Homologs in group_721

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03150 FBDBKF_03150 89.6 Morganella morganii S1 cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
EHELCC_07385 EHELCC_07385 89.6 Morganella morganii S2 cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
NLDBIP_07710 NLDBIP_07710 89.6 Morganella morganii S4 cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
LHKJJB_07245 LHKJJB_07245 89.6 Morganella morganii S3 cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
HKOGLL_03685 HKOGLL_03685 89.6 Morganella morganii S5 cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
PMI_RS11080 PMI_RS11080 79.5 Proteus mirabilis HI4320 cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit

Distribution of the homologs in the orthogroup group_721

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_721

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F234 0.0 976 79 0 575 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Proteus mirabilis (strain HI4320)
Q7N8L5 0.0 971 79 0 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C6CLS0 0.0 948 77 0 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Dickeya chrysanthemi (strain Ech1591)
C6CAW9 0.0 947 77 0 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Musicola paradisiaca (strain Ech703)
B1JK04 0.0 942 76 0 573 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FLY9 0.0 942 76 0 573 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66ED3 0.0 942 76 0 573 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K566 0.0 942 76 0 573 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A8G9X7 0.0 941 75 0 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Serratia proteamaculans (strain 568)
A4TPY6 0.0 940 76 0 573 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pestis (strain Pestoides F)
Q1CLS7 0.0 940 76 0 573 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZBN7 0.0 940 76 0 573 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pestis
Q1C3Z1 0.0 940 76 0 573 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia pestis bv. Antiqua (strain Antiqua)
A7MJ64 0.0 937 76 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Cronobacter sakazakii (strain ATCC BAA-894)
A1JJS3 0.0 936 75 0 573 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B2VG06 0.0 935 75 2 572 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q83QE0 0.0 927 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shigella flexneri
C6DDH3 0.0 927 74 0 571 3 cysI2 Sulfite reductase [NADPH] hemoprotein beta-component 2 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q8FEI8 0.0 927 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B2TZH1 0.0 927 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I6F7 0.0 927 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain SE11)
B7N6Z7 0.0 927 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7LXH6 0.0 927 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O8 (strain IAI1)
B5Z3C6 0.0 927 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X7U2 0.0 927 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O157:H7
B7LEI2 0.0 927 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain 55989 / EAEC)
B7UHH5 0.0 927 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZQK6 0.0 927 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O139:H28 (strain E24377A / ETEC)
B1LQ86 0.0 926 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain SMS-3-5 / SECEC)
Q0T1I7 0.0 926 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shigella flexneri serotype 5b (strain 8401)
A9MF17 0.0 926 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8A3P4 0.0 926 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O9:H4 (strain HS)
Q1R7T5 0.0 926 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain UTI89 / UPEC)
Q0TEA3 0.0 926 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AEU9 0.0 926 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O1:K1 / APEC
B7MYR1 0.0 926 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O81 (strain ED1a)
B7MKN0 0.0 926 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O45:K1 (strain S88 / ExPEC)
P17846 0.0 925 74 1 571 1 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain K12)
C4ZZR7 0.0 925 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain K12 / MC4100 / BW2952)
A8ANX0 0.0 925 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q3YY95 0.0 925 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shigella sonnei (strain Ss046)
Q6D1A2 0.0 925 74 0 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1IU78 0.0 924 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q31XM5 0.0 924 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shigella boydii serotype 4 (strain Sb227)
C6UCN7 0.0 924 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain B / REL606)
C5W865 0.0 924 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli (strain B / BL21-DE3)
A6TD48 0.0 923 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B7LWN9 0.0 923 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NTA0 0.0 923 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5XV25 0.0 923 74 1 571 3 cysI1 Sulfite reductase [NADPH] hemoprotein beta-component 1 Klebsiella pneumoniae (strain 342)
Q32CG4 0.0 921 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shigella dysenteriae serotype 1 (strain Sd197)
B5QW35 0.0 920 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella enteritidis PT4 (strain P125109)
B5FTU2 0.0 919 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella dublin (strain CT_02021853)
B4TTX8 0.0 918 73 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella schwarzengrund (strain CVM19633)
B4T474 0.0 918 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella newport (strain SL254)
A4WDW0 0.0 918 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Enterobacter sp. (strain 638)
P17845 0.0 917 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0PXC5 0.0 917 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella paratyphi C (strain RKS4594)
A9N2E5 0.0 916 73 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5RDS0 0.0 916 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q57KH8 0.0 916 73 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella choleraesuis (strain SC-B67)
B5F430 0.0 915 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella agona (strain SL483)
B5BEZ8 0.0 915 73 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella paratyphi A (strain AKU_12601)
Q5PEH8 0.0 915 73 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z459 0.0 914 74 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella typhi
B4TFY4 0.0 914 73 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Salmonella heidelberg (strain SL476)
C4L9J8 0.0 863 71 1 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q6LM59 0.0 857 70 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Photobacterium profundum (strain SS9)
B4RYS6 0.0 856 69 2 573 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q5NRM2 0.0 853 67 1 571 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q2NVN3 0.0 852 70 0 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Sodalis glossinidius (strain morsitans)
A5F3I5 0.0 851 70 1 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q87L91 0.0 850 71 2 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
C3LRB7 0.0 849 70 1 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio cholerae serotype O1 (strain M66-2)
Q9KUX3 0.0 849 70 1 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B6ELM5 0.0 847 69 1 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Aliivibrio salmonicida (strain LFI1238)
Q5E840 0.0 847 70 1 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Aliivibrio fischeri (strain ATCC 700601 / ES114)
B7VI85 0.0 845 70 1 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio atlanticus (strain LGP32)
B5FGI9 0.0 845 69 1 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Aliivibrio fischeri (strain MJ11)
Q7MHA6 0.0 843 70 2 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio vulnificus (strain YJ016)
A0KNL0 0.0 842 69 1 569 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A7MSZ7 0.0 840 70 2 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio campbellii (strain ATCC BAA-1116)
Q8DCK1 0.0 840 70 2 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Vibrio vulnificus (strain CMCP6)
Q15NK1 0.0 837 67 1 569 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
C6DCZ7 0.0 811 66 1 572 3 cysI1 Sulfite reductase [NADPH] hemoprotein beta-component 1 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A1S9I4 0.0 809 67 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q1LTP2 0.0 803 65 0 556 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Baumannia cicadellinicola subsp. Homalodisca coagulata
Q47UW8 0.0 802 66 2 572 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q3IFM1 0.0 799 66 1 557 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Pseudoalteromonas translucida (strain TAC 125)
Q9JUD9 0.0 790 64 2 567 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9LZ72 0.0 788 64 2 566 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Neisseria meningitidis serogroup C (strain 053442)
B8D7V7 0.0 787 63 1 568 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B5Y1B5 0.0 787 64 0 557 3 cysI2 Sulfite reductase [NADPH] hemoprotein beta-component 2 Klebsiella pneumoniae (strain 342)
Q9JS33 0.0 787 64 2 567 3 cysI1 Sulfite reductase [NADPH] hemoprotein beta-component Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P57502 0.0 786 63 1 568 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9K5 0.0 786 63 1 568 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A6VPZ1 0.0 785 64 3 568 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A1KU05 0.0 783 64 2 567 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B0BT17 0.0 781 62 4 580 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GZ95 0.0 779 61 4 580 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q8VSR0 0.0 776 61 4 580 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Actinobacillus pleuropneumoniae
A3N3D8 0.0 774 61 4 580 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q65T54 0.0 771 62 4 584 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P0C0B2 0.0 760 62 2 557 5 cysI Putative sulfite reductase [NADPH] hemoprotein beta-component Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q493N3 0.0 760 62 2 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Blochmanniella pennsylvanica (strain BPEN)
Q7VQH1 0.0 745 60 2 558 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Blochmanniella floridana
A1T054 0.0 725 61 1 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A3QAP0 0.0 682 55 1 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A8FZY7 0.0 678 55 2 564 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella sediminis (strain HAW-EB3)
Q0HYB3 0.0 677 55 1 564 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella sp. (strain MR-7)
A0KTH5 0.0 677 55 1 564 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella sp. (strain ANA-3)
Q0HFL7 0.0 677 55 1 564 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella sp. (strain MR-4)
A1RGD7 0.0 675 55 1 564 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella sp. (strain W3-18-1)
A4Y9Z3 0.0 675 55 1 564 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q8EB00 0.0 674 55 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q12QQ5 0.0 673 55 0 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A9L2P8 0.0 672 55 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella baltica (strain OS195)
A6WJT5 0.0 672 55 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella baltica (strain OS185)
A3D829 0.0 672 55 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8CJV9 0.0 669 54 1 564 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella piezotolerans (strain WP3 / JCM 13877)
B8EE51 0.0 668 54 1 562 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella baltica (strain OS223)
B1KE86 0.0 664 53 2 574 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella woodyi (strain ATCC 51908 / MS32)
Q07Y86 0.0 663 55 1 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella frigidimarina (strain NCIMB 400)
A8H094 0.0 657 53 1 564 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TTE4 0.0 655 53 1 564 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shewanella halifaxensis (strain HAW-EB4)
Q1D9W9 0.0 616 53 2 543 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Myxococcus xanthus (strain DK1622)
P52673 0.0 610 54 4 558 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Thiocapsa roseopersicina
B7GJU8 0.0 602 50 3 557 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Anoxybacillus flavithermus (strain DSM 21510 / WK1)
O32213 0.0 598 51 3 553 1 cysI Sulfite reductase [NADPH] hemoprotein beta-component Bacillus subtilis (strain 168)
Q9KF75 0.0 597 51 3 554 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q65L57 0.0 595 51 4 554 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q5L041 0.0 589 50 3 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Geobacillus kaustophilus (strain HTA426)
A4IMT6 0.0 588 50 3 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Geobacillus thermodenitrificans (strain NG80-2)
A8FDY3 0.0 588 50 4 554 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Bacillus pumilus (strain SAFR-032)
A7Z8R5 0.0 587 49 5 566 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
C0Z9X2 0.0 585 50 4 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
B1HXC1 0.0 582 51 3 556 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Lysinibacillus sphaericus (strain C3-41)
Q5WKE7 0.0 573 50 5 576 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Shouchella clausii (strain KSM-K16)
B1LS97 0.0 558 47 6 564 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
A9W4X6 0.0 558 47 7 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylorubrum extorquens (strain PA1)
C5APZ1 0.0 556 47 7 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylorubrum extorquens (strain ATCC 14718 / DSM 1338 / JCM 2805 / NCIMB 9133 / AM1)
B7L0Y4 0.0 556 47 7 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylorubrum extorquens (strain CM4 / NCIMB 13688)
C6CXN6 0.0 555 48 4 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Paenibacillus sp. (strain JDR-2)
B1Z7C5 0.0 554 47 7 561 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q3JBJ1 0.0 552 46 4 566 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q8EQP0 0.0 551 48 5 564 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B8IRY2 0.0 550 47 6 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
B5EQW2 0.0 545 47 4 555 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7JAM6 0.0 545 47 4 555 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
B9DLM4 0.0 544 47 4 554 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Staphylococcus carnosus (strain TM300)
B0U8Y9 0.0 541 46 6 559 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylobacterium sp. (strain 4-46)
Q1QU16 0.0 538 49 5 557 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B8EKI5 0.0 536 48 5 554 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
B0U6W0 0.0 536 48 3 548 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xylella fastidiosa (strain M12)
B0SNL6 0.0 535 48 3 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SF75 0.0 535 48 3 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q87DH0 0.0 534 48 3 548 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2IA31 0.0 534 48 3 548 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xylella fastidiosa (strain M23)
Q49UL9 0.0 533 48 4 553 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9PD81 0.0 533 48 3 548 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xylella fastidiosa (strain 9a5c)
Q8KQT8 0.0 532 48 4 547 1 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SI05 0.0 532 48 4 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P0H2 0.0 532 48 4 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q4L9F1 0.0 532 47 4 563 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Staphylococcus haemolyticus (strain JCSC1435)
Q3BPY4 0.0 532 47 4 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PHC8 0.0 531 48 4 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas axonopodis pv. citri (strain 306)
Q5HKZ7 0.0 531 48 5 563 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CMX5 0.0 530 48 5 563 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8P608 0.0 529 47 4 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RPG6 0.0 528 47 4 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas campestris pv. campestris (strain B100)
Q4UY08 0.0 528 47 4 547 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Xanthomonas campestris pv. campestris (strain 8004)
B6JCW3 4.94e-178 518 47 4 560 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q3SV33 9.91e-176 512 47 4 552 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q1QQC7 4.95e-174 508 46 4 553 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q82W45 8.71e-172 502 48 6 552 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A9IT77 1.11e-170 499 48 5 556 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q0AGU3 6.09e-169 494 47 6 552 3 cysI Sulfite reductase [NADPH] hemoprotein beta-component Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
P47169 2.99e-153 479 42 5 585 1 MET5 Sulfite reductase [NADPH] subunit beta Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q1K9C2 2.39e-142 450 41 6 577 3 sir1 Sulfite reductase [NADPH] subunit beta Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P72854 1.35e-109 344 35 7 573 1 sir Sulfite reductase [ferredoxin] Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P30008 1.36e-108 341 36 8 570 3 sir Sulfite reductase [ferredoxin] Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O82802 3.55e-107 340 35 8 571 1 SIR1 Sulfite reductase 1 [ferredoxin], chloroplastic Nicotiana tabacum
Q9LZ66 1.27e-102 326 33 9 582 1 SIR Assimilatory sulfite reductase (ferredoxin), chloroplastic Arabidopsis thaliana
O23813 1.38e-102 326 34 9 579 1 SIR Sulfite reductase [ferredoxin], chloroplastic Zea mays
Q75NZ0 5.37e-102 326 35 10 568 1 SIR Sulfite reductase [ferredoxin], chloroplastic Pisum sativum
Q9AWB2 3.39e-94 302 34 8 518 1 SIR Sulfite reductase [ferredoxin], chloroplastic (Fragment) Glycine max
P9WJ03 2.53e-26 116 25 20 530 1 sir Sulfite reductase [ferredoxin] Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJ02 2.53e-26 116 25 20 530 3 sir Sulfite reductase [ferredoxin] Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TYP6 2.53e-26 116 25 20 530 3 sir Sulfite reductase [ferredoxin] Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q73XV0 1.08e-24 111 24 19 545 3 sir2 Sulfite reductase [ferredoxin] 2 Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P39661 2.43e-23 107 24 18 509 3 nirA Ferredoxin--nitrite reductase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q73YC1 5.07e-23 106 24 18 526 3 sir1 Sulfite reductase [ferredoxin] 1 Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q51879 2.94e-22 103 25 18 492 3 nirA Ferredoxin--nitrite reductase Phormidium laminosum
P38500 6.38e-22 103 24 16 439 2 NIR1 Ferredoxin--nitrite reductase, chloroplastic Betula pendula
P05314 3.33e-21 101 23 19 508 1 NIR Ferredoxin--nitrite reductase, chloroplastic Spinacia oleracea
Q39161 2.88e-20 98 23 19 489 1 NIR1 Ferredoxin--nitrite reductase, chloroplastic Arabidopsis thaliana
P17847 3.95e-20 97 23 19 485 2 NIR Ferredoxin--nitrite reductase, chloroplastic (Fragment) Zea mays
Q42997 5.24e-19 94 24 17 435 2 Os01g0357100 Ferredoxin--nitrite reductase, chloroplastic Oryza sativa subsp. japonica
I3R637 1.28e-18 93 23 23 531 1 nasD Assimilatory ferredoxin-dependent nitrite reductase Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS11770
Feature type CDS
Gene cysI
Product assimilatory sulfite reductase (NADPH) hemoprotein subunit
Location 503188 - 504915 (strand: 1)
Length 1728 (nucleotides) / 575 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_721
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01077 Nitrite and sulphite reductase 4Fe-4S domain
PF03460 Nitrite/Sulfite reductase ferredoxin-like half domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0155 Inorganic ion transport and metabolism (P) P Sulfite reductase, beta subunit (hemoprotein)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00381 sulfite reductase (NADPH) hemoprotein beta-component [EC:1.8.1.2] Sulfur metabolism
Metabolic pathways
Microbial metabolism in diverse environments		 Assimilatory sulfate reduction, sulfate => H2S

Protein Sequence

MSDKKYGPLIVEGKLSDSERMKRDSDYLRGTIKDDLKNGLTGGFEGDNFLLIRFHGMYQQDDRDIRAERTEQQLEPRHAMMLRCRLPGGIITPAQWLKIDKFASENTLYGSIRITNRQTFQFHGILKGDLKPAHQMLHEAGLDSLATANDVNRNVLCTSNPVQSELHSEAYQWAKKISEHLLPRTRAYAEIWLNKEKVAVTDEEPILGKTYLPRKFKTSVVIPPVNDVDLHANDMNFVAIEQNGKLIGFNVLVGGGLAMTHGDTATFPRLASEFGFIFLKDTLAVAQAIVTTQRDWGNRTDRKNAKTKYTLERVGIDVFKQETQRRSGVTFSPVRPYTFTLRGDQPGWLKGIDGHWHLTLFIENGRLIDLPGKPLKTGVAEIAKIHRGDFRLTANQNLIIAGVPQAKKENIELIARAHGLISDSVTPLRENSMACVSFPTCPLAMAEAERFLPDFITCVENIMLSHGVGGEPIVLRVTGCPNGCARAMLSEVGLVGKAPDRYNLHLGGNRTGTRIPRMYRENISSAVILSILDELIGRWSTERNSQEGFGDYLIRADIIKPVLNSAVDFYEAKVV

Flanking regions ( +/- flanking 50bp)

TTTTTAAGTGAACTGCGCACTGTGCGCCGGTATCAGAGGGATGTTTATTAATGAGTGATAAAAAATACGGACCTTTAATTGTTGAGGGTAAACTGAGCGACAGCGAAAGAATGAAGCGTGACAGTGATTATCTGCGCGGGACGATTAAAGACGATTTGAAAAATGGTCTGACCGGCGGGTTTGAAGGGGATAATTTTTTACTGATCCGCTTTCACGGGATGTATCAGCAGGATGACCGTGATATCCGTGCGGAACGCACAGAACAGCAGTTGGAACCCCGTCATGCCATGATGCTTCGCTGCCGTCTGCCGGGCGGTATTATTACACCGGCGCAGTGGCTGAAAATTGATAAATTTGCATCAGAAAATACGCTGTACGGCAGCATCCGCATTACCAACCGGCAGACGTTTCAGTTTCACGGTATTTTGAAAGGGGATTTAAAACCGGCACATCAGATGTTGCATGAAGCAGGGCTGGATTCACTTGCCACGGCTAATGATGTTAACCGCAATGTTCTCTGCACGTCTAATCCGGTTCAGTCTGAATTACACAGTGAGGCGTATCAATGGGCAAAAAAGATATCGGAACATTTATTACCCCGGACGCGTGCGTATGCTGAGATCTGGCTTAATAAAGAAAAAGTTGCAGTAACAGATGAGGAGCCAATATTAGGGAAAACCTACCTGCCGCGTAAATTCAAAACATCAGTGGTGATCCCGCCCGTAAATGATGTTGATTTACATGCTAATGACATGAATTTTGTGGCTATTGAACAAAACGGAAAACTGATAGGTTTTAATGTTCTGGTCGGCGGGGGGCTGGCTATGACACACGGTGATACCGCAACATTTCCCCGTTTGGCCAGTGAATTCGGGTTTATTTTCTTAAAGGATACACTGGCGGTCGCGCAGGCGATTGTCACCACGCAACGTGACTGGGGAAACCGGACAGACCGCAAAAATGCCAAAACCAAATACACTCTTGAACGCGTCGGTATTGACGTTTTTAAACAGGAAACGCAGCGGCGTTCAGGTGTGACATTCTCTCCTGTCCGTCCGTATACATTCACATTACGCGGTGATCAGCCCGGCTGGTTAAAAGGTATTGATGGTCACTGGCATCTGACGCTTTTTATTGAAAATGGCCGCCTGATTGATCTGCCCGGCAAACCATTAAAAACAGGCGTGGCGGAAATCGCAAAAATTCACCGGGGGGATTTTCGTTTAACCGCCAATCAAAACCTGATTATTGCGGGAGTTCCACAGGCAAAAAAAGAGAATATTGAATTGATCGCACGGGCGCATGGTCTTATCAGTGACAGTGTTACTCCGCTGCGTGAGAATTCAATGGCATGTGTTTCTTTCCCGACATGTCCGCTGGCTATGGCAGAAGCGGAGCGTTTCCTGCCTGATTTTATCACCTGTGTGGAAAACATTATGCTGTCACACGGTGTGGGCGGAGAGCCTATTGTATTGCGTGTGACCGGTTGCCCGAATGGCTGCGCCCGGGCGATGTTATCGGAAGTGGGATTAGTGGGAAAAGCGCCGGATCGCTATAATTTACATTTGGGCGGAAATCGTACCGGTACACGAATTCCCCGTATGTACAGGGAAAATATCAGCTCAGCAGTGATTTTATCTATTCTGGATGAATTAATCGGACGCTGGTCAACAGAACGGAATAGTCAGGAAGGATTTGGTGATTATCTGATCCGTGCCGATATTATCAAACCAGTGCTTAACTCAGCGGTTGATTTTTATGAGGCAAAAGTGGTTTAACGTAAAAACCGCGCCATTTTCAGTGGCGCGGTTTTTACTATTTACAAAAA