCC BAA-1116)
Q5E840 0.0 838 69 1 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FGI9 0.0 837 69 1 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Aliivibrio fischeri (strain MJ11)
C3LRB7 0.0 836 68 2 575 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio cholerae serotype O1 (strain M66-2)
Q9KUX3 0.0 836 68 2 575 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0KNL0 0.0 829 67 1 568 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B5Y1B5 0.0 819 67 0 557 3 cysI2 Sulfite reductase [NADPH] hemoprotein beta-component 2 Klebsiella pneumoniae (strain 342)
C6DCZ7 0.0 808 65 0 557 3 cysI1 Sulfite reductase [NADPH] hemoprotein beta-component 1 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q1LTP2 0.0 805 65 0 556 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Baumannia cicadellinicola subsp. Homalodisca coagulata
A1S9I4 0.0 801 65 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A6VPZ1 0.0 799 64 3 565 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A9LZ72 0.0 796 62 2 582 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Neisseria meningitidis serogroup C (strain 053442)
Q3IFM1 0.0 795 65 1 557 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Pseudoalteromonas translucida (strain TAC 125)
Q47UW8 0.0 795 64 2 570 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B0BT17 0.0 793 63 3 572 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GZ95 0.0 793 63 3 572 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q9JUD9 0.0 793 62 2 582 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8VSR0 0.0 792 62 3 572 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Actinobacillus pleuropneumoniae
Q65T54 0.0 790 64 3 565 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A1KU05 0.0 789 62 2 582 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JS33 0.0 789 62 2 582 3 cysI1 Sulfite reductase [NADPH] hemoprotein beta-component Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A3N3D8 0.0 788 63 3 572 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B8D7V7 0.0 785 62 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57502 0.0 782 62 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9K5 0.0 782 62 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
P0C0B2 0.0 762 61 2 557 5 cysI Putative sulfite reductase [NADPH] hemoprotein beta-component Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q493N3 0.0 756 61 3 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Blochmanniella pennsylvanica (strain BPEN)
Q7VQH1 0.0 736 59 2 558 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Blochmanniella floridana
A1T054 0.0 718 60 1 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q0HFL7 0.0 671 56 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella sp. (strain MR-4)
Q0HYB3 0.0 671 56 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella sp. (strain MR-7)
A0KTH5 0.0 671 56 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella sp. (strain ANA-3)
Q8EB00 0.0 668 56 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A1RGD7 0.0 665 54 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella sp. (strain W3-18-1)
A4Y9Z3 0.0 664 54 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A9L2P8 0.0 661 54 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella baltica (strain OS195)
A6WJT5 0.0 661 54 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella baltica (strain OS185)
A3D829 0.0 661 54 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EE51 0.0 660 54 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella baltica (strain OS223)
A3QAP0 0.0 656 54 1 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q12QQ5 0.0 655 54 0 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B0TTE4 0.0 651 53 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella halifaxensis (strain HAW-EB4)
A8FZY7 0.0 650 54 2 564 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella sediminis (strain HAW-EB3)
Q07Y86 0.0 649 53 1 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella frigidimarina (strain NCIMB 400)
B1KE86 0.0 648 53 1 563 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella woodyi (strain ATCC 51908 / MS32)
B8CJV9 0.0 647 53 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella piezotolerans (strain WP3 / JCM 13877)
A8H094 0.0 640 53 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q9KF75 0.0 609 51 3 558 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B7GJU8 0.0 609 50 3 557 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q5L041 0.0 607 50 4 570 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Geobacillus kaustophilus (strain HTA426)
A4IMT6 0.0 605 50 3 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Geobacillus thermodenitrificans (strain NG80-2)
Q1D9W9 0.0 603 51 3 552 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Myxococcus xanthus (strain DK1622)
A7Z8R5 0.0 603 50 5 566 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
O32213 0.0 602 50 3 557 1 cysI Sulfite reductase [NADPH] hemoprotein beta-component Bacillus subtilis (strain 168)
Q65L57 0.0 600 50 4 558 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P52673 0.0 599 52 4 558 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Thiocapsa roseopersicina
A8FDY3 0.0 591 48 4 568 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Bacillus pumilus (strain SAFR-032)
C0Z9X2 0.0 590 49 4 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
B1HXC1 0.0 587 50 3 556 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Lysinibacillus sphaericus (strain C3-41)
Q5WKE7 0.0 581 50 5 576 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shouchella clausii (strain KSM-K16)
C6CXN6 0.0 562 47 4 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Paenibacillus sp. (strain JDR-2)
Q3JBJ1 0.0 560 47 4 566 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q8EQP0 0.0 556 48 5 565 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B5EQW2 0.0 556 48 5 552 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7JAM6 0.0 556 48 5 552 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
B9DLM4 0.0 555 46 4 554 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Staphylococcus carnosus (strain TM300)
B8IRY2 0.0 550 47 6 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q4L9F1 0.0 550 46 4 572 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Staphylococcus haemolyticus (strain JCSC1435)
B1LS97 0.0 546 45 6 564 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q1QU16 0.0 545 49 5 557 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B7L0Y4 0.0 543 46 7 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylorubrum extorquens (strain CM4 / NCIMB 13688)
C5APZ1 0.0 542 46 7 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylorubrum extorquens (strain ATCC 14718 / DSM 1338 / JCM 2805 / NCIMB 9133 / AM1)
A9W4X6 0.0 541 46 7 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylorubrum extorquens (strain PA1)
B1Z7C5 0.0 541 46 7 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q8CMX5 0.0 540 47 4 555 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HKZ7 0.0 540 47 4 555 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q3BPY4 0.0 537 48 4 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B0U8Y9 0.0 536 46 6 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylobacterium sp. (strain 4-46)
Q8KQT8 0.0 535 48 4 547 1 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SI05 0.0 535 48 4 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P0H2 0.0 535 48 4 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q49UL9 0.0 533 47 5 553 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8P608 0.0 532 48 4 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9PD81 0.0 531 48 3 548 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xylella fastidiosa (strain 9a5c)
B0RPG6 0.0 531 48 4 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas campestris pv. campestris (strain B100)
Q4UY08 0.0 531 48 4 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas campestris pv. campestris (strain 8004)
B0U6W0 0.0 530 48 3 548 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xylella fastidiosa (strain M12)
Q8PHC8 0.0 529 48 4 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas axonopodis pv. citri (strain 306)
B0SNL6 0.0 529 46 3 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SF75 0.0 529 46 3 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q87DH0 0.0 528 48 3 548 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2IA31 0.0 528 48 3 548 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xylella fastidiosa (strain M23)
B8EKI5 0.0 525 46 5 554 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q3SV33 3.44e-170 498 46 3 551 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B6JCW3 4.09e-169 495 45 4 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q1QQC7 1.91e-168 493 45 4 553 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A9IT77 1.92e-163 481 45 6 563 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q82W45 4.28e-163 479 45 6 553 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
P47169 1.3e-159 495 42 5 586 1 MET5 Sulfite reductase [NADPH] subunit beta Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q0AGU3 1.61e-159 471 44 6 553 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q1K9C2 3.53e-152 476 43 7 571 3 sir1 Sulfite reductase [NADPH] subunit beta Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P72854 8.37e-116 360 35 7 573 1 sir Sulfite reductase [ferredoxin] Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P30008 3.61e-115 358 35 10 578 3 sir Sulfite reductase [ferredoxin] Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O23813 9.56e-112 350 35 9 579 1 SIR Sulfite reductase [ferredoxin], chloroplastic Zea mays
O82802 4.67e-111 350 34 8 576 1 SIR1 Sulfite reductase 1 [ferredoxin], chloroplastic Nicotiana tabacum
Q9LZ66 3.89e-110 346 34 9 581 1 SIR Assimilatory sulfite reductase (ferredoxin), chloroplastic Arabidopsis thaliana
Q75NZ0 3.5e-107 339 34 9 577 1 SIR Sulfite reductase [ferredoxin], chloroplastic Pisum sativum
Q9AWB2 3.61e-99 315 35 8 518 1 SIR Sulfite reductase [ferredoxin], chloroplastic (Fragment) Glycine max
P9WJ03 2.49e-31 131 26 17 502 1 sir Sulfite reductase [ferredoxin] Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJ02 2.49e-31 131 26 17 502 3 sir Sulfite reductase [ferredoxin] Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TYP6 2.49e-31 131 26 17 502 3 sir Sulfite reductase [ferredoxin] Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q73XV0 4.22e-29 125 25 19 528 3 sir2 Sulfite reductase [ferredoxin] 2 Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q73YC1 2.75e-26 116 24 20 529 3 sir1 Sulfite reductase [ferredoxin] 1 Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q39161 7.33e-26 115 26 23 521 1 NIR1 Ferredoxin--nitrite reductase, chloroplastic Arabidopsis thaliana
P05314 2.43e-25 114 23 25 572 1 NIR Ferredoxin--nitrite reductase, chloroplastic Spinacia oleracea
P38500 5.66e-24 109 25 21 499 2 NIR1 Ferredoxin--nitrite reductase, chloroplastic Betula pendula
P17847 8.97e-24 108 24 24 526 2 NIR Ferredoxin--nitrite reductase, chloroplastic (Fragment) Zea mays
P39661 2.65e-23 107 24 19 502 3 nirA Ferredoxin--nitrite reductase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q42997 7.17e-23 106 24 21 487 2 Os01g0357100 Ferredoxin--nitrite reductase, chloroplastic Oryza sativa subsp. japonica
Q51879 3.65e-20 97 24 19 498 3 nirA Ferredoxin--nitrite reductase Phormidium laminosum
I3R637 1.39e-19 96 24 22 518 1 nasD Assimilatory ferredoxin-dependent nitrite reductase Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
Q58280 0.000882 45 22 4 190 1 fsr Coenzyme F420-dependent sulfite reductase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS11080
Feature type CDS
Gene cysI
Product assimilatory sulfite reductase (NADPH) hemoprotein subunit
Location 2437986 - 2439716 (strand: -1)
Length 1731 (nucleotides) / 576 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_792
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01077 Nitrite and sulphite reductase 4Fe-4S domain
PF03460 Nitrite/Sulfite reductase ferredoxin-like half domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0155 Inorganic ion transport and metabolism (P) P Sulfite reductase, beta subunit (hemoprotein)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00381 sulfite reductase (NADPH) hemoprotein beta-component [EC:1.8.1.2] Sulfur metabolism
Metabolic pathways
Microbial metabolism in diverse environments
Sulfur cycle
Assimilatory sulfate reduction, sulfate => H2S

Protein Sequence

MKSQTQAPLVVEGKLSDSERMKKESNFLRGTISDDLQNGLTGGFEGDNFLLIRFHGMYQQDDRDIRAERAQQLLEPRHAMMLRCRLPGGVITPKQWLSIDKFASENTLYGSIRITNRQTFQFHGILKGHVKPAHQMLASTGLDALATANDVNRNVLCTSNPEQSSLHQEAYEWAKKLSEHLLPRTHAYAEIWLDKEKVATTDEEPILGETYLPRKFKTSVVIPPYNDVDLHANDMNFIAIAENGHLVGFNVLVGGGLAMTHGDKKTFPRLASEFGYIPIDKTLAVAEAIVTTQRDWGNRTERKNAKTKYTLERVGIETFKQEVERRSGVMFDMIRPYQFTHRGDQIGWLKGVDNKWYLTLFIESGRLIDKPNAPLKTGVAEIAKVHLGDFRLTANQNLIVAGVPEAQKEQIEAIARQYGLINDEVTPLRKHAMACVSFPTCPLAMAEAERFLPAFTDTLDNIMAKYGVSDEHIVVRVTGCPNGCGRAMLAEVGLVGKAPDRYNLHLGGNRMGTRIPRMYRENISSQEIIEILDTLIGQWAISRELNEGFGDFLIRTDVIKPVVNSAIDFYEVQEVI

Flanking regions ( +/- flanking 50bp)

TTTAAGTGAGCTACGTTTAGCACGTCGTTATCAGAGGGATGTTTATTAAAATGAAATCACAAACTCAAGCGCCCTTAGTGGTTGAAGGAAAACTATCTGATAGTGAACGTATGAAAAAAGAGAGTAATTTCTTACGAGGCACTATTAGTGATGATCTACAAAATGGTCTAACCGGTGGTTTTGAGGGCGATAATTTTTTATTAATTCGTTTTCACGGTATGTACCAACAAGATGATAGAGATATTCGTGCCGAGCGTGCCCAACAGCTACTAGAGCCTCGTCATGCCATGATGTTACGTTGTCGTTTACCGGGCGGTGTCATCACACCAAAGCAGTGGCTAAGTATCGATAAGTTTGCTAGTGAAAATACGCTCTATGGCAGTATTCGTATTACTAATCGTCAAACTTTTCAATTTCATGGCATTTTAAAAGGTCATGTTAAACCGGCTCACCAAATGCTAGCGTCAACAGGCCTTGATGCTCTTGCAACCGCCAATGATGTTAATCGAAATGTGCTATGTACCTCAAACCCTGAACAATCTTCATTGCATCAAGAAGCTTATGAATGGGCCAAAAAACTATCCGAGCATTTATTGCCACGCACCCATGCCTATGCAGAAATTTGGTTAGATAAAGAGAAAGTGGCGACAACGGATGAGGAGCCTATTTTAGGTGAAACCTATTTACCTCGGAAATTTAAAACATCGGTGGTGATCCCCCCTTATAACGATGTTGACTTGCATGCCAATGACATGAATTTTATTGCCATCGCAGAAAATGGGCATTTGGTTGGTTTTAATGTGCTAGTCGGTGGCGGCCTTGCGATGACCCATGGTGATAAAAAAACCTTTCCGCGTTTAGCTAGTGAATTTGGTTATATTCCTATTGATAAAACATTAGCAGTCGCTGAAGCGATTGTGACGACGCAACGAGATTGGGGCAATCGTACTGAACGTAAAAATGCCAAAACCAAATACACCTTAGAGCGTGTTGGTATTGAAACATTTAAACAGGAAGTTGAACGTCGCTCAGGCGTTATGTTTGATATGATCCGACCGTATCAATTTACTCACCGTGGTGATCAAATTGGTTGGTTAAAAGGGGTTGATAACAAATGGTATCTAACCTTATTTATTGAAAGTGGTCGATTAATCGATAAACCTAATGCGCCGTTAAAAACGGGGGTTGCTGAAATTGCCAAAGTGCATCTTGGTGACTTTCGTTTAACAGCTAATCAAAATTTGATTGTTGCTGGTGTACCAGAGGCACAGAAAGAGCAGATTGAGGCGATAGCGCGTCAATATGGTTTAATTAATGATGAGGTTACACCGCTGCGTAAACATGCCATGGCGTGTGTTTCATTTCCAACTTGCCCATTAGCCATGGCAGAAGCGGAGCGTTTCCTTCCCGCATTTACCGATACCCTTGATAATATCATGGCTAAATACGGAGTCAGTGATGAGCATATTGTTGTACGTGTAACAGGGTGTCCTAACGGTTGTGGTCGTGCGATGTTGGCGGAAGTCGGACTGGTGGGTAAAGCCCCCGATCGCTATAACTTACATCTAGGAGGAAACCGCATGGGTACTCGCATTCCTAGAATGTATCGTGAAAATATTTCATCACAAGAAATCATTGAAATTCTTGATACTTTAATTGGTCAGTGGGCTATTTCACGTGAATTAAATGAAGGTTTTGGTGATTTTCTTATTCGCACTGATGTTATCAAACCCGTTGTTAATTCAGCCATTGATTTTTATGAAGTGCAGGAGGTGATATGAGTCGATTATCACTTTCTCAGTTGGTGTTGCTATCGATTGAAGAGCAGCGA