Homologs in group_2443

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_20070 FBDBKF_20070 44.2 Morganella morganii S1 - HTH cro/C1-type domain-containing protein
EHELCC_03460 EHELCC_03460 44.2 Morganella morganii S2 - HTH cro/C1-type domain-containing protein
NLDBIP_03460 NLDBIP_03460 44.2 Morganella morganii S4 - HTH cro/C1-type domain-containing protein
LHKJJB_09290 LHKJJB_09290 44.2 Morganella morganii S3 - HTH cro/C1-type domain-containing protein
HKOGLL_09685 HKOGLL_09685 44.2 Morganella morganii S5 - HTH cro/C1-type domain-containing protein
F4V73_RS01690 F4V73_RS01690 42.9 Morganella psychrotolerans - helix-turn-helix transcriptional regulator

Distribution of the homologs in the orthogroup group_2443

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2443

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q9V1R0 3.19e-06 47 29 0 91 3 PYRAB03670 Putative HTH-type transcriptional regulatory protein PYRAB03670 Pyrococcus abyssi (strain GE5 / Orsay)
Q8TZX4 5.19e-06 46 38 0 54 3 PF1851 Putative HTH-type transcriptional regulatory protein PF1851 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
O59472 1.07e-05 45 35 0 54 3 PH1808 Putative HTH-type transcriptional regulatory protein PH1808 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P0C5S2 1.76e-05 43 32 0 62 4 R00410 Uncharacterized HTH-type transcriptional regulator R00410 Rhizobium meliloti (strain 1021)
A6U5H5 1.76e-05 43 32 0 62 4 Smed_0045 Uncharacterized HTH-type transcriptional regulator Smed_0045 Sinorhizobium medicae (strain WSM419)
O06581 3.81e-05 43 29 1 94 1 prpR HTH-type transcriptional regulator PrpR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q97QZ2 0.000142 41 32 0 55 1 pezA Antitoxin PezA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P55681 0.000168 41 28 1 85 4 NGR_a01020 Uncharacterized HTH-type transcriptional regulator y4wC Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q5JF28 0.000231 41 38 0 54 3 TK0539 Putative HTH-type transcriptional regulatory protein TK0539 Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS10875
Feature type CDS
Gene -
Product helix-turn-helix transcriptional regulator
Location 2397040 - 2397342 (strand: -1)
Length 303 (nucleotides) / 100 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2443
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01381 Helix-turn-helix

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1396 Transcription (K) K Transcriptional regulator, contains XRE-family HTH domain

Protein Sequence

MNKKISKIVGARIKMLRQQHGMTGSELGALLGVSQQHQSRFENGECNIHVDVIYLLSYIFKVKLNYFFQDINDCFDQEGIAYKESYYHSETIVEKCELWR

Flanking regions ( +/- flanking 50bp)

TGAGTGATAATAATATATTTTTCGATATGGTTTTGTCATTCGAGGCGATTATGAATAAAAAAATATCAAAGATAGTTGGCGCAAGAATAAAAATGTTAAGACAACAACATGGTATGACGGGTAGTGAGCTTGGTGCTTTATTAGGAGTAAGCCAGCAACATCAATCACGCTTTGAAAATGGGGAGTGCAATATTCATGTGGATGTAATTTACTTATTATCTTATATTTTTAAAGTTAAATTAAATTATTTTTTTCAGGATATAAATGATTGTTTTGATCAAGAAGGAATAGCCTATAAAGAAAGTTATTATCATTCTGAGACGATTGTCGAAAAGTGTGAACTTTGGCGCTAGTTAATATGATGCCTAACAGACTGATTAGGCATCATATTTTGGTTTTTATT