Homologs in group_630

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01400 FBDBKF_01400 79.8 Morganella morganii S1 pdxJ pyridoxine 5'-phosphate synthase
EHELCC_00145 EHELCC_00145 79.8 Morganella morganii S2 pdxJ pyridoxine 5'-phosphate synthase
NLDBIP_03315 NLDBIP_03315 79.8 Morganella morganii S4 pdxJ pyridoxine 5'-phosphate synthase
LHKJJB_04830 LHKJJB_04830 79.8 Morganella morganii S3 pdxJ pyridoxine 5'-phosphate synthase
HKOGLL_02215 HKOGLL_02215 79.8 Morganella morganii S5 pdxJ pyridoxine 5'-phosphate synthase
F4V73_RS01995 F4V73_RS01995 79.4 Morganella psychrotolerans pdxJ pyridoxine 5'-phosphate synthase

Distribution of the homologs in the orthogroup group_630

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_630

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N1X8 2.69e-142 401 78 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q3V7N3 1.68e-133 379 75 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q31XS3 2.46e-132 375 75 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Shigella boydii serotype 4 (strain Sb227)
Q3YYV2 4.7e-132 375 75 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Shigella sonnei (strain Ss046)
P0A794 3.81e-131 372 74 0 242 1 pdxJ Pyridoxine 5'-phosphate synthase Escherichia coli (strain K12)
P0A795 3.81e-131 372 74 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Escherichia coli O157:H7
Q8FF18 1.66e-130 371 74 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q32CV7 3.45e-130 370 74 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Shigella dysenteriae serotype 1 (strain Sd197)
Q8ZN19 5.01e-130 370 74 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z4K6 5.77e-130 370 74 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Salmonella typhi
Q3V7K1 6.66e-130 369 74 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57LD3 6.66e-130 369 74 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Salmonella choleraesuis (strain SC-B67)
Q8ZCP4 2.37e-129 368 73 0 243 1 pdxJ Pyridoxine 5'-phosphate synthase Yersinia pestis
Q3V7P0 8.74e-129 367 73 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q5E317 2.38e-121 348 69 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q3IDK9 3.43e-119 342 68 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudoalteromonas translucida (strain TAC 125)
Q7MHP1 2.28e-118 340 68 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Vibrio vulnificus (strain YJ016)
Q8DC73 2.28e-118 340 68 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Vibrio vulnificus (strain CMCP6)
Q3V7I6 3.35e-118 340 67 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Photobacterium profundum (strain SS9)
Q9KPB5 1.97e-117 338 69 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q492D2 3.35e-117 337 62 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Blochmanniella pennsylvanica (strain BPEN)
Q87LP2 7.21e-115 331 69 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q0VP22 1.19e-112 326 65 0 238 3 pdxJ Pyridoxine 5'-phosphate synthase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q8EH78 5.92e-111 322 67 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q47WP8 2.12e-109 318 64 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q3V870 3.16e-107 312 63 0 241 3 pdxJ Pyridoxine 5'-phosphate synthase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IFW5 3.16e-107 312 63 0 241 3 pdxJ Pyridoxine 5'-phosphate synthase Legionella pneumophila (strain Corby)
Q3V7F6 3.2e-107 312 63 0 241 3 pdxJ Pyridoxine 5'-phosphate synthase Legionella pneumophila (strain Lens)
Q3V7G1 1.14e-106 311 63 0 241 3 pdxJ Pyridoxine 5'-phosphate synthase Legionella pneumophila (strain Paris)
Q7VRR1 7.79e-106 308 58 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Blochmanniella floridana
B7UYW9 1.54e-104 305 62 0 235 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas aeruginosa (strain LESB58)
Q9I5G5 1.78e-104 305 62 0 235 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02HS5 1.78e-104 305 62 0 235 1 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q5R109 2.86e-104 305 63 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q0AF72 1.85e-103 302 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q3JCY8 4.94e-103 301 62 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B5EQL6 1.46e-102 300 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J9K4 1.46e-102 300 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q31HP0 2.26e-102 300 62 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q3KHL6 2.1e-101 297 60 0 240 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas fluorescens (strain Pf0-1)
C1DQS7 2.38e-101 297 60 0 235 3 pdxJ Pyridoxine 5'-phosphate synthase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A4XSC7 1.04e-100 296 61 0 235 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas mendocina (strain ymp)
Q3V7G6 1.08e-100 295 62 0 238 3 pdxJ Pyridoxine 5'-phosphate synthase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A6VAK3 1.17e-100 295 60 0 232 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas aeruginosa (strain PA7)
Q82SJ7 2.08e-100 295 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q7VWW0 4.6e-100 294 61 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W9J7 4.6e-100 294 61 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WH63 4.6e-100 294 61 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B1J4E3 6.73e-100 293 59 0 240 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas putida (strain W619)
Q1I5W1 7.46e-100 293 60 0 240 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas entomophila (strain L48)
C1D7L7 1.31e-99 293 59 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Laribacter hongkongensis (strain HLHK9)
Q48EV6 1.97e-99 292 58 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q87XG4 3.79e-99 291 58 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A0L8S5 4.3e-99 291 64 0 238 3 pdxJ Pyridoxine 5'-phosphate synthase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A4VIX8 6.14e-99 291 60 0 238 3 pdxJ Pyridoxine 5'-phosphate synthase Stutzerimonas stutzeri (strain A1501)
Q4ZPE4 7.38e-99 291 58 0 240 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas syringae pv. syringae (strain B728a)
Q3V8A2 1.45e-98 290 59 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B0KV24 1.57e-98 290 58 0 240 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas putida (strain GB-1)
Q88MY2 1.68e-98 290 59 0 240 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W8E9 1.68e-98 290 59 0 240 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q2Y865 4.22e-98 289 61 0 238 3 pdxJ Pyridoxine 5'-phosphate synthase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B3R1Z6 6.03e-98 289 62 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A9M276 1.23e-97 288 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Neisseria meningitidis serogroup C (strain 053442)
Q7NWC0 1.39e-97 288 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q4KHS8 2.98e-97 287 60 0 231 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q5F6P1 1.46e-96 285 58 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q1LKN4 2.67e-96 285 61 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q9RQV9 3.66e-96 284 58 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A1KVH8 4.4e-96 284 59 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9RML6 4.4e-96 284 59 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Neisseria meningitidis serogroup C
Q9K0V9 5.13e-96 283 59 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
C3K6Z0 1.07e-95 283 60 0 231 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas fluorescens (strain SBW25)
Q3SH53 1.13e-95 283 64 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Thiobacillus denitrificans (strain ATCC 25259)
Q3JQ80 2.79e-95 282 64 0 239 1 pdxJ Pyridoxine 5'-phosphate synthase Burkholderia pseudomallei (strain 1710b)
Q3V7M2 2.79e-95 282 64 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Burkholderia mallei (strain ATCC 23344)
Q3V7S9 3.33e-95 282 64 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Burkholderia pseudomallei (strain K96243)
Q83BL1 5.49e-95 281 58 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9N936 5.49e-95 281 58 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KFA7 5.49e-95 281 58 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Coxiella burnetii (strain Dugway 5J108-111)
Q2JSG7 1.1e-94 280 59 0 233 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain JA-3-3Ab)
A5G535 1.36e-93 277 60 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Geotalea uraniireducens (strain Rf4)
B3DF93 1.77e-93 277 58 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q8Y0H8 3.47e-93 277 62 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q39I70 8.29e-93 276 61 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B7K7E4 1.31e-92 275 58 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Gloeothece citriformis (strain PCC 7424)
Q2JP46 3.17e-92 274 59 0 233 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q39UG0 3.46e-92 274 59 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q0K8N6 5.92e-92 274 62 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q3V8C9 6.46e-92 273 59 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B9M5K2 2.19e-91 271 59 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A9BAZ9 2.46e-91 272 57 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain MIT 9211)
Q2KXM4 1.12e-90 270 61 1 239 3 pdxJ Pyridoxine 5'-phosphate synthase Bordetella avium (strain 197N)
Q3M9L4 1.33e-90 270 57 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8DKM1 3.84e-90 268 58 0 233 3 pdxJ Pyridoxine 5'-phosphate synthase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q31AB8 7.64e-90 268 56 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain MIT 9312)
Q8Z080 7.99e-90 268 57 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B1WY64 8.82e-90 268 56 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Crocosphaera subtropica (strain ATCC 51142 / BH68)
B5YGR4 9.12e-90 268 56 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A5GU97 1.64e-89 267 56 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain RCC307)
A2C897 2.64e-89 266 56 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain MIT 9303)
B8HKL1 3.34e-89 266 57 0 231 3 pdxJ Pyridoxine 5'-phosphate synthase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
B3E693 3.49e-89 266 57 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q3AJ26 4.27e-89 266 55 1 237 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain CC9605)
Q7V6Q5 4.65e-89 266 56 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain MIT 9313)
A8G5H7 7.02e-89 265 56 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain MIT 9215)
Q7V0Y7 1.17e-88 265 55 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q7VBK3 1.43e-88 265 54 1 237 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A2BRT6 3.9e-88 263 55 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain AS9601)
Q46Z21 5.16e-88 264 59 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q5FNS2 5.28e-88 263 58 2 235 3 pdxJ Pyridoxine 5'-phosphate synthase Gluconobacter oxydans (strain 621H)
B2U984 8.72e-88 263 61 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Ralstonia pickettii (strain 12J)
A2C3H1 1e-87 263 56 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain NATL1A)
Q46K45 1.1e-87 263 55 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain NATL2A)
A2BX94 1.16e-87 262 54 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain MIT 9515)
Q0IB11 2.06e-87 262 57 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain CC9311)
Q16AJ0 2.74e-87 261 55 2 248 3 pdxJ Pyridoxine 5'-phosphate synthase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q3V7J3 3.02e-87 261 56 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A9IUY4 4.19e-87 261 60 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A1AR94 7.37e-87 260 56 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q7NPF2 2.29e-86 259 57 0 233 3 pdxJ Pyridoxine 5'-phosphate synthase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A5GLI2 2.77e-86 259 55 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain WH7803)
B8GPL4 2.89e-86 259 55 0 238 3 pdxJ Pyridoxine 5'-phosphate synthase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q7U7S1 3.56e-86 259 56 1 237 3 pdxJ Pyridoxine 5'-phosphate synthase Parasynechococcus marenigrum (strain WH8102)
Q3AVH3 4.38e-86 259 54 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain CC9902)
C6E5P6 6.61e-86 258 59 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Geobacter sp. (strain M21)
A4YWD1 8.91e-86 258 56 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Bradyrhizobium sp. (strain ORS 278)
Q4FUV3 1.02e-85 258 56 2 239 3 pdxJ Pyridoxine 5'-phosphate synthase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B5EHA6 2.13e-85 256 59 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
B3QTV1 2.65e-84 254 54 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
P72776 2.68e-84 254 54 1 236 3 pdxJ Pyridoxine 5'-phosphate synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q3A5V4 2.99e-84 253 58 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A1K607 4.2e-84 253 55 1 245 3 pdxJ Pyridoxine 5'-phosphate synthase Azoarcus sp. (strain BH72)
Q8D304 4.58e-84 253 50 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Wigglesworthia glossinidia brevipalpis
Q28V29 7.65e-84 253 54 1 245 3 pdxJ Pyridoxine 5'-phosphate synthase Jannaschia sp. (strain CCS1)
Q5P083 9.01e-84 253 55 2 245 3 pdxJ Pyridoxine 5'-phosphate synthase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
B1ZNA6 1.35e-83 252 52 2 245 3 pdxJ Pyridoxine 5'-phosphate synthase Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
B8FJ89 2.48e-83 251 53 1 235 3 pdxJ Pyridoxine 5'-phosphate synthase Desulfatibacillum aliphaticivorans
B2J448 3.89e-83 251 57 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q1QDV0 4.77e-83 251 55 2 239 3 pdxJ Pyridoxine 5'-phosphate synthase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
O69158 5.76e-83 251 54 1 244 3 pdxJ Pyridoxine 5'-phosphate synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B8H623 1.06e-82 250 52 3 243 3 pdxJ Pyridoxine 5'-phosphate synthase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A808 1.06e-82 250 52 3 243 3 pdxJ Pyridoxine 5'-phosphate synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q10X41 1.18e-82 249 56 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Trichodesmium erythraeum (strain IMS101)
Q47EF4 1.87e-82 249 54 1 245 3 pdxJ Pyridoxine 5'-phosphate synthase Dechloromonas aromatica (strain RCB)
A1BE95 2.25e-82 249 54 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
P46212 4.15e-82 248 57 3 233 3 pdxJ Pyridoxine 5'-phosphate synthase (Fragment) Aquifex pyrophilus
O67417 4.53e-82 248 56 2 239 3 pdxJ Pyridoxine 5'-phosphate synthase Aquifex aeolicus (strain VF5)
B2V6U1 4.78e-82 248 58 2 241 3 pdxJ Pyridoxine 5'-phosphate synthase Sulfurihydrogenibium sp. (strain YO3AOP1)
Q2IWU8 2.1e-81 247 53 2 244 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodopseudomonas palustris (strain HaA2)
Q7UYK5 2.25e-81 246 52 1 235 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q5NLS8 2.27e-81 247 56 1 239 3 pdxJ Pyridoxine 5'-phosphate synthase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
C0QU74 2.48e-81 246 54 1 239 3 pdxJ Pyridoxine 5'-phosphate synthase Persephonella marina (strain DSM 14350 / EX-H1)
Q2RT91 5.44e-81 246 55 1 244 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q3ATB8 8.43e-81 244 55 1 234 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobium chlorochromatii (strain CaD3)
Q3B5P7 1.14e-80 244 54 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q3V812 3.02e-80 243 58 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q8KPR0 3.02e-80 243 58 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B4SDS5 1.1e-79 242 53 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
B0C977 1.47e-79 242 60 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Acaryochloris marina (strain MBIC 11017)
B4S3G9 4.47e-78 238 51 0 233 3 pdxJ Pyridoxine 5'-phosphate synthase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
C6BV77 8.87e-78 237 50 0 235 3 pdxJ Pyridoxine 5'-phosphate synthase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
B2URE7 4.12e-77 236 49 3 241 3 pdxJ Pyridoxine 5'-phosphate synthase Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
C0R576 7.62e-77 234 49 2 235 3 pdxJ Pyridoxine 5'-phosphate synthase Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q3V8B3 8.13e-77 234 49 2 235 3 pdxJ Pyridoxine 5'-phosphate synthase Wolbachia pipientis wMel
B0T3H6 3.44e-76 233 54 2 243 3 pdxJ Pyridoxine 5'-phosphate synthase Caulobacter sp. (strain K31)
B3ELU3 1.3e-75 231 51 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobium phaeobacteroides (strain BS1)
Q3J5W4 1.4e-75 232 51 2 245 3 pdxJ Pyridoxine 5'-phosphate synthase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PGF5 1.4e-75 232 51 2 245 3 pdxJ Pyridoxine 5'-phosphate synthase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B8DPF1 3.3e-75 231 50 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
A0LK96 6.09e-75 230 51 0 233 3 pdxJ Pyridoxine 5'-phosphate synthase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A1VCV9 2.23e-74 229 51 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Nitratidesulfovibrio vulgaris (strain DP4)
Q3V891 2.23e-74 229 51 0 230 1 pdxJ Pyridoxine 5'-phosphate synthase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
C4XGU0 6.4e-74 228 53 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
Q214J9 7.14e-74 228 51 1 241 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodopseudomonas palustris (strain BisB18)
B3QJH1 7.46e-74 228 52 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodopseudomonas palustris (strain TIE-1)
Q3V7S0 9.18e-74 228 52 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A7IM59 1.84e-73 227 54 1 230 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
A4SDF7 2.13e-73 226 51 1 229 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q136W2 3.11e-73 226 54 2 240 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodopseudomonas palustris (strain BisB5)
B3CLF3 1.21e-72 224 47 2 232 3 pdxJ Pyridoxine 5'-phosphate synthase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q30ZQ6 7.24e-72 222 49 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A8ZVC5 1.74e-71 221 51 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
A6Q3Y6 8.71e-71 220 47 2 259 3 pdxJ Pyridoxine 5'-phosphate synthase Nitratiruptor sp. (strain SB155-2)
B4U872 7.18e-70 217 51 2 233 3 pdxJ Pyridoxine 5'-phosphate synthase Hydrogenobaculum sp. (strain Y04AAS1)
Q2GG30 8.65e-70 217 45 1 241 3 pdxJ Pyridoxine 5'-phosphate synthase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q5HBN7 1.09e-69 216 47 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Ehrlichia ruminantium (strain Welgevonden)
B3QQ93 1.1e-69 216 48 0 229 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q5FHH4 1.8e-69 216 47 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Ehrlichia ruminantium (strain Gardel)
Q3SRB0 6.48e-69 215 51 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B9LAE4 1.66e-68 214 46 2 256 3 pdxJ Pyridoxine 5'-phosphate synthase Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
Q30S57 2.25e-68 214 45 1 255 3 pdxJ Pyridoxine 5'-phosphate synthase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q3YSI5 7.11e-68 212 45 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Ehrlichia canis (strain Jake)
C0Q9S7 1.62e-67 211 50 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q3V7J9 3.3e-67 210 44 1 237 3 pdxJ Pyridoxine 5'-phosphate synthase Anaplasma marginale (strain St. Maries)
A8ESJ1 6.82e-67 210 43 1 259 3 pdxJ Pyridoxine 5'-phosphate synthase Aliarcobacter butzleri (strain RM4018)
A6QAX8 8.53e-67 210 45 1 258 3 pdxJ Pyridoxine 5'-phosphate synthase Sulfurovum sp. (strain NBC37-1)
Q2S0U5 4.14e-66 207 46 3 244 3 pdxJ Pyridoxine 5'-phosphate synthase Salinibacter ruber (strain DSM 13855 / M31)
B2KEC4 8.58e-66 207 45 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Elusimicrobium minutum (strain Pei191)
Q7MAP8 4.77e-65 206 42 2 258 3 pdxJ Pyridoxine 5'-phosphate synthase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q3V7R4 1.25e-64 204 43 2 238 3 pdxJ Pyridoxine 5'-phosphate synthase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q7VHV1 5.37e-64 203 43 2 262 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A8FMU3 2.99e-63 201 44 4 259 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A1W0M1 1.03e-62 199 43 4 262 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
B9KCG6 1.12e-62 199 43 4 259 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q8KFJ5 1.14e-62 199 48 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q2GJT4 5.27e-62 197 45 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Anaplasma phagocytophilum (strain HZ)
A7I3Y5 6.31e-62 197 44 3 259 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A7H2E1 1.47e-61 196 44 4 259 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A0RNS2 1.55e-61 196 40 2 257 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter fetus subsp. fetus (strain 82-40)
Q9PN59 3.66e-61 196 44 4 259 1 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5HTM5 4.6e-61 195 44 4 259 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter jejuni (strain RM1221)
Q4FLS6 1.31e-59 191 40 1 236 3 pdxJ Pyridoxine 5'-phosphate synthase Pelagibacter ubique (strain HTCC1062)
Q17ZN1 1.45e-48 163 36 5 261 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter acinonychis (strain Sheeba)
O26102 8.59e-48 161 37 6 261 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZJ29 1.31e-47 161 35 4 261 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter pylori (strain J99 / ATCC 700824)
B5Z9L2 8.9e-47 159 36 6 261 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter pylori (strain G27)
B2UVZ8 1.37e-46 158 36 6 261 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter pylori (strain Shi470)
B6JP91 1.68e-46 158 36 6 261 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter pylori (strain P12)
Q1CR25 2.82e-46 157 35 4 261 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter pylori (strain HPAG1)
Q3V814 1.13e-42 147 36 3 237 3 pdxJ Pyridoxine 5'-phosphate synthase Bacteroides fragilis (strain YCH46)
Q5L912 1.13e-42 147 36 3 237 3 pdxJ Pyridoxine 5'-phosphate synthase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q11PM4 5.4e-42 145 35 3 238 3 pdxJ Pyridoxine 5'-phosphate synthase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q51843 8.3e-42 145 36 3 233 3 pdxJ Pyridoxine 5'-phosphate synthase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q8A0V3 2.47e-41 144 35 3 237 3 pdxJ Pyridoxine 5'-phosphate synthase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
B2RIJ5 4.64e-41 143 36 3 233 3 pdxJ Pyridoxine 5'-phosphate synthase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
A6KXM3 1.69e-40 142 34 3 237 3 pdxJ Pyridoxine 5'-phosphate synthase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A5FJ95 1.45e-39 139 36 4 236 3 pdxJ Pyridoxine 5'-phosphate synthase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q5H704 3.74e-39 139 34 3 248 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SUX4 3.74e-39 139 34 3 248 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas oryzae pv. oryzae (strain PXO99A)
A0LXW0 7.58e-39 137 32 2 235 3 pdxJ Pyridoxine 5'-phosphate synthase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q2P9L0 2.36e-38 137 34 3 250 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8PEG8 6.68e-38 135 36 3 237 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RLF1 6.68e-38 135 36 3 237 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas campestris pv. campestris (strain B100)
Q4V0R7 6.68e-38 135 36 3 237 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas campestris pv. campestris (strain 8004)
A6LC86 1.35e-35 129 32 2 236 3 pdxJ Pyridoxine 5'-phosphate synthase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
B0SJ25 1.52e-35 130 31 4 253 3 pdxJ Pyridoxine 5'-phosphate synthase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SBH6 1.52e-35 130 31 4 253 3 pdxJ Pyridoxine 5'-phosphate synthase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q8UDU5 2.39e-35 129 34 4 235 3 pdxJ Pyridoxine 5'-phosphate synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
B9JXN7 1.34e-34 127 32 4 244 3 pdxJ Pyridoxine 5'-phosphate synthase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q98KL6 3.68e-34 125 33 3 238 3 pdxJ Pyridoxine 5'-phosphate synthase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q11I86 5.99e-34 125 35 5 237 3 pdxJ Pyridoxine 5'-phosphate synthase Chelativorans sp. (strain BNC1)
Q92NT6 5.52e-33 123 33 4 240 3 pdxJ Pyridoxine 5'-phosphate synthase Rhizobium meliloti (strain 1021)
Q9PH84 4.22e-32 120 33 3 237 3 pdxJ Pyridoxine 5'-phosphate synthase Xylella fastidiosa (strain 9a5c)
Q3BZR9 5e-32 120 35 3 245 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q87F88 7.32e-32 120 33 3 237 3 pdxJ Pyridoxine 5'-phosphate synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I669 7.32e-32 120 33 3 237 3 pdxJ Pyridoxine 5'-phosphate synthase Xylella fastidiosa (strain M23)
B0U2A9 9.05e-32 120 33 3 237 3 pdxJ Pyridoxine 5'-phosphate synthase Xylella fastidiosa (strain M12)
Q21XM2 1.08e-31 119 33 6 249 3 pdxJ Pyridoxine 5'-phosphate synthase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A6WZX2 1.59e-31 119 33 3 229 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q8FZT6 5.75e-31 117 33 3 229 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella suis biovar 1 (strain 1330)
B0CHH2 5.75e-31 117 33 3 229 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella suis (strain ATCC 23445 / NCTC 10510)
A9M642 5.75e-31 117 33 3 229 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q8PRF1 7.88e-31 117 33 3 247 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas axonopodis pv. citri (strain 306)
A5VRD3 1.09e-30 117 33 3 229 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YI24 1.09e-30 117 33 3 229 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RE25 1.09e-30 117 33 3 229 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella melitensis biotype 2 (strain ATCC 23457)
Q57CC2 1.09e-30 117 33 3 229 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella abortus biovar 1 (strain 9-941)
Q2YQM7 1.09e-30 117 33 3 229 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella abortus (strain 2308)
B2S6L0 1.09e-30 117 33 3 229 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella abortus (strain S19)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09305
Feature type CDS
Gene pdxJ
Product pyridoxine 5'-phosphate synthase
Location 2032019 - 2032750 (strand: -1)
Length 732 (nucleotides) / 243 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_630
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03740 Pyridoxal phosphate biosynthesis protein PdxJ

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0854 Coenzyme transport and metabolism (H) H Pyridoxine 5'-phosphate synthase PdxJ

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03474 pyridoxine 5-phosphate synthase [EC:2.6.99.2] Vitamin B6 metabolism
Metabolic pathways
Biosynthesis of cofactors
Pyridoxal-P biosynthesis, erythrose-4P => pyridoxal-P

Protein Sequence

MSDILLGVNIDHIATLRNARGTTYPDPVQAAFIAEQAGADGITIHLREDRRHITDRDLMLISQTVQTRLNLEMAVTEEMIEIACQTQPDFCCLVPEKRQEVTTEGGLDVVGNEEKVADAIKRLSLAGIKVSLFIDPDHEQINAADRVGAPFIEIHTGAYADAEDEQAQEKEFVRIRDAVTYAASKGLKVNAGHGLHYHNVQRIAALPELYELNIGHAIIGRAVFSGLAPAVEEMKRLMREARR

Flanking regions ( +/- flanking 50bp)

ATGGAATGTGTAAACTAAGGTAATACAACGTTATTTTTCAGGAGAAGAGCATGTCTGATATTCTACTTGGCGTTAATATTGACCATATTGCAACCCTACGTAATGCCCGTGGCACAACTTATCCCGATCCGGTTCAAGCGGCATTTATTGCGGAACAAGCGGGGGCTGATGGGATCACTATTCATTTACGTGAAGACAGACGTCATATTACCGATCGTGATTTAATGCTGATCAGCCAAACGGTTCAAACAAGATTAAATTTAGAAATGGCGGTAACAGAAGAGATGATTGAGATTGCTTGCCAAACTCAACCTGACTTTTGTTGTTTAGTGCCTGAAAAACGCCAAGAAGTGACCACAGAAGGTGGTTTAGACGTGGTGGGTAATGAAGAGAAAGTGGCTGATGCGATTAAACGTTTATCATTAGCGGGGATTAAAGTCTCTTTATTTATTGATCCTGACCATGAGCAAATTAATGCAGCAGATCGTGTCGGCGCACCTTTTATTGAAATTCATACCGGTGCTTATGCTGACGCTGAAGATGAACAGGCTCAAGAGAAGGAGTTTGTTCGCATTCGTGATGCGGTAACCTATGCAGCGTCTAAAGGTTTAAAAGTCAATGCAGGTCATGGTTTGCATTATCATAATGTACAACGTATTGCTGCATTACCTGAACTTTATGAACTCAATATTGGTCATGCGATTATTGGTCGAGCGGTATTTAGTGGGCTTGCACCAGCCGTTGAAGAAATGAAACGCCTAATGAGAGAAGCGCGTCGCTAATGGCTATTGTTGGTATAGGTATGGATATCGTTGAGATATCACGTATTGAA