Homologs in group_879

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04520 FBDBKF_04520 85.6 Morganella morganii S1 speA biosynthetic arginine decarboxylase
EHELCC_05810 EHELCC_05810 85.6 Morganella morganii S2 speA biosynthetic arginine decarboxylase
NLDBIP_06130 NLDBIP_06130 85.6 Morganella morganii S4 speA biosynthetic arginine decarboxylase
LHKJJB_03010 LHKJJB_03010 85.6 Morganella morganii S3 speA biosynthetic arginine decarboxylase
HKOGLL_06485 HKOGLL_06485 85.6 Morganella morganii S5 speA biosynthetic arginine decarboxylase
F4V73_RS08960 F4V73_RS08960 86.1 Morganella psychrotolerans speA biosynthetic arginine decarboxylase

Distribution of the homologs in the orthogroup group_879

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_879

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F1A4 0.0 1322 100 0 635 3 speA Biosynthetic arginine decarboxylase Proteus mirabilis (strain HI4320)
Q7N121 0.0 1159 87 0 634 3 speA Biosynthetic arginine decarboxylase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8ZHG8 0.0 1071 80 1 634 3 speA Biosynthetic arginine decarboxylase Yersinia pestis
B5XUB1 0.0 1066 80 1 634 3 speA Biosynthetic arginine decarboxylase Klebsiella pneumoniae (strain 342)
P21170 0.0 1065 79 1 634 1 speA Biosynthetic arginine decarboxylase Escherichia coli (strain K12)
Q8FE34 0.0 1064 79 1 634 3 speA Biosynthetic arginine decarboxylase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XCX9 0.0 1064 79 1 634 3 speA Biosynthetic arginine decarboxylase Escherichia coli O157:H7
Q83Q93 0.0 1061 79 1 634 3 speA Biosynthetic arginine decarboxylase Shigella flexneri
B1LDE8 0.0 1061 79 1 634 3 speA Biosynthetic arginine decarboxylase Escherichia coli (strain SMS-3-5 / SECEC)
B5YQD6 0.0 1061 79 1 634 3 speA Biosynthetic arginine decarboxylase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P60659 0.0 1061 79 1 634 3 speA Biosynthetic arginine decarboxylase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P60658 0.0 1061 79 1 634 3 speA Biosynthetic arginine decarboxylase Salmonella typhi
Q0T0V3 0.0 1060 79 1 634 3 speA Biosynthetic arginine decarboxylase Shigella flexneri serotype 5b (strain 8401)
B4TV55 0.0 1059 79 1 634 3 speA Biosynthetic arginine decarboxylase Salmonella schwarzengrund (strain CVM19633)
A9N4N1 0.0 1059 79 1 634 3 speA Biosynthetic arginine decarboxylase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T5J3 0.0 1059 79 1 634 3 speA Biosynthetic arginine decarboxylase Salmonella newport (strain SL254)
B4THH1 0.0 1059 79 1 634 3 speA Biosynthetic arginine decarboxylase Salmonella heidelberg (strain SL476)
Q57K30 0.0 1059 79 1 634 3 speA Biosynthetic arginine decarboxylase Salmonella choleraesuis (strain SC-B67)
B5F5L1 0.0 1059 79 1 634 3 speA Biosynthetic arginine decarboxylase Salmonella agona (strain SL483)
B5FUJ7 0.0 1056 79 1 634 3 speA Biosynthetic arginine decarboxylase Salmonella dublin (strain CT_02021853)
C4K6F4 0.0 942 70 1 634 3 speA Biosynthetic arginine decarboxylase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q9CL60 0.0 906 67 1 626 3 speA Biosynthetic arginine decarboxylase Pasteurella multocida (strain Pm70)
Q9K0U3 0.0 874 66 1 626 3 speA Biosynthetic arginine decarboxylase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JT25 0.0 872 66 1 626 3 speA Biosynthetic arginine decarboxylase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8EFU5 0.0 746 57 3 638 3 speA Biosynthetic arginine decarboxylase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A0KVN8 0.0 746 57 3 638 3 speA Biosynthetic arginine decarboxylase Shewanella sp. (strain ANA-3)
Q0HW78 0.0 744 57 3 638 3 speA Biosynthetic arginine decarboxylase Shewanella sp. (strain MR-7)
Q0HJY2 0.0 744 57 3 638 3 speA Biosynthetic arginine decarboxylase Shewanella sp. (strain MR-4)
A1RKK8 0.0 741 56 3 638 3 speA Biosynthetic arginine decarboxylase Shewanella sp. (strain W3-18-1)
A4Y5Y9 0.0 741 56 3 638 3 speA Biosynthetic arginine decarboxylase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1TY02 0.0 741 56 5 641 3 speA Biosynthetic arginine decarboxylase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A8FWJ3 0.0 740 56 3 638 3 speA Biosynthetic arginine decarboxylase Shewanella sediminis (strain HAW-EB3)
A9KY70 0.0 739 56 3 638 3 speA Biosynthetic arginine decarboxylase Shewanella baltica (strain OS195)
Q083L6 0.0 738 57 3 638 3 speA Biosynthetic arginine decarboxylase Shewanella frigidimarina (strain NCIMB 400)
A6WM65 0.0 737 56 3 638 3 speA Biosynthetic arginine decarboxylase Shewanella baltica (strain OS185)
A3D3G2 0.0 737 56 3 638 3 speA Biosynthetic arginine decarboxylase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EAI2 0.0 737 56 3 638 3 speA Biosynthetic arginine decarboxylase Shewanella baltica (strain OS223)
B8CR70 0.0 734 56 3 638 3 speA Biosynthetic arginine decarboxylase Shewanella piezotolerans (strain WP3 / JCM 13877)
B1KRD4 0.0 733 57 3 626 3 speA Biosynthetic arginine decarboxylase Shewanella woodyi (strain ATCC 51908 / MS32)
B0TQX3 0.0 731 56 3 627 3 speA Biosynthetic arginine decarboxylase Shewanella halifaxensis (strain HAW-EB4)
Q12LW6 0.0 726 55 3 638 3 speA Biosynthetic arginine decarboxylase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A8H5G3 0.0 724 56 3 627 3 speA Biosynthetic arginine decarboxylase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A3QDD8 0.0 723 56 3 626 3 speA Biosynthetic arginine decarboxylase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q7MK24 0.0 723 55 4 631 1 speA Biosynthetic arginine decarboxylase Vibrio vulnificus (strain YJ016)
Q8DA54 0.0 723 55 4 631 3 speA Biosynthetic arginine decarboxylase Vibrio vulnificus (strain CMCP6)
Q87JS8 0.0 717 55 4 631 3 speA Biosynthetic arginine decarboxylase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A1S712 0.0 709 54 3 638 3 speA Biosynthetic arginine decarboxylase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A0KIP8 0.0 703 54 4 637 3 speA Biosynthetic arginine decarboxylase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q9KLD1 0.0 701 54 4 631 3 speA Biosynthetic arginine decarboxylase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A4SPD6 0.0 697 54 4 637 3 speA Biosynthetic arginine decarboxylase Aeromonas salmonicida (strain A449)
C4L9A9 0.0 679 53 4 628 3 speA Biosynthetic arginine decarboxylase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q0ACK8 0.0 607 51 8 637 3 speA Biosynthetic arginine decarboxylase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q8PFQ5 0.0 566 46 7 637 3 speA Biosynthetic arginine decarboxylase Xanthomonas axonopodis pv. citri (strain 306)
Q8P448 0.0 560 46 7 637 3 speA Biosynthetic arginine decarboxylase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8A2B1 0.0 550 45 11 637 3 speA Biosynthetic arginine decarboxylase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q7NU27 0.0 546 46 6 621 3 speA Biosynthetic arginine decarboxylase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q87VU3 0.0 545 45 8 629 3 speA Biosynthetic arginine decarboxylase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A6L012 0.0 544 45 13 640 3 speA Biosynthetic arginine decarboxylase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q9HUX1 0.0 542 46 7 626 3 speA Biosynthetic arginine decarboxylase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q64ZT8 0.0 541 45 11 637 3 speA Biosynthetic arginine decarboxylase Bacteroides fragilis (strain YCH46)
Q5LIQ3 0.0 541 45 11 637 3 speA Biosynthetic arginine decarboxylase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q87F25 0.0 539 45 7 627 3 speA Biosynthetic arginine decarboxylase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6M1 0.0 539 45 7 627 3 speA Biosynthetic arginine decarboxylase Xylella fastidiosa (strain M23)
Q9PH02 0.0 539 45 7 627 3 speA Biosynthetic arginine decarboxylase Xylella fastidiosa (strain 9a5c)
B0U1H6 0.0 538 45 7 627 3 speA Biosynthetic arginine decarboxylase Xylella fastidiosa (strain M12)
Q88QC7 0.0 538 45 8 629 3 speA Biosynthetic arginine decarboxylase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8YRP3 1.36e-165 492 40 9 632 3 speA Biosynthetic arginine decarboxylase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7NE10 3.59e-165 489 40 9 649 3 speA Biosynthetic arginine decarboxylase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q7UTS2 1.22e-164 489 41 11 658 3 speA Biosynthetic arginine decarboxylase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q8DHY6 2.04e-163 485 41 10 635 3 speA Biosynthetic arginine decarboxylase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A1AS90 4.63e-160 476 39 8 636 3 speA Biosynthetic arginine decarboxylase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
P74576 3.06e-158 474 41 15 652 3 speA1 Biosynthetic arginine decarboxylase 1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B5EIW4 3.54e-157 469 39 9 636 3 speA Biosynthetic arginine decarboxylase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
C6E3V4 1.1e-156 468 38 9 636 3 speA Biosynthetic arginine decarboxylase Geobacter sp. (strain M21)
B9M6H6 7.28e-155 463 39 7 632 3 speA Biosynthetic arginine decarboxylase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A5GB52 1.01e-154 462 39 9 636 3 speA Biosynthetic arginine decarboxylase Geotalea uraniireducens (strain Rf4)
B3EAF3 4.79e-151 453 39 9 636 3 speA Biosynthetic arginine decarboxylase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q39X78 2.01e-150 451 38 9 636 3 speA Biosynthetic arginine decarboxylase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A0A4W3 2.39e-149 449 38 7 632 3 speA Biosynthetic arginine decarboxylase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
P72587 1.41e-147 445 38 12 643 3 speA2 Biosynthetic arginine decarboxylase 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A3PA96 4.11e-146 441 36 11 636 3 speA Biosynthetic arginine decarboxylase Prochlorococcus marinus (strain MIT 9301)
Q31DD8 3.59e-145 439 36 11 636 3 speA Biosynthetic arginine decarboxylase Prochlorococcus marinus (strain MIT 9312)
A2BNH3 4.8e-145 438 36 11 636 3 speA Biosynthetic arginine decarboxylase Prochlorococcus marinus (strain AS9601)
A8G243 9.77e-145 437 36 11 636 3 speA Biosynthetic arginine decarboxylase Prochlorococcus marinus (strain MIT 9215)
A2BU00 9.88e-145 437 35 10 635 3 speA Biosynthetic arginine decarboxylase Prochlorococcus marinus (strain MIT 9515)
Q9RXR4 1.34e-144 437 37 10 635 3 speA Biosynthetic arginine decarboxylase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q7U3S0 9.08e-144 435 38 10 634 3 speA Biosynthetic arginine decarboxylase Parasynechococcus marenigrum (strain WH8102)
Q7V3M9 2.98e-142 431 35 8 633 3 speA Biosynthetic arginine decarboxylase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A5GWM2 6.47e-141 427 37 6 629 3 speA Biosynthetic arginine decarboxylase Synechococcus sp. (strain RCC307)
A2CDK1 2.81e-138 421 37 10 639 3 speA Biosynthetic arginine decarboxylase Prochlorococcus marinus (strain MIT 9303)
Q7TUJ9 6.35e-135 412 38 7 588 3 speA Biosynthetic arginine decarboxylase Prochlorococcus marinus (strain MIT 9313)
Q7VEG4 1.87e-130 400 34 6 632 3 speA Biosynthetic arginine decarboxylase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
O23141 2.17e-122 382 36 14 613 1 ADC2 Arginine decarboxylase 2 Arabidopsis thaliana
O82475 3.25e-120 376 35 17 620 2 ADC1 Arginine decarboxylase Brassica juncea
A0A1S3WYR7 1.18e-118 372 35 14 616 3 ADC1B Arginine decarboxylase 1B, chloroplastic Nicotiana tabacum
Q9SI64 5.62e-118 370 36 15 606 1 ADC1 Arginine decarboxylase 1, chloroplastic Arabidopsis thaliana
A0A1S3YCW2 1.71e-117 370 35 14 618 1 ADC1A Arginine decarboxylase 1A, chloroplastic Nicotiana tabacum
Q39827 2.5e-117 368 36 14 609 2 None Arginine decarboxylase Glycine max
Q43075 2.92e-115 363 35 16 614 2 None Arginine decarboxylase Pisum sativum
Q9SNN0 4.62e-112 355 35 12 616 1 ADC1 Arginine decarboxylase 1 Oryza sativa subsp. japonica
Q96412 1.93e-110 351 34 13 622 2 ADC Arginine decarboxylase Dianthus caryophyllus
P49726 2.13e-106 333 36 13 520 2 None Arginine decarboxylase Solanum lycopersicum
P22220 3.66e-95 308 31 21 651 1 SPE1 Arginine decarboxylase Avena sativa
Q7XRA1 1.86e-92 301 31 19 647 1 ADC2 Arginine decarboxylase 2 Oryza sativa subsp. japonica
O81160 2.15e-84 273 39 11 431 3 SPE2 Arginine decarboxylase (Fragment) Theobroma cacao
Q9ZME5 1.13e-14 80 25 12 301 3 lysA Diaminopimelate decarboxylase Helicobacter pylori (strain J99 / ATCC 700824)
Q9PII5 8.9e-14 77 23 10 318 3 lysA Diaminopimelate decarboxylase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B4XMC6 1.88e-13 76 25 6 209 1 lysA Diaminopimelate decarboxylase Helicobacter pylori
P56129 7.92e-13 74 24 6 209 3 lysA Diaminopimelate decarboxylase Helicobacter pylori (strain ATCC 700392 / 26695)
Q9Z661 8.7e-12 71 27 14 315 3 lysA Diaminopimelate decarboxylase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
P19572 1.32e-09 64 25 11 304 3 lysA Diaminopimelate decarboxylase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q58497 5.13e-09 62 25 13 310 1 lysA Diaminopimelate decarboxylase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O29458 7.06e-09 62 25 12 275 3 lysA Diaminopimelate decarboxylase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O69203 7.32e-09 62 28 10 269 3 lysA Diaminopimelate decarboxylase Actinosynnema pretiosum subsp. auranticum
Q94A94 7.53e-09 62 23 13 330 1 LYSA2 Diaminopimelate decarboxylase 2, chloroplastic Arabidopsis thaliana
Q6ZG77 1.35e-08 61 23 11 297 2 LYSA Probable diaminopimelate decarboxylase, chloroplastic Oryza sativa subsp. japonica
P44316 1.64e-08 60 24 11 295 3 lysA Diaminopimelate decarboxylase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O05321 2.29e-08 60 24 12 302 3 lysA Diaminopimelate decarboxylase Pseudomonas fluorescens
Q8A800 2.67e-08 60 22 12 333 3 lysA Diaminopimelate decarboxylase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
O67262 7.53e-08 58 30 3 114 1 lysA Diaminopimelate decarboxylase Aquifex aeolicus (strain VF5)
Q9KVL7 8.08e-08 58 25 10 297 1 lysA Diaminopimelate decarboxylase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8RQM6 9.69e-08 58 28 11 239 3 lysA Diaminopimelate decarboxylase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q949X7 1.21e-07 58 23 11 295 1 LYSA1 Diaminopimelate decarboxylase 1, chloroplastic Arabidopsis thaliana
P09890 2.87e-07 57 26 7 239 1 lysA Diaminopimelate decarboxylase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q55484 9.35e-07 55 26 4 167 3 lysA Diaminopimelate decarboxylase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9JWA6 9.46e-07 55 23 11 297 3 lysA Diaminopimelate decarboxylase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q2G1M6 7.36e-06 52 21 11 295 1 sbnH 2-[(L-alanin-3-ylcarbamoyl)methyl]-2-hydroxybutanedioate decarboxylase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9JXM2 1.43e-05 51 23 11 299 3 lysA Diaminopimelate decarboxylase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q2A5D5 3.85e-05 50 24 9 201 3 lysA Diaminopimelate decarboxylase Francisella tularensis subsp. holarctica (strain LVS)
Q9X5M1 0.000133 48 25 11 294 3 lysA Diaminopimelate decarboxylase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9RTK2 0.000488 46 25 13 288 3 lysA Diaminopimelate decarboxylase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P9WIU7 0.000531 46 24 8 256 1 lysA Diaminopimelate decarboxylase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIU6 0.000531 46 24 8 256 3 lysA Diaminopimelate decarboxylase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5M5 0.000531 46 24 8 256 3 lysA Diaminopimelate decarboxylase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O50657 0.000731 46 23 9 259 1 ldc Lysine/ornithine decarboxylase Selenomonas ruminantium

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS10315
Feature type CDS
Gene speA
Product biosynthetic arginine decarboxylase
Location 2261381 - 2263288 (strand: -1)
Length 1908 (nucleotides) / 635 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_879
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02784 Pyridoxal-dependent decarboxylase, pyridoxal binding domain
PF17810 Arginine decarboxylase helical bundle domain
PF17944 Arginine decarboxylase C-terminal helical extension

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1166 Amino acid transport and metabolism (E) E Arginine decarboxylase (spermidine biosynthesis)

Protein Sequence

MNDNIARKMQQTYNITYWGGGYYCANNRGNISVCPNPDVPEATLDLTELVKQVQEEHSHLRLPALFCFPQILQHRLRSINAAFHRARESYGYKGDYFLVYPIKVNQQRRVIESLINAGEPLGLEAGSKAELMAVLAHANMTSSVIVCNGYKDREYIRLALTGEKLGHKVFLVIEKMSEIKMVLEEAERLEVIPRLGVRARLASQGSGKWQASGGEKSKFGLAATQVLQLIDTLRQAGRLDSLQLLHFHLGSQMANIRDIATGVRESARFYVELHKLGVNIQYFDVGGGLGVDYEGTRSQSDCSVNYGLNEYANNVIWAIGDACDENELPHPTVITESGRALTAHHTVLISNVIGVERNEFTAITPPAEDAPRPIASLWETWEEMQTKGNSRSLREWLHDSQLDLHDVHTQYVHGMLSLTERAWAEELYLNICRHIQYDLDPSNRAHRPIIDELQERMSDKFYVNFSLFQSLPDAWGIDQLFPVLPIEGLDKPLDRRAVLLDITCDSDGIIDHYVDGDGVETTMPMPAYDPEYPPMIGFFMVGAYQEILGNMHNLFGDTAAVDVYLDEKGNLTYQLSEEGDTVADMLQYVKLNPAVLLERFRTQVKNAQLDKALQEQFLTEFESGLYGYTYLEEEE

Flanking regions ( +/- flanking 50bp)

TACTATAGTGACAGGCAAGGTATAAACTCATACTCCCTAAGGAGAATGTCATGAATGATAACATCGCTCGTAAGATGCAACAGACTTATAACATCACATATTGGGGGGGAGGATACTACTGCGCGAATAATCGCGGCAATATTAGTGTTTGCCCAAATCCTGATGTGCCTGAAGCAACGCTGGATTTAACAGAATTAGTTAAGCAAGTACAAGAAGAGCATTCACATTTACGCCTTCCTGCGCTGTTTTGTTTTCCACAAATTTTACAGCACCGTTTGCGCTCAATTAATGCCGCTTTTCATCGTGCACGTGAGTCTTATGGCTACAAAGGGGATTACTTTTTAGTTTATCCAATTAAAGTCAATCAACAGCGTCGTGTGATTGAATCGCTAATTAATGCTGGAGAGCCATTAGGATTAGAAGCTGGCTCTAAAGCTGAATTAATGGCAGTGCTTGCTCATGCCAACATGACCAGTTCGGTGATTGTTTGTAATGGTTACAAAGATCGCGAATATATTCGTTTAGCCCTTACAGGGGAAAAGCTCGGTCATAAAGTGTTCTTGGTCATTGAAAAAATGTCTGAGATAAAAATGGTACTTGAAGAAGCCGAACGTTTAGAAGTGATCCCCCGCTTAGGGGTTCGTGCTCGCCTTGCTTCTCAAGGCTCCGGTAAATGGCAAGCCAGTGGGGGTGAAAAATCAAAATTCGGCCTTGCTGCAACACAAGTACTACAACTGATTGATACGCTACGCCAAGCTGGTCGTTTAGATAGTTTGCAGTTATTGCATTTTCACCTTGGATCACAGATGGCTAATATCCGTGATATTGCGACAGGTGTGCGTGAATCAGCCCGTTTTTATGTTGAGCTACATAAGTTAGGGGTCAATATTCAGTATTTTGATGTTGGTGGTGGCTTGGGCGTTGATTATGAAGGTACGCGCTCACAATCTGATTGCTCCGTTAACTATGGCCTGAATGAATACGCTAATAACGTTATTTGGGCGATTGGTGATGCTTGTGATGAAAATGAATTACCTCATCCAACCGTTATTACAGAATCAGGTCGAGCATTAACTGCGCATCATACGGTGCTTATTTCCAATGTTATTGGTGTTGAACGTAACGAATTTACTGCAATCACGCCGCCGGCCGAAGATGCTCCAAGACCTATCGCAAGCCTTTGGGAAACATGGGAAGAGATGCAAACCAAAGGGAATAGCCGTTCATTGCGTGAATGGCTGCATGATAGCCAATTAGATTTACATGATGTCCATACTCAATATGTACACGGTATGTTAAGTCTGACAGAGCGTGCATGGGCGGAAGAGTTATATCTGAATATCTGTCGTCATATTCAATATGATTTAGATCCAAGTAATCGAGCCCATCGCCCGATTATTGATGAACTGCAAGAGCGTATGTCAGATAAGTTCTATGTCAACTTTTCACTGTTCCAGTCATTGCCTGATGCTTGGGGAATTGATCAATTATTCCCTGTATTACCAATTGAAGGTTTAGATAAACCGCTCGATCGCCGTGCTGTATTGCTAGATATCACTTGTGATTCAGATGGTATTATCGATCATTATGTCGATGGTGATGGGGTCGAAACCACGATGCCAATGCCAGCTTATGATCCTGAATATCCACCAATGATTGGCTTCTTTATGGTGGGGGCGTATCAGGAAATCCTTGGAAATATGCATAACTTATTTGGTGATACAGCTGCTGTTGATGTTTATCTTGATGAGAAAGGCAATCTTACTTATCAGTTGAGTGAAGAGGGTGATACCGTTGCGGATATGCTTCAATATGTAAAACTTAATCCTGCGGTATTGTTGGAGCGCTTCCGTACTCAAGTGAAAAATGCACAGTTAGATAAAGCACTCCAAGAGCAGTTCCTAACTGAATTTGAAAGTGGCTTATACGGTTATACCTATCTGGAAGAAGAGGAGTAATGCTTACTTCCTAATGCAGAGTGGTGTTGATACATCACTCTTTATCTATC