Homologs in group_792

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03150 FBDBKF_03150 100.0 Morganella morganii S1 cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
EHELCC_07385 EHELCC_07385 100.0 Morganella morganii S2 cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
NLDBIP_07710 NLDBIP_07710 100.0 Morganella morganii S4 cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
LHKJJB_07245 LHKJJB_07245 100.0 Morganella morganii S3 cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
F4V73_RS11770 F4V73_RS11770 89.6 Morganella psychrotolerans cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
PMI_RS11080 PMI_RS11080 79.7 Proteus mirabilis HI4320 cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit

Distribution of the homologs in the orthogroup group_792

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_792

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N8L5 0.0 993 81 0 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B4F234 0.0 985 80 0 572 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Proteus mirabilis (strain HI4320)
A8G9X7 0.0 979 79 0 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Serratia proteamaculans (strain 568)
B1JK04 0.0 978 79 0 575 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FLY9 0.0 978 79 0 575 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66ED3 0.0 976 78 0 575 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TPY6 0.0 976 78 0 575 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pestis (strain Pestoides F)
Q1CLS7 0.0 976 78 0 575 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZBN7 0.0 976 78 0 575 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pestis
B2K566 0.0 976 78 0 575 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C3Z1 0.0 976 78 0 575 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pestis bv. Antiqua (strain Antiqua)
C6CLS0 0.0 974 78 0 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Dickeya chrysanthemi (strain Ech1591)
A7MJ64 0.0 966 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Cronobacter sakazakii (strain ATCC BAA-894)
A1JJS3 0.0 965 77 0 575 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C6CAW9 0.0 965 78 0 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Musicola paradisiaca (strain Ech703)
A9MF17 0.0 962 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A6TD48 0.0 960 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B7UHH5 0.0 958 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B5XV25 0.0 958 77 1 571 3 cysI1 Sulfite reductase [NADPH] hemoprotein beta-component 1 Klebsiella pneumoniae (strain 342)
B1LQ86 0.0 957 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain SMS-3-5 / SECEC)
A8ANX0 0.0 957 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B2TZH1 0.0 957 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I6F7 0.0 957 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain SE11)
B7N6Z7 0.0 957 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A8A3P4 0.0 957 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O9:H4 (strain HS)
B7LXH6 0.0 957 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O8 (strain IAI1)
B5Z3C6 0.0 957 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X7U2 0.0 957 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O157:H7
B7LEI2 0.0 957 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain 55989 / EAEC)
A7ZQK6 0.0 957 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8FEI8 0.0 956 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1R7T5 0.0 956 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain UTI89 / UPEC)
Q0TEA3 0.0 956 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AEU9 0.0 956 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O1:K1 / APEC
B7MYR1 0.0 956 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O81 (strain ED1a)
B7MKN0 0.0 956 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O45:K1 (strain S88 / ExPEC)
P17846 0.0 956 77 1 571 1 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain K12)
C4ZZR7 0.0 956 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain K12 / MC4100 / BW2952)
C6DDH3 0.0 956 76 0 571 3 cysI2 Sulfite reductase [NADPH] hemoprotein beta-component 2 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q83QE0 0.0 955 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shigella flexneri
B1IU78 0.0 955 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
C6UCN7 0.0 955 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain B / REL606)
C5W865 0.0 955 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain B / BL21-DE3)
Q3YY95 0.0 955 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shigella sonnei (strain Ss046)
Q31XM5 0.0 954 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shigella boydii serotype 4 (strain Sb227)
B7LWN9 0.0 953 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q0T1I7 0.0 953 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shigella flexneri serotype 5b (strain 8401)
B4T474 0.0 953 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella newport (strain SL254)
B2VG06 0.0 953 77 2 572 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B7NTA0 0.0 953 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P17845 0.0 952 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q32CG4 0.0 952 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shigella dysenteriae serotype 1 (strain Sd197)
B5FTU2 0.0 951 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella dublin (strain CT_02021853)
B5QW35 0.0 951 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella enteritidis PT4 (strain P125109)
B5F430 0.0 951 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella agona (strain SL483)
B4TTX8 0.0 951 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella schwarzengrund (strain CVM19633)
C0PXC5 0.0 951 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella paratyphi C (strain RKS4594)
Q6D1A2 0.0 950 75 0 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q57KH8 0.0 949 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella choleraesuis (strain SC-B67)
A4WDW0 0.0 949 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Enterobacter sp. (strain 638)
B5BEZ8 0.0 949 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella paratyphi A (strain AKU_12601)
Q5PEH8 0.0 949 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RDS0 0.0 949 77 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella gallinarum (strain 287/91 / NCTC 13346)
A9N2E5 0.0 948 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TFY4 0.0 947 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella heidelberg (strain SL476)
Q8Z459 0.0 946 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella typhi
Q2NVN3 0.0 884 73 0 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Sodalis glossinidius (strain morsitans)
Q6LM59 0.0 880 71 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Photobacterium profundum (strain SS9)
B4RYS6 0.0 879 72 1 566 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A5F3I5 0.0 878 72 1 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q87L91 0.0 877 72 2 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
C3LRB7 0.0 875 72 1 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio cholerae serotype O1 (strain M66-2)
Q9KUX3 0.0 875 72 1 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
C4L9J8 0.0 875 71 1 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q5NRM2 0.0 868 68 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q7MHA6 0.0 865 71 2 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio vulnificus (strain YJ016)
A0KNL0 0.0 863 71 1 565 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A7MSZ7 0.0 862 70 2 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio campbellii (strain ATCC BAA-1116)
Q8DCK1 0.0 861 71 2 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio vulnificus (strain CMCP6)
Q15NK1 0.0 861 69 0 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B7VI85 0.0 859 70 1 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio atlanticus (strain LGP32)
B6ELM5 0.0 859 71 1 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Aliivibrio salmonicida (strain LFI1238)
Q5E840 0.0 858 70 1 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FGI9 0.0 857 70 1 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Aliivibrio fischeri (strain MJ11)
A1S9I4 0.0 832 69 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q47UW8 0.0 826 67 2 575 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
C6DCZ7 0.0 826 66 1 572 3 cysI1 Sulfite reductase [NADPH] hemoprotein beta-component 1 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q1LTP2 0.0 824 67 0 556 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Baumannia cicadellinicola subsp. Homalodisca coagulata
Q3IFM1 0.0 821 68 1 557 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Pseudoalteromonas translucida (strain TAC 125)
Q9JUD9 0.0 810 65 2 570 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9LZ72 0.0 808 64 2 570 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Neisseria meningitidis serogroup C (strain 053442)
Q9JS33 0.0 805 64 2 570 3 cysI1 Sulfite reductase [NADPH] hemoprotein beta-component Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B5Y1B5 0.0 802 65 0 557 3 cysI2 Sulfite reductase [NADPH] hemoprotein beta-component 2 Klebsiella pneumoniae (strain 342)
A1KU05 0.0 801 64 2 570 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A6VPZ1 0.0 799 63 3 578 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B3GZ95 0.0 795 62 4 580 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q8VSR0 0.0 795 62 4 580 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Actinobacillus pleuropneumoniae
B0BT17 0.0 794 62 4 580 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N3D8 0.0 789 61 4 580 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B8D7V7 0.0 788 62 1 568 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57502 0.0 787 62 1 568 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9K5 0.0 787 62 1 568 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q65T54 0.0 787 63 4 580 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q493N3 0.0 779 63 2 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Blochmanniella pennsylvanica (strain BPEN)
Q7VQH1 0.0 758 60 3 569 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Blochmanniella floridana
P0C0B2 0.0 757 61 2 557 5 cysI Putative sulfite reductase [NADPH] hemoprotein beta-component Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A1T054 0.0 743 62 1 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A3QAP0 0.0 691 56 1 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q0HYB3 0.0 684 56 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella sp. (strain MR-7)
A0KTH5 0.0 684 56 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella sp. (strain ANA-3)
Q0HFL7 0.0 683 56 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella sp. (strain MR-4)
A8FZY7 0.0 682 56 2 564 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella sediminis (strain HAW-EB3)
A1RGD7 0.0 682 55 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella sp. (strain W3-18-1)
Q12QQ5 0.0 682 56 0 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B8CJV9 0.0 681 55 1 564 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella piezotolerans (strain WP3 / JCM 13877)
A4Y9Z3 0.0 681 55 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q8EB00 0.0 680 56 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A9L2P8 0.0 679 55 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella baltica (strain OS195)
A6WJT5 0.0 679 55 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella baltica (strain OS185)
A3D829 0.0 679 55 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EE51 0.0 679 55 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella baltica (strain OS223)
B1KE86 0.0 674 54 1 563 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella woodyi (strain ATCC 51908 / MS32)
A8H094 0.0 672 55 1 564 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q07Y86 0.0 671 55 1 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella frigidimarina (strain NCIMB 400)
B0TTE4 0.0 669 54 1 564 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella halifaxensis (strain HAW-EB4)
P52673 0.0 629 56 4 558 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Thiocapsa roseopersicina
Q1D9W9 0.0 626 54 2 546 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Myxococcus xanthus (strain DK1622)
Q9KF75 0.0 620 52 3 554 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B7GJU8 0.0 620 52 3 557 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Anoxybacillus flavithermus (strain DSM 21510 / WK1)
O32213 0.0 616 51 3 553 1 cysI Sulfite reductase [NADPH] hemoprotein beta-component Bacillus subtilis (strain 168)
Q65L57 0.0 616 52 4 554 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A4IMT6 0.0 610 51 3 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Geobacillus thermodenitrificans (strain NG80-2)
Q5L041 0.0 610 52 3 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Geobacillus kaustophilus (strain HTA426)
C0Z9X2 0.0 608 51 5 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
A7Z8R5 0.0 601 50 5 566 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A8FDY3 0.0 598 51 4 554 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Bacillus pumilus (strain SAFR-032)
B1HXC1 0.0 596 51 3 556 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Lysinibacillus sphaericus (strain C3-41)
Q5WKE7 0.0 584 51 5 576 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shouchella clausii (strain KSM-K16)
B1LS97 0.0 570 48 6 564 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q8EQP0 0.0 569 49 6 572 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B8IRY2 0.0 566 48 6 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
C6CXN6 0.0 566 48 4 558 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Paenibacillus sp. (strain JDR-2)
Q3JBJ1 0.0 566 47 4 565 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B9DLM4 0.0 565 48 5 558 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Staphylococcus carnosus (strain TM300)
A9W4X6 0.0 563 48 7 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylorubrum extorquens (strain PA1)
C5APZ1 0.0 561 47 7 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylorubrum extorquens (strain ATCC 14718 / DSM 1338 / JCM 2805 / NCIMB 9133 / AM1)
B7L0Y4 0.0 561 47 7 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylorubrum extorquens (strain CM4 / NCIMB 13688)
B1Z7C5 0.0 558 47 7 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q4L9F1 0.0 558 49 5 566 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Staphylococcus haemolyticus (strain JCSC1435)
Q8CMX5 0.0 556 49 4 555 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HKZ7 0.0 556 49 4 555 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B0U8Y9 0.0 554 47 6 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylobacterium sp. (strain 4-46)
B5EQW2 0.0 549 48 4 555 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7JAM6 0.0 549 48 4 555 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
B8EKI5 0.0 547 49 5 554 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q49UL9 0.0 546 48 4 553 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9PD81 0.0 546 49 3 548 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xylella fastidiosa (strain 9a5c)
Q1QU16 0.0 544 50 5 557 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B0SNL6 0.0 544 48 3 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SF75 0.0 544 48 3 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
B0U6W0 0.0 543 49 3 548 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xylella fastidiosa (strain M12)
Q87DH0 0.0 541 49 3 548 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2IA31 0.0 541 49 3 548 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xylella fastidiosa (strain M23)
Q3BPY4 0.0 540 48 4 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PHC8 0.0 537 48 4 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas axonopodis pv. citri (strain 306)
Q8KQT8 0.0 536 48 4 547 1 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SI05 0.0 536 48 4 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P0H2 0.0 536 48 4 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8P608 0.0 531 48 5 548 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RPG6 0.0 530 48 5 548 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas campestris pv. campestris (strain B100)
Q4UY08 0.0 530 48 5 548 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas campestris pv. campestris (strain 8004)
B6JCW3 1.06e-178 520 46 3 557 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A9IT77 4.5e-177 516 48 5 556 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q1QQC7 2.05e-175 511 46 5 554 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q3SV33 8.34e-175 509 46 4 552 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q82W45 1.53e-173 506 47 6 552 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q0AGU3 9.61e-171 499 47 6 552 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
P47169 1.28e-158 493 42 5 585 1 MET5 Sulfite reductase [NADPH] subunit beta Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q1K9C2 9.91e-149 467 42 8 573 3 sir1 Sulfite reductase [NADPH] subunit beta Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P30008 4.67e-116 360 36 10 578 3 sir Sulfite reductase [ferredoxin] Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P72854 7.94e-114 355 35 8 578 1 sir Sulfite reductase [ferredoxin] Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O82802 1.89e-109 345 35 10 579 1 SIR1 Sulfite reductase 1 [ferredoxin], chloroplastic Nicotiana tabacum
Q75NZ0 7.58e-108 341 35 11 576 1 SIR Sulfite reductase [ferredoxin], chloroplastic Pisum sativum
O23813 2.42e-107 338 35 9 579 1 SIR Sulfite reductase [ferredoxin], chloroplastic Zea mays
Q9LZ66 1.91e-106 336 34 11 585 1 SIR Assimilatory sulfite reductase (ferredoxin), chloroplastic Arabidopsis thaliana
Q9AWB2 5.72e-97 310 35 10 521 1 SIR Sulfite reductase [ferredoxin], chloroplastic (Fragment) Glycine max
P9WJ03 4.49e-30 127 26 21 529 1 sir Sulfite reductase [ferredoxin] Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJ02 4.49e-30 127 26 21 529 3 sir Sulfite reductase [ferredoxin] Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TYP6 4.49e-30 127 26 21 529 3 sir Sulfite reductase [ferredoxin] Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P05314 2.16e-26 117 24 21 526 1 NIR Ferredoxin--nitrite reductase, chloroplastic Spinacia oleracea
Q73YC1 3.4e-26 116 24 19 533 3 sir1 Sulfite reductase [ferredoxin] 1 Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q73XV0 5.41e-26 115 25 21 544 3 sir2 Sulfite reductase [ferredoxin] 2 Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q39161 1.71e-25 114 25 21 521 1 NIR1 Ferredoxin--nitrite reductase, chloroplastic Arabidopsis thaliana
P38500 1.97e-24 110 25 22 510 2 NIR1 Ferredoxin--nitrite reductase, chloroplastic Betula pendula
Q51879 3.31e-24 109 26 18 495 3 nirA Ferredoxin--nitrite reductase Phormidium laminosum
Q42997 2.2e-23 107 25 17 437 2 Os01g0357100 Ferredoxin--nitrite reductase, chloroplastic Oryza sativa subsp. japonica
P17847 1.84e-22 105 24 22 524 2 NIR Ferredoxin--nitrite reductase, chloroplastic (Fragment) Zea mays
P39661 2.57e-22 103 25 15 430 3 nirA Ferredoxin--nitrite reductase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
I3R637 4.69e-16 85 23 20 521 1 nasD Assimilatory ferredoxin-dependent nitrite reductase Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_03685
Feature type CDS
Gene cysI
Product assimilatory sulfite reductase (NADPH) hemoprotein subunit
Location 54941 - 56668 (strand: -1)
Length 1728 (nucleotides) / 575 (amino acids)
In genomic island -

Contig

Accession ZDB_681
Length 269562 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_792
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01077 Nitrite and sulphite reductase 4Fe-4S domain
PF03460 Nitrite/Sulfite reductase ferredoxin-like half domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0155 Inorganic ion transport and metabolism (P) P Sulfite reductase, beta subunit (hemoprotein)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00381 sulfite reductase (NADPH) hemoprotein beta-component [EC:1.8.1.2] Sulfur metabolism
Metabolic pathways
Microbial metabolism in diverse environments
Sulfur cycle
Assimilatory sulfate reduction, sulfate => H2S

Protein Sequence

MSDKHNGPLIVEGKLSDSERMKRDSNYLRGTIKEDLKNGLTGGFEGDNFLLIRFHGMYQQDDRDIRAERTEQKLEPRHAMMLRCRLPGGVITPEQWLRIDKFAAEQTLYGSIRITNRQTFQFHGILKGDVKPAHQMLHEAGLDSLATANDVNRNVLCTSNPVQSGLHREAYEWAKKISEHLLPRTRAYAEIWLDKEKVAATDEEPILGETYLPRKFKTSVVIPPLNDVDLHANDMNFVAIEENGKLIGFNVLVGGGLAMTHGDTATFPRLASEFGFIPLKDTLAVAEAIVTTQRDWGNRTERKNAKTKYTLERVGVDTFKQETERRAGITFSPIRPYEFTLRGDQIGWLKGIDDHWHLTLFIENGRLIDLPGKPLKTGVAEIARIHRGDFRLTANQNLIIAGIPEAEKSRIESLARAHGLISDNVTPLRENSMACVSFPTCPLAMAEAERFLPEFVTEVEKIMSSHGVGNEEIVLRVTGCPNGCGRAMLSEVGLVGKAPDRYNLHLGGNRTGTRIPRMYRENISSAVILSVLDELIGRWSQERTDGEDFGDYLIRAGVVKPVLNSAVDFYEAGAA

Flanking regions ( +/- flanking 50bp)

TTTTTAAGTGAGCTGCGCACAGCGCGCCGGTACCAGAGGGATGTCTATTAATGAGCGATAAACACAACGGGCCTTTAATCGTGGAAGGCAAACTGAGCGACAGCGAAAGAATGAAGCGCGACAGCAACTATCTGCGCGGCACCATCAAAGAGGATCTGAAAAATGGTTTGACCGGCGGATTTGAAGGGGATAACTTTCTGCTGATCCGCTTTCACGGCATGTATCAGCAGGATGACAGGGATATCCGGGCGGAACGCACAGAACAGAAACTGGAGCCGCGTCACGCCATGATGCTGCGCTGCCGTTTGCCGGGAGGTGTGATCACACCGGAACAGTGGCTGAGAATAGACAAATTTGCTGCAGAACAGACGCTGTACGGCAGTATCCGGATCACCAACCGGCAGACCTTTCAGTTCCACGGCATTCTGAAAGGGGATGTCAAACCGGCGCATCAGATGCTGCATGAGGCGGGGCTGGATTCACTGGCAACCGCCAATGATGTGAACCGTAATGTACTCTGTACCTCGAATCCGGTTCAGTCCGGCCTGCACCGTGAAGCGTATGAGTGGGCGAAAAAAATCTCTGAGCATCTGCTGCCGCGCACCCGTGCTTACGCTGAAATCTGGCTGGATAAAGAAAAAGTGGCGGCAACTGATGAGGAACCGATCTTAGGTGAAACCTATCTGCCGCGTAAGTTTAAAACCTCGGTGGTGATCCCGCCGCTGAACGATGTTGATTTGCACGCTAATGATATGAATTTTGTGGCGATTGAGGAAAACGGCAAACTGATTGGTTTTAATGTGCTGGTGGGCGGCGGCCTGGCGATGACTCACGGTGATACCGCGACTTTTCCCCGTCTGGCCAGTGAGTTCGGCTTTATCCCGCTGAAAGATACCCTGGCGGTGGCAGAGGCGATTGTCACCACTCAGCGCGACTGGGGAAACCGGACGGAACGCAAAAATGCCAAAACCAAATACACGCTGGAGCGGGTGGGGGTTGACACATTTAAACAGGAAACCGAACGGCGTGCCGGTATCACGTTTTCCCCGATCCGCCCGTATGAATTTACCCTGCGTGGTGATCAGATCGGCTGGTTAAAAGGGATTGATGACCACTGGCATCTGACGCTGTTTATTGAAAACGGGCGTCTGATTGATTTGCCGGGCAAACCGCTGAAAACCGGCGTGGCGGAAATCGCCAGAATCCACCGGGGAGATTTCCGGTTAACCGCCAATCAGAACCTGATTATTGCCGGTATTCCGGAGGCGGAAAAATCCCGTATCGAATCCCTTGCGCGGGCACACGGCCTTATCAGCGACAATGTCACACCGCTGCGGGAAAACTCAATGGCTTGTGTGTCATTCCCGACCTGTCCGCTGGCAATGGCGGAAGCGGAGCGCTTTCTGCCGGAGTTTGTCACAGAGGTTGAGAAAATTATGTCCTCGCACGGCGTGGGAAATGAAGAGATTGTTCTGCGGGTCACCGGTTGCCCGAACGGCTGCGGAAGAGCCATGCTGTCGGAGGTGGGATTGGTCGGCAAAGCGCCGGATCGCTATAATCTGCATCTCGGCGGTAACCGCACCGGCACCCGTATCCCGCGCATGTACCGCGAAAATATCAGCTCAGCGGTGATTTTATCGGTGCTTGATGAGCTTATCGGACGCTGGTCACAGGAGCGGACGGACGGGGAGGATTTCGGCGATTATCTGATCCGCGCCGGGGTGGTAAAACCGGTTCTGAATTCCGCCGTGGATTTTTATGAGGCAGGTGCTGCCTGAAATAAAAAACCGCGCCGTTTTACGCGGCGCGGTTTCTGTATTCACAGCAA