Homologs in group_560

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01420 FBDBKF_01420 65.2 Morganella morganii S1 lepB signal peptidase I
EHELCC_00125 EHELCC_00125 65.2 Morganella morganii S2 lepB signal peptidase I
NLDBIP_03335 NLDBIP_03335 65.2 Morganella morganii S4 lepB signal peptidase I
LHKJJB_04850 LHKJJB_04850 65.2 Morganella morganii S3 lepB signal peptidase I
HKOGLL_02195 HKOGLL_02195 65.2 Morganella morganii S5 lepB signal peptidase I
F4V73_RS01975 F4V73_RS01975 65.8 Morganella psychrotolerans lepB signal peptidase I

Distribution of the homologs in the orthogroup group_560

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_560

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P00803 3.82e-133 384 58 3 326 1 lepB Signal peptidase I Escherichia coli (strain K12)
P0A1W2 3.19e-131 379 58 3 326 3 lepB Signal peptidase I Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1W3 3.19e-131 379 58 3 326 3 lepB Signal peptidase I Salmonella typhi
P57347 3.72e-103 308 48 7 328 3 lepB Signal peptidase I Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9R0 4.52e-94 284 46 8 326 3 lepB Signal peptidase I Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P44454 2.02e-77 243 38 6 349 3 lepB Signal peptidase I Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q89AM6 1.34e-75 237 44 6 265 3 lepB Signal peptidase I Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P26844 1.06e-59 196 37 11 337 3 lepB Signal peptidase I Pseudomonas fluorescens
Q9I5G7 8.18e-58 191 36 11 337 3 lepB Signal peptidase I Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O67088 3.89e-34 128 35 8 243 3 lepB Signal peptidase I Aquifex aeolicus (strain VF5)
Q8L2J7 1.47e-28 114 31 8 251 1 lepB Signal peptidase I Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q92JB1 1.52e-28 114 31 8 265 3 lepB Signal peptidase I Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A8F0M1 6.17e-28 112 30 8 265 3 lepB Signal peptidase I Rickettsia massiliae (strain Mtu5)
Q4UKA7 1.81e-27 111 30 8 265 3 lepB Signal peptidase I Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A8GQT7 1.83e-27 111 30 8 265 1 lepB Signal peptidase I Rickettsia rickettsii (strain Sheila Smith)
Q9ZE32 7.46e-27 109 31 8 250 3 lepB Signal peptidase I Rickettsia prowazekii (strain Madrid E)
A8EXI2 9.67e-27 109 32 9 252 3 lepB Signal peptidase I Rickettsia canadensis (strain McKiel)
A8GM78 8.27e-26 106 30 8 265 3 lepB Signal peptidase I Rickettsia akari (strain Hartford)
A8GYE1 4.49e-23 99 29 8 263 3 lepB Signal peptidase I Rickettsia bellii (strain OSU 85-389)
Q1RHA1 5.47e-23 99 29 8 263 3 lepB Signal peptidase I Rickettsia bellii (strain RML369-C)
Q9ZLQ5 3.75e-22 97 28 6 249 3 lepB Signal peptidase I Helicobacter pylori (strain J99 / ATCC 700824)
O25300 2.71e-21 95 28 7 252 3 lepB Signal peptidase I Helicobacter pylori (strain ATCC 700392 / 26695)
P0A069 8.18e-13 69 25 8 263 3 spsB Signal peptidase IB Staphylococcus aureus (strain MW2)
P0A070 8.18e-13 69 25 8 263 3 spsB Signal peptidase IB Staphylococcus aureus
Q6GAW1 8.18e-13 69 25 8 263 3 spsB Signal peptidase IB Staphylococcus aureus (strain MSSA476)
P0A068 8.18e-13 69 25 8 263 1 spsB Signal peptidase IB Staphylococcus aureus (strain N315)
P0A067 8.18e-13 69 25 8 263 3 spsB Signal peptidase IB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GIC3 9.39e-13 69 25 7 244 3 spsB Signal peptidase IB Staphylococcus aureus (strain MRSA252)
Q5HHB9 9.39e-13 69 25 8 254 1 spsB Signal peptidase IB Staphylococcus aureus (strain COL)
Q57350 3.6e-11 64 24 8 259 3 sipP Signal peptidase I P Bacillus subtilis subsp. natto
O07560 6.28e-11 63 28 7 227 2 sipV Signal peptidase I V Bacillus subtilis (strain 168)
P73157 1.27e-10 63 36 3 104 3 lepB2 Probable signal peptidase I-2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P73157 4.59e-07 53 48 0 43 3 lepB2 Probable signal peptidase I-2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P42959 1.62e-10 62 27 8 239 1 sipU Signal peptidase I U Bacillus subtilis (strain 168)
P41027 8.61e-10 60 37 2 91 3 lepB Signal peptidase I Bacillus caldolyticus
Q51876 1.08e-09 60 43 5 96 3 lepB Signal peptidase I Phormidium laminosum
Q51876 3.26e-06 50 38 2 71 3 lepB Signal peptidase I Phormidium laminosum
P37943 1.51e-09 60 33 4 107 1 sipP Signal peptidase I P Bacillus subtilis subsp. natto
P42668 5.76e-09 58 25 10 255 3 lepB Signal peptidase I Bacillus licheniformis
O07344 6.63e-09 58 27 9 219 3 lepB Signal peptidase I Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P59662 6.89e-09 58 27 9 219 3 lepB Signal peptidase I Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P72660 4.2e-08 56 61 0 34 3 lepB1 Probable signal peptidase I-1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P72660 4.7e-07 53 41 2 86 3 lepB1 Probable signal peptidase I-1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O33021 1.6e-07 55 25 13 310 3 lepB Probable signal peptidase I Mycobacterium leprae (strain TN)
P9WKA1 1.61e-07 55 27 13 280 1 lepB Signal peptidase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WKA0 1.61e-07 55 27 13 280 3 lepB Signal peptidase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9M9Z2 4.49e-07 54 33 2 101 2 TPP2 Probable thylakoidal processing peptidase 2, chloroplastic Arabidopsis thaliana
P71013 8.86e-07 52 23 10 234 1 sipT Signal peptidase I T Bacillus subtilis (strain 168)
P28628 2.3e-06 50 23 10 249 1 sipS Signal peptidase I S Bacillus subtilis (strain 168)
Q8H0W1 3.13e-06 51 31 3 110 2 PLSP1 Chloroplast processing peptidase Arabidopsis thaliana
Q8H0W1 0.000312 45 44 0 43 2 PLSP1 Chloroplast processing peptidase Arabidopsis thaliana
O04348 2.76e-05 48 32 2 95 2 TPP1 Thylakoidal processing peptidase 1, chloroplastic Arabidopsis thaliana
P41025 4.97e-05 47 28 3 98 3 sipS2 Signal peptidase I Bacillus amyloliquefaciens
Q6NLT8 7.35e-05 46 29 2 89 2 IMP1A Mitochondrial ATP-independent inner membrane protease subunit 1a Arabidopsis thaliana
P41026 0.000108 45 22 10 250 3 sipA Signal peptidase I Bacillus amyloliquefaciens
P28627 0.000258 44 29 3 103 1 IMP1 Mitochondrial inner membrane protease subunit 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q96LU5 0.000571 43 37 2 70 1 IMMP1L Mitochondrial inner membrane protease subunit 1 Homo sapiens
Q9CQU8 0.000628 43 37 2 70 1 Immp1l Mitochondrial inner membrane protease subunit 1 Mus musculus

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09325
Feature type CDS
Gene lepB
Product signal peptidase I
Location 2035354 - 2036325 (strand: -1)
Length 972 (nucleotides) / 323 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_560
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF10502 Signal peptidase, peptidase S26

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0681 Intracellular trafficking, secretion, and vesicular transport (U) U Signal peptidase I

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03100 signal peptidase I [EC:3.4.21.89] Protein export -

Protein Sequence

MASTFALILTLATLITGIFWCIDRFKLKPARKAKLKRLQELTQGSEDQQELAKSINKPSWAETLGSLFPVLAIVLILRSFVYEPFQIPSRSMMPTLLVGDFILVEKFAYGLKDPITQTTLISTGKPKRGDIAVFKYPRDPSTDFIKRVIGLPGDKIVYDMTSKKLHIYPNCNKAICDDEIAVTYGTAYPSEWTLLLQSVPGGQRISGMKSIPIEEPISTATQFRQEERIETIGDVSHRIMTIPGDVTVPEFIQPGLPQGTWIVPEGQYFMMGDNRDGSSDSRFWGFVPEQNLVGKATTIWMSFEKQENEWPTGVRFSRIGGIK

Flanking regions ( +/- flanking 50bp)

TTTTTAGCCATACTGCATGTTGGTAAAGATAAATAATTTAAGGAGAAAATATGGCTAGCACGTTTGCCTTGATCCTAACGTTGGCAACGCTAATTACGGGTATTTTTTGGTGTATAGATCGTTTTAAATTAAAGCCAGCCCGTAAAGCGAAGTTAAAACGTTTACAAGAGTTAACGCAGGGAAGTGAGGATCAGCAAGAGTTAGCAAAATCGATTAATAAACCAAGCTGGGCAGAGACATTAGGCTCTCTGTTTCCTGTATTGGCGATTGTATTGATTTTGCGTTCCTTTGTGTATGAGCCGTTTCAGATCCCATCTCGTTCGATGATGCCGACTTTATTAGTCGGTGATTTCATCTTGGTTGAAAAATTTGCTTATGGATTAAAAGATCCTATTACACAAACAACCTTGATTAGTACGGGTAAACCTAAACGTGGTGATATTGCGGTATTTAAATACCCACGTGATCCATCAACTGACTTTATTAAACGGGTGATTGGTTTACCGGGGGATAAAATAGTGTATGACATGACGTCGAAGAAATTACACATTTACCCAAATTGTAATAAAGCAATATGTGATGATGAAATAGCGGTAACCTATGGTACAGCGTATCCTAGTGAATGGACATTACTGTTACAAAGTGTACCTGGTGGTCAACGTATTAGCGGTATGAAATCGATTCCGATTGAAGAGCCAATTTCTACAGCTACGCAATTTCGCCAAGAAGAGAGAATTGAAACGATTGGTGATGTCTCTCATCGTATTATGACTATTCCGGGAGATGTTACTGTACCTGAATTTATTCAGCCGGGATTACCTCAAGGTACGTGGATTGTCCCTGAAGGTCAGTATTTTATGATGGGTGATAACCGTGATGGTAGTTCAGATAGTCGTTTCTGGGGCTTTGTGCCTGAGCAAAACTTAGTCGGTAAAGCCACAACGATTTGGATGAGCTTCGAGAAACAAGAAAATGAATGGCCTACAGGTGTTCGTTTCAGCCGTATTGGTGGCATTAAGTAATTTTTAACAAAATAGCTACAGCATTCCTTTCTATCTCAGTGTAGAATATG