Homologs in group_189

Help

8 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08355 FBDBKF_08355 23.0 Morganella morganii S1 xerC tyrosine recombinase XerC
EHELCC_13170 EHELCC_13170 23.0 Morganella morganii S2 xerC tyrosine recombinase XerC
NLDBIP_13510 NLDBIP_13510 23.0 Morganella morganii S4 xerC tyrosine recombinase XerC
LHKJJB_13045 LHKJJB_13045 23.0 Morganella morganii S3 xerC tyrosine recombinase XerC
HKOGLL_11985 HKOGLL_11985 23.0 Morganella morganii S5 xerC tyrosine recombinase XerC
F4V73_RS09555 F4V73_RS09555 21.8 Morganella psychrotolerans xerC tyrosine recombinase XerC
PMI_RS05890 PMI_RS05890 25.0 Proteus mirabilis HI4320 - tyrosine-type recombinase/integrase
PMI_RS16605 PMI_RS16605 24.9 Proteus mirabilis HI4320 xerC tyrosine recombinase XerC

Distribution of the homologs in the orthogroup group_189

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_189

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P36932 1.29e-129 376 56 0 324 1 int Integrase Escherichia phage P2
P06723 7.38e-75 236 39 4 334 3 int Integrase Escherichia phage 186
Q38067 2.22e-58 194 36 10 331 3 None Putative integrase Pseudomonas phage Pf1
P21442 1.21e-52 179 33 6 321 1 int Integrase Haemophilus phage HP1 (strain HP1c1)
Q9KA25 6.04e-18 85 28 9 283 3 xerC Tyrosine recombinase XerC Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8RA66 1.16e-12 71 28 9 239 3 xerC Tyrosine recombinase XerC Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B5YFZ8 2.99e-12 69 28 8 227 3 xerC Tyrosine recombinase XerC Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
P44630 3.49e-12 69 25 11 292 3 xerD Tyrosine recombinase XerD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q92A53 4.42e-12 68 27 8 233 3 xerD Tyrosine recombinase XerD Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8YJD9 1.48e-11 67 29 13 231 3 xerC Tyrosine recombinase XerC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q1RHT1 1.48e-11 67 26 9 242 3 xerD Tyrosine recombinase XerD Rickettsia bellii (strain RML369-C)
Q7ZAN7 1.49e-11 67 29 12 231 3 xerC Tyrosine recombinase XerC Brucella suis biovar 1 (strain 1330)
A8F7B4 2.51e-11 66 29 11 231 3 Tlet_1492 Tyrosine recombinase Tlet_1492 Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q4UM01 2.77e-11 67 26 9 245 3 xerD Tyrosine recombinase XerD Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P46352 3.03e-11 66 27 9 257 3 xerD Tyrosine recombinase XerD Bacillus subtilis (strain 168)
Q7ZAM5 6.5e-11 65 26 6 248 3 xerC Tyrosine recombinase XerC Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q71Y59 1.16e-10 65 26 10 262 3 xerD Tyrosine recombinase XerD Listeria monocytogenes serotype 4b (strain F2365)
Q65JN5 1.24e-10 65 25 6 247 3 xerC Tyrosine recombinase XerC Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8Y5V0 1.25e-10 64 26 10 262 3 xerD Tyrosine recombinase XerD Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8UC70 2.11e-10 64 25 9 232 3 xerC Tyrosine recombinase XerC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9HXQ6 2.12e-10 64 25 6 228 3 xerD Tyrosine recombinase XerD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7IFN3 2.15e-10 63 25 10 290 3 THA_404 Tyrosine recombinase THA_404 Thermosipho africanus (strain TCF52B)
Q980D9 2.33e-10 63 34 4 138 1 xerA Tyrosine recombinase XerA Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q9Z6N5 2.86e-10 63 28 9 246 3 xerD Tyrosine recombinase XerD Chlamydia pneumoniae
Q7ZAM7 2.96e-10 63 28 9 250 3 xerD Tyrosine recombinase XerD Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72SA5 2.96e-10 63 28 9 250 3 xerD Tyrosine recombinase XerD Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q9CPF0 3.32e-10 63 25 10 283 3 xerD Tyrosine recombinase XerD Pasteurella multocida (strain Pm70)
P9WF33 3.36e-10 63 28 8 218 1 xerD Tyrosine recombinase XerD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WF32 3.36e-10 63 28 8 218 3 xerD Tyrosine recombinase XerD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67637 3.36e-10 63 28 8 218 3 xerD Tyrosine recombinase XerD Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q92IC9 4.81e-10 63 25 9 259 3 xerD Tyrosine recombinase XerD Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9KCP0 7.03e-10 62 27 10 247 3 xerD Tyrosine recombinase XerD Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q7ZAM3 8.59e-10 62 28 9 226 3 xerD Tyrosine recombinase XerD Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B7GGC7 8.85e-10 62 25 7 245 3 xerC Tyrosine recombinase XerC Anoxybacillus flavithermus (strain DSM 21510 / WK1)
P0A055 1.03e-09 63 26 8 253 3 tnpB Transposase B from transposon Tn554 Staphylococcus aureus
P0A054 1.03e-09 63 26 8 253 3 tnpB1 Transposase B from transposon Tn554 Staphylococcus aureus (strain N315)
P0A053 1.03e-09 63 26 8 253 3 tnpB1 Transposase B from transposon Tn554 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A1SQX0 1.67e-09 61 26 7 222 3 xerC Tyrosine recombinase XerC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q88MV0 1.83e-09 61 24 10 287 3 xerD Tyrosine recombinase XerD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9ZDG8 3.37e-09 60 26 8 238 3 xerD Tyrosine recombinase XerD Rickettsia prowazekii (strain Madrid E)
P0A0P1 6.64e-09 59 25 7 242 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain MW2)
P0A0P2 6.64e-09 59 25 7 242 3 xerD Tyrosine recombinase XerD Staphylococcus aureus
Q6G967 6.64e-09 59 25 7 242 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain MSSA476)
Q6GGK1 6.64e-09 59 25 7 242 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain MRSA252)
P0A0P0 6.64e-09 59 25 7 242 1 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain N315)
P0A0N9 6.64e-09 59 25 7 242 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFS5 6.64e-09 59 25 7 242 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain COL)
Q89X68 6.7e-09 59 27 5 143 3 xerC Tyrosine recombinase XerC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P37375 6.89e-09 60 25 5 257 3 tnpB Transposase B from transposon PsiTn554 Staphylococcus aureus
Q7ZAP1 7.31e-09 59 28 8 187 3 xerD Tyrosine recombinase XerD Bifidobacterium longum (strain NCC 2705)
Q92ME3 8.46e-09 59 24 10 262 3 xerD Tyrosine recombinase XerD Rhizobium meliloti (strain 1021)
Q3SVJ8 1.11e-08 59 28 4 153 3 xerC Tyrosine recombinase XerC Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q2NB52 1.16e-08 58 27 9 213 3 xerC Tyrosine recombinase XerC Erythrobacter litoralis (strain HTCC2594)
Q9JV76 1.32e-08 58 26 7 228 3 xerD Tyrosine recombinase XerD Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q97HE5 1.63e-08 58 26 8 212 3 CA_C2066 Putative tyrosine recombinase CA_C2066 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B8I9N8 1.73e-08 58 24 15 291 3 xerC Tyrosine recombinase XerC Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
A8FD78 2.07e-08 58 25 8 249 3 xerC Tyrosine recombinase XerC Bacillus pumilus (strain SAFR-032)
Q92LK1 2.16e-08 58 31 5 142 3 xerC Tyrosine recombinase XerC Rhizobium meliloti (strain 1021)
Q9K068 2.4e-08 58 26 7 228 3 xerD Tyrosine recombinase XerD Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8ZHK1 2.64e-08 57 24 8 270 3 xerD Tyrosine recombinase XerD Yersinia pestis
Q49890 3.41e-08 57 25 9 217 3 xerD Tyrosine recombinase XerD Mycobacterium leprae (strain TN)
Q0VM16 3.67e-08 57 27 7 225 3 xerC Tyrosine recombinase XerC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q8KET0 3.74e-08 57 24 11 275 3 xerD Tyrosine recombinase XerD Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8NQL5 3.81e-08 57 25 12 284 3 xerD Tyrosine recombinase XerD Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q98ED9 5.63e-08 57 30 6 143 3 xerC Tyrosine recombinase XerC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B3E1H7 9.44e-08 56 26 11 233 3 xerC Tyrosine recombinase XerC Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q8P550 1.04e-07 56 22 6 245 3 xerC Tyrosine recombinase XerC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RNK3 1.04e-07 56 22 6 245 3 xerC Tyrosine recombinase XerC Xanthomonas campestris pv. campestris (strain B100)
Q4UYY0 1.04e-07 56 22 6 245 3 xerC Tyrosine recombinase XerC Xanthomonas campestris pv. campestris (strain 8004)
Q7ZAN6 1.19e-07 55 26 10 247 3 xerD Tyrosine recombinase XerD Brucella suis biovar 1 (strain 1330)
A5UE41 1.2e-07 55 26 8 232 3 xerC Tyrosine recombinase XerC Haemophilus influenzae (strain PittEE)
Q8TZV9 1.26e-07 55 29 8 224 3 xerA Tyrosine recombinase XerA Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P44818 1.37e-07 55 26 8 232 1 xerC Tyrosine recombinase XerC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7VPN8 1.38e-07 55 25 9 242 3 xerD Tyrosine recombinase XerD Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7MNQ0 1.66e-07 55 24 10 290 3 xerD Tyrosine recombinase XerD Vibrio vulnificus (strain YJ016)
Q7ZAJ0 1.66e-07 55 24 10 290 3 xerD Tyrosine recombinase XerD Vibrio vulnificus (strain CMCP6)
B3QM22 1.86e-07 55 22 8 254 3 xerC Tyrosine recombinase XerC Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
A0LEB8 2.11e-07 55 25 10 269 3 xerC Tyrosine recombinase XerC Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B8DG54 2.29e-07 55 24 8 271 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serotype 4a (strain HCC23)
Q7ZAN4 2.36e-07 55 23 11 285 3 xerD Tyrosine recombinase XerD Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q4QMP0 2.61e-07 55 26 8 232 3 xerC Tyrosine recombinase XerC Haemophilus influenzae (strain 86-028NP)
A5URM3 2.65e-07 55 30 7 140 3 xerC Tyrosine recombinase XerC Roseiflexus sp. (strain RS-1)
Q03FK2 2.79e-07 54 25 9 242 3 xerC Tyrosine recombinase XerC Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
P55632 2.97e-07 54 27 7 214 3 NGR_a01870 Putative integrase/recombinase y4qK Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B0UNY7 3.02e-07 54 30 6 143 3 xerC Tyrosine recombinase XerC Methylobacterium sp. (strain 4-46)
B2U7W2 3.14e-07 54 23 7 255 3 xerC Tyrosine recombinase XerC Ralstonia pickettii (strain 12J)
O84351 3.2e-07 54 27 8 242 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
B0BBY1 3.2e-07 54 27 8 242 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
Q3KM11 3.2e-07 54 27 8 242 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
B0B7R6 3.2e-07 54 27 8 242 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
B3GZ58 3.66e-07 54 24 11 268 3 xerC Tyrosine recombinase XerC Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q48733 4.4e-07 54 27 11 239 3 xerC Tyrosine recombinase XerC Lactobacillus leichmannii
Q9A437 4.79e-07 54 23 9 271 3 xerD Tyrosine recombinase XerD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B9DPG4 5.11e-07 53 24 6 229 3 xerC Tyrosine recombinase XerC Staphylococcus carnosus (strain TM300)
O59490 6.06e-07 53 26 9 256 3 xerA Tyrosine recombinase XerA Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
A8GXV3 6.35e-07 53 27 5 159 3 xerC Tyrosine recombinase XerC Rickettsia bellii (strain OSU 85-389)
Q98FX8 6.47e-07 53 24 9 283 3 xerD Tyrosine recombinase XerD Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q7NVH1 6.95e-07 53 26 9 243 3 xerC Tyrosine recombinase XerC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8YJP2 7.15e-07 53 26 10 247 3 xerD Tyrosine recombinase XerD Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q49XU5 7.33e-07 53 24 12 270 3 xerD Tyrosine recombinase XerD Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q93C64 7.53e-07 53 25 8 216 3 xerD Tyrosine recombinase XerD Lacticaseibacillus casei
P96629 7.75e-07 53 21 16 366 3 int ICEBs1 integrase Bacillus subtilis (strain 168)
B6IPE2 7.85e-07 53 29 5 139 3 xerC Tyrosine recombinase XerC Rhodospirillum centenum (strain ATCC 51521 / SW)
Q1RK56 7.91e-07 53 27 5 159 3 xerC Tyrosine recombinase XerC Rickettsia bellii (strain RML369-C)
B7VMD2 8.93e-07 53 25 7 236 3 xerC Tyrosine recombinase XerC Vibrio atlanticus (strain LGP32)
Q04A03 9.47e-07 53 27 9 219 3 xerC Tyrosine recombinase XerC Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G9V2 9.47e-07 53 27 9 219 3 xerC Tyrosine recombinase XerC Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
A0AI80 1.01e-06 53 24 8 276 3 xerC Tyrosine recombinase XerC Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q7ZAM0 1.02e-06 53 25 10 270 3 xerD Tyrosine recombinase XerD Shigella flexneri
P0A8P8 1.04e-06 53 24 11 292 1 xerD Tyrosine recombinase XerD Escherichia coli (strain K12)
P0A8P9 1.04e-06 53 24 11 292 3 xerD Tyrosine recombinase XerD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A2P6 1.08e-06 53 24 11 288 1 xerD Tyrosine recombinase XerD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2P7 1.08e-06 53 24 11 288 3 xerD Tyrosine recombinase XerD Salmonella typhi
A8GQ15 1.12e-06 53 28 4 139 3 xerC Tyrosine recombinase XerC Rickettsia akari (strain Hartford)
P0C122 1.16e-06 53 26 10 247 3 xerD Tyrosine recombinase XerD Brucella abortus biovar 1 (strain 9-941)
Q2YR40 1.16e-06 53 26 10 247 2 xerD Tyrosine recombinase XerD Brucella abortus (strain 2308)
Q7ZAJ2 1.21e-06 52 26 8 219 3 xerD Tyrosine recombinase XerD Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8X574 1.29e-06 52 23 10 288 3 xerD Tyrosine recombinase XerD Escherichia coli O157:H7
Q9PK47 1.35e-06 52 26 8 237 3 xerC Tyrosine recombinase XerC Chlamydia muridarum (strain MoPn / Nigg)
Q039E1 1.49e-06 52 24 9 241 3 xerC Tyrosine recombinase XerC Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WEA7 1.49e-06 52 24 9 241 3 xerC Tyrosine recombinase XerC Lacticaseibacillus casei (strain BL23)
A8F033 1.64e-06 52 24 12 289 3 xerC Tyrosine recombinase XerC Rickettsia canadensis (strain McKiel)
Q8Z3A8 1.68e-06 52 27 9 219 3 xerC Tyrosine recombinase XerC Salmonella typhi
A1AKP9 1.69e-06 52 27 9 219 3 xerC Tyrosine recombinase XerC Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
P55888 1.71e-06 52 27 9 219 3 xerC Tyrosine recombinase XerC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q87DI2 1.83e-06 52 24 7 218 3 xerC Tyrosine recombinase XerC Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2IA18 1.83e-06 52 24 7 218 3 xerC Tyrosine recombinase XerC Xylella fastidiosa (strain M23)
Q92C75 1.89e-06 52 23 7 271 3 xerC Tyrosine recombinase XerC Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q9PD96 1.97e-06 52 24 10 227 3 xerC Tyrosine recombinase XerC Xylella fastidiosa (strain 9a5c)
O35009 2.31e-06 50 28 4 158 3 yoeC Probable integrase/recombinase YoeC Bacillus subtilis (strain 168)
A5D2W6 2.32e-06 52 23 8 267 3 xerC Tyrosine recombinase XerC Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
C4K256 2.4e-06 52 28 4 138 3 xerC Tyrosine recombinase XerC Rickettsia peacockii (strain Rustic)
C3PLU8 2.51e-06 52 28 4 138 3 xerC Tyrosine recombinase XerC Rickettsia africae (strain ESF-5)
P39776 2.59e-06 52 23 7 239 1 xerC Tyrosine recombinase XerC Bacillus subtilis (strain 168)
O84872 2.67e-06 52 28 8 221 3 xerD Tyrosine recombinase XerD Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q720E4 2.79e-06 51 23 8 271 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serotype 4b (strain F2365)
C1L2I5 2.79e-06 51 23 8 271 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serotype 4b (strain CLIP80459)
Q5HP53 2.91e-06 51 26 8 219 3 xerD Tyrosine recombinase XerD Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q92G55 3.64e-06 51 28 4 138 3 xerC Tyrosine recombinase XerC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q8PPP9 3.81e-06 51 23 8 245 3 xerC Tyrosine recombinase XerC Xanthomonas axonopodis pv. citri (strain 306)
Q8Y7K0 3.84e-06 51 24 7 271 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q253S9 4.58e-06 51 25 11 254 3 xerC Tyrosine recombinase XerC Chlamydia felis (strain Fe/C-56)
Q7ZAK0 4.88e-06 51 28 2 114 3 xerC Tyrosine recombinase XerC Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8U9U6 5.4e-06 51 35 3 77 3 xerD Tyrosine recombinase XerD Agrobacterium fabrum (strain C58 / ATCC 33970)
A8GTV8 5.43e-06 50 28 4 138 3 xerC Tyrosine recombinase XerC Rickettsia rickettsii (strain Sheila Smith)
B0BVE6 5.43e-06 50 28 4 138 3 xerC Tyrosine recombinase XerC Rickettsia rickettsii (strain Iowa)
Q7ZAJ8 7.45e-06 50 23 11 290 3 xerD Tyrosine recombinase XerD Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0PA27 7.49e-06 50 32 4 145 1 xerH Tyrosine recombinase XerH Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9PL53 7.61e-06 50 27 8 219 3 xerD Tyrosine recombinase XerD Chlamydia muridarum (strain MoPn / Nigg)
B4SDZ2 7.73e-06 50 23 9 263 3 xerC Tyrosine recombinase XerC Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q4UJZ3 7.74e-06 50 27 4 138 3 xerC Tyrosine recombinase XerC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9KPE9 8.22e-06 50 25 10 270 3 xerD Tyrosine recombinase XerD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7MQB9 8.52e-06 50 25 12 284 3 xerC Tyrosine recombinase XerC Vibrio vulnificus (strain YJ016)
Q7ZAI9 8.52e-06 50 25 12 284 3 xerC Tyrosine recombinase XerC Vibrio vulnificus (strain CMCP6)
A8F2V6 9.28e-06 50 27 4 138 3 xerC Tyrosine recombinase XerC Rickettsia massiliae (strain Mtu5)
P0A052 9.37e-06 50 27 6 155 3 tnpA Transposase A from transposon Tn554 Staphylococcus aureus
P0A051 9.37e-06 50 27 6 155 3 tnpA1 Transposase A from transposon Tn554 Staphylococcus aureus (strain N315)
P0A050 9.37e-06 50 27 6 155 3 tnpA1 Transposase A from transposon Tn554 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5WAU7 1.15e-05 50 25 9 223 3 xerC Tyrosine recombinase XerC Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A6VQS4 1.17e-05 49 24 8 240 3 xerC Tyrosine recombinase XerC Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q5L6G3 1.26e-05 49 25 9 240 3 xerC Tyrosine recombinase XerC Chlamydia abortus (strain DSM 27085 / S26/3)
B0UWL5 1.34e-05 49 24 11 246 3 xerC Tyrosine recombinase XerC Histophilus somni (strain 2336)
Q88B11 1.62e-05 49 22 8 265 3 xerC Tyrosine recombinase XerC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8NNZ9 1.63e-05 49 27 4 136 3 xerC Tyrosine recombinase XerC Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q49X37 1.85e-05 49 24 8 231 3 xerC Tyrosine recombinase XerC Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B5YY58 2.04e-05 49 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X4T6 2.04e-05 49 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli O157:H7
Q8XWD0 2.24e-05 48 28 5 140 3 xerD Tyrosine recombinase XerD Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3YVF5 2.25e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Shigella sonnei (strain Ss046)
Q31UH7 2.25e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Shigella boydii serotype 4 (strain Sb227)
B2TUW7 2.25e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LU45 2.25e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LLY2 2.25e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli (strain SMS-3-5 / SECEC)
B6I4F2 2.25e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli (strain SE11)
B7NFB3 2.25e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8P6 2.25e-05 48 25 8 218 1 xerC Tyrosine recombinase XerC Escherichia coli (strain K12)
B1IW93 2.25e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8P7 2.25e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8A6R9 2.25e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli O9:H4 (strain HS)
B1XAH7 2.25e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli (strain K12 / DH10B)
C4ZZ74 2.25e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli (strain K12 / MC4100 / BW2952)
B7N2A1 2.25e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli O81 (strain ED1a)
B7NTD1 2.25e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7L968 2.25e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli (strain 55989 / EAEC)
B7M613 2.27e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli O8 (strain IAI1)
A7ZU16 2.27e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli O139:H28 (strain E24377A / ETEC)
Q7ZAL9 2.32e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Shigella flexneri
Q329Y7 2.32e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Shigella dysenteriae serotype 1 (strain Sd197)
Q48C04 2.35e-05 48 22 9 265 3 xerC Tyrosine recombinase XerC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q0SZ02 2.47e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Shigella flexneri serotype 5b (strain 8401)
Q5JHA3 2.64e-05 48 27 6 192 3 xerA Tyrosine recombinase XerA Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q1R4C3 2.68e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli (strain UTI89 / UPEC)
A1AHX9 2.68e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli O1:K1 / APEC
B7MH75 2.68e-05 48 25 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli O45:K1 (strain S88 / ExPEC)
Q823T9 2.72e-05 48 25 8 236 3 xerC Tyrosine recombinase XerC Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q8PCQ9 3.03e-05 48 45 0 51 3 xerD Tyrosine recombinase XerD Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q0TAR4 3.09e-05 48 25 9 221 3 xerC Tyrosine recombinase XerC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
C3LPX0 3.13e-05 48 26 9 219 3 xerC Tyrosine recombinase XerC Vibrio cholerae serotype O1 (strain M66-2)
Q9KVL4 3.13e-05 48 26 9 219 3 xerC Tyrosine recombinase XerC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4I4 3.13e-05 48 26 9 219 3 xerC Tyrosine recombinase XerC Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q4L6J7 3.2e-05 48 23 7 225 3 xerD Tyrosine recombinase XerD Staphylococcus haemolyticus (strain JCSC1435)
Q87KJ6 3.38e-05 48 25 8 236 3 xerC Tyrosine recombinase XerC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8D1K0 3.48e-05 48 25 8 223 3 xerC Tyrosine recombinase XerC Yersinia pestis
Q9V1P5 3.9e-05 48 27 2 115 1 xerA Tyrosine recombinase XerA Pyrococcus abyssi (strain GE5 / Orsay)
O31206 4.06e-05 48 25 10 251 1 xerD Tyrosine recombinase XerD Proteus mirabilis
Q9CKC2 4.23e-05 48 23 11 277 3 xerC Tyrosine recombinase XerC Pasteurella multocida (strain Pm70)
B7UNC8 4.32e-05 48 26 8 218 3 xerC Tyrosine recombinase XerC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q500B4 4.5e-05 48 22 9 265 3 xerC Tyrosine recombinase XerC Pseudomonas syringae pv. syringae (strain B728a)
Q8KBZ5 4.76e-05 48 20 8 274 3 xerC Tyrosine recombinase XerC Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q2YXL6 6.15e-05 47 22 8 231 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8Y3C8 7.45e-05 47 23 5 228 3 xerC1 Tyrosine recombinase XerC 1 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8VS06 7.47e-05 47 25 10 224 3 xerC Tyrosine recombinase XerC Pseudomonas fluorescens
B6YWN8 8.82e-05 47 42 0 47 3 xerA Tyrosine recombinase XerA Thermococcus onnurineus (strain NA1)
O26979 0.0001 47 48 0 37 3 xerA Tyrosine recombinase XerA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q9PDF4 0.000102 47 42 0 52 3 xerD Tyrosine recombinase XerD Xylella fastidiosa (strain 9a5c)
Q8XTL6 0.000102 47 44 0 47 3 xerC2 Tyrosine recombinase XerC 2 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A7N0V8 0.000119 47 25 8 236 3 xerC Tyrosine recombinase XerC Vibrio campbellii (strain ATCC BAA-1116)
B0KQ43 0.000124 46 24 9 223 3 xerC Tyrosine recombinase XerC Pseudomonas putida (strain GB-1)
O31207 0.000124 46 42 1 57 1 xerC Tyrosine recombinase XerC Proteus mirabilis
Q87DN0 0.000125 47 42 0 52 3 xerD Tyrosine recombinase XerD Xylella fastidiosa (strain Temecula1 / ATCC 700964)
A9B1E0 0.000176 46 39 1 66 3 xerC Tyrosine recombinase XerC Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
A8Z3T2 0.000179 46 22 8 231 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain USA300 / TCH1516)
A6QGF2 0.000179 46 22 8 231 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain Newman)
Q5HGI0 0.000179 46 22 8 231 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain COL)
Q2FZ30 0.000179 46 22 8 231 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHI6 0.000179 46 22 8 231 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain USA300)
Q7ZAJ4 0.000192 46 24 8 233 3 xerC Tyrosine recombinase XerC Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPU0 0.000192 46 24 8 233 3 xerC Tyrosine recombinase XerC Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8NWZ8 0.000196 46 42 0 50 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain MW2)
Q6G9W1 0.000196 46 42 0 50 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain MSSA476)
P67631 0.000196 46 42 0 50 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain N315)
P67630 0.000196 46 42 0 50 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X1M7 0.000196 46 42 0 50 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GHI3 0.000201 46 42 0 50 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain MRSA252)
A5ISD6 0.000205 46 42 0 50 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain JH9)
A6U170 0.000205 46 42 0 50 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain JH1)
Q9KJF6 0.000216 45 42 0 50 3 xerC Tyrosine recombinase XerC Staphylococcus aureus
Q02E82 0.000258 45 23 10 247 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V5H1 0.000258 45 23 10 247 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain LESB58)
C4ZGY6 0.000261 45 28 4 153 3 EUBREC_2677 Tyrosine recombinase EUBREC_2677 Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q4L5V4 0.000272 45 42 0 50 3 xerC Tyrosine recombinase XerC Staphylococcus haemolyticus (strain JCSC1435)
A7NFG3 0.000298 45 26 10 216 3 xerC Tyrosine recombinase XerC Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q89XW5 0.000304 45 37 1 54 3 xerD Tyrosine recombinase XerD Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9ZCE0 0.000311 45 25 6 160 3 xerC Tyrosine recombinase XerC Rickettsia prowazekii (strain Madrid E)
Q68VT2 0.00032 45 26 8 189 3 xerC Tyrosine recombinase XerC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P42540 0.000383 45 32 6 137 3 None Probable integrase/recombinase Acholeplasma phage L2
Q8PGR5 0.000397 45 43 0 51 3 xerD Tyrosine recombinase XerD Xanthomonas axonopodis pv. citri (strain 306)
A6VE54 0.000508 45 32 2 78 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain PA7)
O31087 0.00063 44 46 1 43 3 xerC Tyrosine recombinase XerC Serratia marcescens
B3DQV1 0.00068 44 41 0 46 3 xerC Tyrosine recombinase XerC Bifidobacterium longum (strain DJO10A)
Q51566 0.000689 44 41 1 43 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1D804 0.000721 44 40 0 47 3 xerC Tyrosine recombinase XerC Myxococcus xanthus (strain DK1622)
P59818 0.000721 44 40 0 47 3 xerC Tyrosine recombinase XerC Myxococcus xanthus
B7GQE1 0.000724 44 41 0 46 3 xerC Tyrosine recombinase XerC Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
Q2LT92 0.00075 44 47 0 38 3 xerC Tyrosine recombinase XerC Syntrophus aciditrophicus (strain SB)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09895
Feature type CDS
Gene -
Product tyrosine-type recombinase/integrase
Location 2145999 - 2146982 (strand: 1)
Length 984 (nucleotides) / 327 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_189
Orthogroup size 9
N. genomes 7

Actions

Genomic region

Domains

PF00589 Phage integrase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4974 Replication, recombination and repair (L) L Site-specific recombinase XerD

Protein Sequence

MTIKKLEDGRYEVDIRPTGRNGKRIRRKFNKKHEAIAFERYVMANHSKKEWGTKLKDIRPLDELVELWWNMFGKHSENGKSNYNNAMRVCKGMHSSNVSQVTSKSISFYQNERFAKGIKPSTINRELYAIRGIFSQLIKMGLYEAENPFIEAKKLKINASEMSYLTLDETRKLLANLEGDYYNIAVFCLSTGARWGEAMKLKREHIIENKVRFTYTKTRKARIVPISKELCDQICKGKKDLLFSSVSYQVFRKILKSVKPSLPDGQATHVLRHTFATHFMINGGSIITLQRILGHASLKQTMTYAHFAPDFLQDAIVNNPLKGGLSL

Flanking regions ( +/- flanking 50bp)

TTGTGAATTTATTGATTCACAAAGCCTTTCTACCATTGGAGAGCTTTCTTATGACAATTAAGAAACTTGAAGATGGTCGATATGAAGTGGACATTAGACCGACTGGACGTAATGGAAAACGGATCAGACGGAAATTTAATAAAAAACATGAAGCCATTGCCTTTGAACGTTATGTAATGGCCAATCACAGCAAAAAAGAATGGGGGACAAAATTAAAAGACATTCGCCCATTAGATGAACTCGTTGAGCTATGGTGGAACATGTTCGGTAAACATAGCGAGAACGGAAAATCTAACTACAACAATGCAATGCGTGTCTGTAAGGGTATGCATAGTAGCAATGTATCTCAAGTTACATCAAAAAGTATCTCATTTTATCAAAATGAGCGTTTTGCTAAGGGGATAAAACCCTCCACTATTAATCGAGAACTGTATGCTATACGAGGTATATTTTCTCAATTAATTAAAATGGGATTATATGAGGCTGAAAATCCCTTTATTGAGGCCAAGAAATTAAAAATAAATGCGAGTGAGATGTCTTACTTAACCCTTGATGAAACCCGAAAACTACTCGCTAATCTGGAAGGTGATTATTATAACATTGCCGTATTTTGTTTAAGTACGGGGGCTAGATGGGGCGAAGCAATGAAACTGAAACGAGAGCATATCATTGAAAACAAAGTGCGTTTTACTTACACTAAAACAAGAAAAGCGCGCATTGTCCCTATATCGAAAGAACTCTGCGATCAAATATGCAAAGGAAAAAAAGACCTCCTATTTTCCTCCGTTTCATATCAAGTATTTAGAAAAATACTAAAAAGTGTAAAACCTTCTTTGCCCGACGGACAAGCTACACATGTGTTGCGTCATACTTTCGCTACGCATTTCATGATCAACGGCGGTAGCATCATCACATTACAAAGAATTCTAGGGCATGCCAGTTTAAAACAAACGATGACCTATGCTCATTTTGCACCCGATTTCTTACAAGATGCGATTGTAAACAATCCATTAAAAGGAGGTCTCAGTTTATAGATAAAATTGTCCACAGAGCGACCACACTTGGTCGCTTTTCATCATTTTTT