Homologs in group_556

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01400 FBDBKF_01400 95.5 Morganella morganii S1 pdxJ pyridoxine 5'-phosphate synthase
EHELCC_00145 EHELCC_00145 95.5 Morganella morganii S2 pdxJ pyridoxine 5'-phosphate synthase
NLDBIP_03315 NLDBIP_03315 95.5 Morganella morganii S4 pdxJ pyridoxine 5'-phosphate synthase
LHKJJB_04830 LHKJJB_04830 95.5 Morganella morganii S3 pdxJ pyridoxine 5'-phosphate synthase
HKOGLL_02215 HKOGLL_02215 95.5 Morganella morganii S5 pdxJ pyridoxine 5'-phosphate synthase
PMI_RS09305 PMI_RS09305 79.4 Proteus mirabilis HI4320 pdxJ pyridoxine 5'-phosphate synthase

Distribution of the homologs in the orthogroup group_556

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_556

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N1X8 1.15e-149 419 82 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8ZCP4 2.42e-135 383 77 0 243 1 pdxJ Pyridoxine 5'-phosphate synthase Yersinia pestis
Q3V7P0 5.04e-134 380 76 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q3V7N3 1.35e-132 376 75 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q31XS3 4.33e-129 367 74 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Shigella boydii serotype 4 (strain Sb227)
Q3YYV2 6.5e-129 367 73 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Shigella sonnei (strain Ss046)
P0A794 2.09e-127 363 73 0 242 1 pdxJ Pyridoxine 5'-phosphate synthase Escherichia coli (strain K12)
P0A795 2.09e-127 363 73 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Escherichia coli O157:H7
Q8FF18 3.32e-127 362 73 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8ZN19 4.09e-127 362 73 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q32CV7 1.79e-126 361 73 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Shigella dysenteriae serotype 1 (strain Sd197)
Q3V7K1 2.46e-126 360 73 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57LD3 2.46e-126 360 73 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Salmonella choleraesuis (strain SC-B67)
Q8Z4K6 3.38e-126 360 73 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Salmonella typhi
Q5E317 1.45e-121 348 69 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q3V7I6 4.57e-119 342 68 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Photobacterium profundum (strain SS9)
Q7MHP1 7.15e-119 342 67 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Vibrio vulnificus (strain YJ016)
Q8DC73 7.15e-119 342 67 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Vibrio vulnificus (strain CMCP6)
Q492D2 6.31e-117 337 62 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Blochmanniella pennsylvanica (strain BPEN)
Q9KPB5 3.33e-116 335 68 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87LP2 4.67e-116 334 69 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q0VP22 4.82e-115 332 67 0 238 3 pdxJ Pyridoxine 5'-phosphate synthase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q3IDK9 1.81e-114 330 66 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudoalteromonas translucida (strain TAC 125)
Q47WP8 5.5e-114 329 66 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q8EH78 6.68e-114 329 69 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7VRR1 4.83e-109 317 62 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Blochmanniella floridana
Q3KHL6 3.06e-105 307 61 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas fluorescens (strain Pf0-1)
Q2Y865 1.01e-104 305 62 0 238 3 pdxJ Pyridoxine 5'-phosphate synthase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q3V8A2 1.51e-104 305 63 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B1J4E3 2.94e-104 305 61 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas putida (strain W619)
B0KV24 3.66e-104 304 61 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas putida (strain GB-1)
Q1I5W1 3.67e-104 304 62 0 240 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas entomophila (strain L48)
Q48EV6 6.74e-104 304 61 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q3V7G1 9.39e-104 303 61 0 241 3 pdxJ Pyridoxine 5'-phosphate synthase Legionella pneumophila (strain Paris)
Q87XG4 9.78e-104 303 61 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A5W8E9 1.05e-103 303 62 0 240 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88MY2 1.07e-103 303 61 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q3V870 1.3e-103 303 61 0 241 3 pdxJ Pyridoxine 5'-phosphate synthase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IFW5 1.3e-103 303 61 0 241 3 pdxJ Pyridoxine 5'-phosphate synthase Legionella pneumophila (strain Corby)
Q3V7F6 1.39e-103 303 61 0 241 3 pdxJ Pyridoxine 5'-phosphate synthase Legionella pneumophila (strain Lens)
Q0AF72 2.07e-103 302 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q4ZPE4 2.27e-103 302 61 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas syringae pv. syringae (strain B728a)
A4XSC7 4.34e-103 301 63 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas mendocina (strain ymp)
B7UYW9 5.9e-103 301 60 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas aeruginosa (strain LESB58)
Q9I5G5 7.34e-103 301 60 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02HS5 7.34e-103 301 60 0 237 1 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q3JCY8 1.22e-102 300 63 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B5EQL6 1.36e-102 300 58 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J9K4 1.36e-102 300 58 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q82SJ7 2.37e-102 300 61 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q3V7G6 3.79e-102 299 62 0 238 3 pdxJ Pyridoxine 5'-phosphate synthase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
C1DQS7 4.32e-102 299 60 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q83BL1 7.38e-102 298 61 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9N936 7.38e-102 298 61 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KFA7 7.38e-102 298 61 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Coxiella burnetii (strain Dugway 5J108-111)
Q5R109 2.21e-101 297 61 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q4KHS8 3.19e-101 297 62 0 233 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A6VAK3 6.97e-100 293 60 0 232 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas aeruginosa (strain PA7)
C3K6Z0 1.05e-99 293 62 0 233 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas fluorescens (strain SBW25)
Q1LKN4 5.51e-99 292 63 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B3R1Z6 5.69e-99 291 63 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A9M276 7.93e-99 291 61 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Neisseria meningitidis serogroup C (strain 053442)
Q7NWC0 1.03e-98 290 58 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q5F6P1 1.23e-97 288 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9RQV9 1.45e-97 287 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A1KVH8 2.3e-97 287 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9RML6 2.3e-97 287 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Neisseria meningitidis serogroup C
Q9K0V9 2.46e-97 287 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q3SH53 7.04e-97 286 64 0 235 3 pdxJ Pyridoxine 5'-phosphate synthase Thiobacillus denitrificans (strain ATCC 25259)
A4VIX8 6.01e-96 283 58 0 240 3 pdxJ Pyridoxine 5'-phosphate synthase Stutzerimonas stutzeri (strain A1501)
A0L8S5 6.32e-96 283 62 0 238 3 pdxJ Pyridoxine 5'-phosphate synthase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q31HP0 4.11e-95 281 58 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B3E693 1.52e-94 280 60 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
C1D7L7 1.74e-94 280 58 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Laribacter hongkongensis (strain HLHK9)
Q7VWW0 2.97e-94 279 60 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W9J7 2.97e-94 279 60 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WH63 2.97e-94 279 60 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q3JQ80 2.99e-94 280 62 0 237 1 pdxJ Pyridoxine 5'-phosphate synthase Burkholderia pseudomallei (strain 1710b)
Q3V7M2 3.23e-94 280 62 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Burkholderia mallei (strain ATCC 23344)
Q3V7S9 3.64e-94 280 62 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Burkholderia pseudomallei (strain K96243)
Q2JSG7 7.11e-94 278 59 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain JA-3-3Ab)
Q0K8N6 1.15e-93 278 63 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q3AJ26 1.62e-93 277 58 1 237 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain CC9605)
Q39I70 1.4e-92 275 60 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q2JP46 2.01e-92 274 60 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain JA-2-3B'a(2-13))
A5G535 2.72e-92 274 60 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Geotalea uraniireducens (strain Rf4)
A5GLI2 7.9e-92 273 56 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain WH7803)
Q3V8C9 2.59e-91 271 60 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B9M5K2 3.51e-91 271 61 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q8Y0H8 1.6e-90 270 61 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q39UG0 1.64e-90 270 59 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A9BAZ9 2.07e-90 269 56 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain MIT 9211)
B5YGR4 2.46e-90 269 55 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B3DF93 2.51e-90 269 58 2 236 3 pdxJ Pyridoxine 5'-phosphate synthase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B8GPL4 2.58e-90 269 57 0 238 3 pdxJ Pyridoxine 5'-phosphate synthase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q3AVH3 2.61e-90 269 55 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain CC9902)
Q46Z21 4.93e-90 269 62 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q7U7S1 8.48e-90 268 56 1 237 3 pdxJ Pyridoxine 5'-phosphate synthase Parasynechococcus marenigrum (strain WH8102)
Q7V6Q5 9.44e-90 268 57 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain MIT 9313)
Q3M9L4 1.41e-89 267 58 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A5GU97 1.71e-89 267 56 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain RCC307)
A2C897 3.35e-89 266 56 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain MIT 9303)
B1WY64 3.46e-89 266 57 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Crocosphaera subtropica (strain ATCC 51142 / BH68)
B7K7E4 3.57e-89 266 56 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Gloeothece citriformis (strain PCC 7424)
B8HKL1 7.03e-89 265 57 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q8Z080 9.03e-89 265 58 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8DKM1 2.26e-88 264 58 0 233 3 pdxJ Pyridoxine 5'-phosphate synthase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q1QDV0 1.15e-87 263 56 2 239 3 pdxJ Pyridoxine 5'-phosphate synthase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q3V7J3 1.64e-87 262 55 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q4FUV3 2.6e-87 262 57 2 236 3 pdxJ Pyridoxine 5'-phosphate synthase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A2C3H1 3.25e-87 261 54 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain NATL1A)
Q7VBK3 3.36e-87 261 53 1 237 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q3A5V4 4.08e-87 261 57 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q2KXM4 4.32e-87 261 59 1 237 3 pdxJ Pyridoxine 5'-phosphate synthase Bordetella avium (strain 197N)
Q46K45 4.82e-87 261 54 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain NATL2A)
A2BRT6 6.12e-87 260 54 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain AS9601)
A8G5H7 1.76e-86 259 54 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain MIT 9215)
Q7V0Y7 1.82e-86 259 54 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q31AB8 3.32e-86 258 54 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain MIT 9312)
Q16AJ0 6.01e-86 258 55 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q5FNS2 7.2e-86 257 55 2 233 3 pdxJ Pyridoxine 5'-phosphate synthase Gluconobacter oxydans (strain 621H)
B2U984 9.83e-86 258 61 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Ralstonia pickettii (strain 12J)
A2BX94 2.42e-85 256 54 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain MIT 9515)
Q0IB11 2.71e-85 256 54 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain CC9311)
C6E5P6 2.76e-85 256 59 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Geobacter sp. (strain M21)
A4YWD1 3.85e-85 256 55 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Bradyrhizobium sp. (strain ORS 278)
P72776 4.72e-85 256 54 1 231 3 pdxJ Pyridoxine 5'-phosphate synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A9IUY4 6.14e-85 256 59 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q2IWU8 1.2e-84 255 53 1 244 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodopseudomonas palustris (strain HaA2)
B1ZNA6 1.57e-84 254 53 2 242 3 pdxJ Pyridoxine 5'-phosphate synthase Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
Q2RT91 5.88e-84 253 56 1 244 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B5EHA6 6.56e-84 253 58 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
A1AR94 7.08e-84 253 57 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A1K607 8.08e-84 253 55 1 243 3 pdxJ Pyridoxine 5'-phosphate synthase Azoarcus sp. (strain BH72)
Q8D304 2.13e-83 251 49 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Wigglesworthia glossinidia brevipalpis
C0QU74 3.02e-83 251 56 1 239 3 pdxJ Pyridoxine 5'-phosphate synthase Persephonella marina (strain DSM 14350 / EX-H1)
Q7NPF2 5.51e-83 250 56 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q47EF4 6.35e-83 251 55 1 243 3 pdxJ Pyridoxine 5'-phosphate synthase Dechloromonas aromatica (strain RCB)
Q10X41 2.48e-82 249 57 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Trichodesmium erythraeum (strain IMS101)
Q3V812 2.59e-82 249 59 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q8KPR0 2.59e-82 249 59 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O69158 4.73e-82 248 52 1 244 3 pdxJ Pyridoxine 5'-phosphate synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O67417 6.56e-82 248 55 2 239 3 pdxJ Pyridoxine 5'-phosphate synthase Aquifex aeolicus (strain VF5)
B3QTV1 2.4e-81 246 52 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q5P083 4.47e-81 246 53 2 243 3 pdxJ Pyridoxine 5'-phosphate synthase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
P46212 1.32e-80 244 54 2 233 3 pdxJ Pyridoxine 5'-phosphate synthase (Fragment) Aquifex pyrophilus
Q28V29 1.52e-80 244 51 1 245 3 pdxJ Pyridoxine 5'-phosphate synthase Jannaschia sp. (strain CCS1)
B8H623 2.22e-80 244 52 2 243 3 pdxJ Pyridoxine 5'-phosphate synthase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A808 2.22e-80 244 52 2 243 3 pdxJ Pyridoxine 5'-phosphate synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A7IM59 2.39e-80 244 58 1 230 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
B2J448 3.84e-80 243 57 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
B8FJ89 5.75e-80 243 50 1 235 3 pdxJ Pyridoxine 5'-phosphate synthase Desulfatibacillum aliphaticivorans
A1BE95 9.5e-80 242 52 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q5NLS8 1.92e-79 242 55 1 237 3 pdxJ Pyridoxine 5'-phosphate synthase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
C6BV77 2.37e-79 241 51 0 235 3 pdxJ Pyridoxine 5'-phosphate synthase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q3B5P7 4.83e-79 240 51 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q7UYK5 7.37e-79 240 51 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
B0C977 1.3e-77 237 58 0 233 3 pdxJ Pyridoxine 5'-phosphate synthase Acaryochloris marina (strain MBIC 11017)
C4XGU0 3.78e-77 236 55 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
Q3ATB8 3.87e-77 235 53 2 235 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobium chlorochromatii (strain CaD3)
Q30ZQ6 4.6e-77 235 50 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q136W2 2.42e-76 234 55 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodopseudomonas palustris (strain BisB5)
B4S3G9 2.5e-76 233 49 0 229 3 pdxJ Pyridoxine 5'-phosphate synthase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
B2V6U1 4.74e-76 233 55 2 241 3 pdxJ Pyridoxine 5'-phosphate synthase Sulfurihydrogenibium sp. (strain YO3AOP1)
B3QJH1 2.17e-75 231 52 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodopseudomonas palustris (strain TIE-1)
Q3V7S0 2.78e-75 231 52 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B0T3H6 3.08e-75 231 54 2 243 3 pdxJ Pyridoxine 5'-phosphate synthase Caulobacter sp. (strain K31)
B3ELU3 3.27e-75 231 50 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobium phaeobacteroides (strain BS1)
A0LK96 3.69e-75 230 52 0 233 3 pdxJ Pyridoxine 5'-phosphate synthase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B8DPF1 5.7e-75 230 49 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
B2URE7 9.58e-75 229 47 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
A1VCV9 1.62e-74 229 53 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Nitratidesulfovibrio vulgaris (strain DP4)
Q3V891 1.62e-74 229 53 0 230 1 pdxJ Pyridoxine 5'-phosphate synthase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
C0R576 1.8e-74 229 48 2 235 3 pdxJ Pyridoxine 5'-phosphate synthase Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q3V8B3 1.98e-74 228 48 2 235 3 pdxJ Pyridoxine 5'-phosphate synthase Wolbachia pipientis wMel
B4SDS5 5.11e-74 228 49 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q3J5W4 5.63e-74 228 50 1 245 3 pdxJ Pyridoxine 5'-phosphate synthase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PGF5 5.63e-74 228 50 1 245 3 pdxJ Pyridoxine 5'-phosphate synthase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B3QQ93 7.7e-73 224 48 0 229 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q214J9 2.25e-72 224 49 2 249 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodopseudomonas palustris (strain BisB18)
A8ZVC5 2.76e-72 223 51 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
B3CLF3 6.89e-72 222 48 3 232 3 pdxJ Pyridoxine 5'-phosphate synthase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
A4SDF7 1.65e-71 221 49 1 229 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q2GG30 4.38e-71 220 46 1 241 3 pdxJ Pyridoxine 5'-phosphate synthase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q3YSI5 1.22e-70 219 47 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Ehrlichia canis (strain Jake)
Q7MAP8 1.31e-70 220 43 2 258 3 pdxJ Pyridoxine 5'-phosphate synthase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q3SRB0 2.02e-70 219 51 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A6QAX8 6.58e-70 218 44 1 258 3 pdxJ Pyridoxine 5'-phosphate synthase Sulfurovum sp. (strain NBC37-1)
B2KEC4 1.13e-69 217 47 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Elusimicrobium minutum (strain Pei191)
A6Q3Y6 1.66e-69 217 46 2 259 3 pdxJ Pyridoxine 5'-phosphate synthase Nitratiruptor sp. (strain SB155-2)
B4U872 1.81e-69 216 49 3 235 3 pdxJ Pyridoxine 5'-phosphate synthase Hydrogenobaculum sp. (strain Y04AAS1)
B9LAE4 4.92e-69 216 45 2 256 3 pdxJ Pyridoxine 5'-phosphate synthase Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
Q5FHH4 1.08e-68 214 47 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Ehrlichia ruminantium (strain Gardel)
Q5HBN7 1.77e-68 213 46 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Ehrlichia ruminantium (strain Welgevonden)
A8ESJ1 1.89e-67 212 42 2 259 3 pdxJ Pyridoxine 5'-phosphate synthase Aliarcobacter butzleri (strain RM4018)
Q3V7J9 7.8e-67 209 45 1 237 3 pdxJ Pyridoxine 5'-phosphate synthase Anaplasma marginale (strain St. Maries)
C0Q9S7 1.56e-66 209 51 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q30S57 7.31e-66 207 43 1 255 3 pdxJ Pyridoxine 5'-phosphate synthase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q7VHV1 7.86e-66 207 44 2 259 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q8KFJ5 1.16e-64 204 48 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q2S0U5 2.58e-64 203 45 2 239 3 pdxJ Pyridoxine 5'-phosphate synthase Salinibacter ruber (strain DSM 13855 / M31)
A7I3Y5 3.96e-64 203 42 3 259 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q3V7R4 3.05e-62 197 41 2 239 3 pdxJ Pyridoxine 5'-phosphate synthase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
A0RNS2 5.54e-62 197 40 2 257 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter fetus subsp. fetus (strain 82-40)
A1W0M1 2.01e-61 196 41 4 262 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A8FMU3 2.37e-61 196 42 5 259 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A7H2E1 7.58e-61 194 42 4 259 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q9PN59 4.64e-60 192 41 5 259 1 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B9KCG6 8.47e-60 192 39 5 259 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q5HTM5 1.06e-59 192 41 5 259 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter jejuni (strain RM1221)
Q4FLS6 3.97e-58 187 41 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Pelagibacter ubique (strain HTCC1062)
Q2GJT4 2.87e-57 185 42 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Anaplasma phagocytophilum (strain HZ)
Q17ZN1 1.12e-48 164 37 6 261 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter acinonychis (strain Sheeba)
O26102 3.91e-48 162 36 5 261 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZJ29 5.52e-48 162 36 6 262 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter pylori (strain J99 / ATCC 700824)
B5Z9L2 2.84e-47 160 37 7 262 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter pylori (strain G27)
B6JP91 5.78e-47 159 37 7 262 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter pylori (strain P12)
B2UVZ8 1.26e-46 158 36 6 261 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter pylori (strain Shi470)
Q1CR25 3.49e-46 157 34 5 261 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter pylori (strain HPAG1)
A6LC86 3.74e-43 149 36 2 235 3 pdxJ Pyridoxine 5'-phosphate synthase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q11PM4 7.06e-43 148 36 4 241 3 pdxJ Pyridoxine 5'-phosphate synthase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
A6KXM3 2.38e-42 147 35 2 235 3 pdxJ Pyridoxine 5'-phosphate synthase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q3V814 9.19e-42 145 35 2 235 3 pdxJ Pyridoxine 5'-phosphate synthase Bacteroides fragilis (strain YCH46)
Q5L912 9.19e-42 145 35 2 235 3 pdxJ Pyridoxine 5'-phosphate synthase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q8A0V3 9.49e-42 145 35 2 235 3 pdxJ Pyridoxine 5'-phosphate synthase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q51843 5.39e-41 143 36 2 234 3 pdxJ Pyridoxine 5'-phosphate synthase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B2RIJ5 6.62e-41 143 36 2 234 3 pdxJ Pyridoxine 5'-phosphate synthase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
B0SJ25 1.47e-40 142 36 4 243 3 pdxJ Pyridoxine 5'-phosphate synthase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SBH6 1.47e-40 142 36 4 243 3 pdxJ Pyridoxine 5'-phosphate synthase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
A0LXW0 2.05e-39 139 33 3 236 3 pdxJ Pyridoxine 5'-phosphate synthase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q5H704 8.51e-38 135 35 4 250 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SUX4 8.51e-38 135 35 4 250 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P9L0 6.42e-37 133 34 4 252 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A5FJ95 1.05e-36 132 34 2 227 3 pdxJ Pyridoxine 5'-phosphate synthase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q8PEG8 2.82e-34 126 35 4 239 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RLF1 2.82e-34 126 35 4 239 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas campestris pv. campestris (strain B100)
Q4V0R7 2.82e-34 126 35 4 239 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas campestris pv. campestris (strain 8004)
Q21XM2 3.52e-33 123 35 6 236 3 pdxJ Pyridoxine 5'-phosphate synthase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q98KL6 6.07e-33 122 33 3 236 3 pdxJ Pyridoxine 5'-phosphate synthase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q3BZR9 3.67e-32 121 35 3 245 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B9JXN7 1.35e-31 119 33 4 239 3 pdxJ Pyridoxine 5'-phosphate synthase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q8UDU5 1.73e-31 119 33 4 235 3 pdxJ Pyridoxine 5'-phosphate synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q11I86 6.84e-31 117 32 4 237 3 pdxJ Pyridoxine 5'-phosphate synthase Chelativorans sp. (strain BNC1)
Q8PRF1 7.97e-31 117 34 3 248 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas axonopodis pv. citri (strain 306)
Q9PH84 1.78e-30 116 33 3 244 3 pdxJ Pyridoxine 5'-phosphate synthase Xylella fastidiosa (strain 9a5c)
Q87F88 2.04e-30 116 33 4 246 3 pdxJ Pyridoxine 5'-phosphate synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I669 2.04e-30 116 33 4 246 3 pdxJ Pyridoxine 5'-phosphate synthase Xylella fastidiosa (strain M23)
B0U2A9 3.28e-30 116 33 3 244 3 pdxJ Pyridoxine 5'-phosphate synthase Xylella fastidiosa (strain M12)
Q92NT6 5.81e-29 112 31 4 239 3 pdxJ Pyridoxine 5'-phosphate synthase Rhizobium meliloti (strain 1021)
Q8FZT6 3.56e-28 110 32 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella suis biovar 1 (strain 1330)
B0CHH2 3.56e-28 110 32 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella suis (strain ATCC 23445 / NCTC 10510)
A9M642 3.56e-28 110 32 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
A5VRD3 6.16e-28 109 32 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YI24 6.16e-28 109 32 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RE25 6.16e-28 109 32 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella melitensis biotype 2 (strain ATCC 23457)
Q57CC2 6.16e-28 109 32 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella abortus biovar 1 (strain 9-941)
Q2YQM7 6.16e-28 109 32 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella abortus (strain 2308)
B2S6L0 6.16e-28 109 32 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella abortus (strain S19)
A6WZX2 5.29e-27 107 31 3 234 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01995
Feature type CDS
Gene pdxJ
Product pyridoxine 5'-phosphate synthase
Location 434149 - 434880 (strand: 1)
Length 732 (nucleotides) / 243 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_556
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03740 Pyridoxal phosphate biosynthesis protein PdxJ

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0854 Coenzyme transport and metabolism (H) H Pyridoxine 5'-phosphate synthase PdxJ

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03474 pyridoxine 5-phosphate synthase [EC:2.6.99.2] Vitamin B6 metabolism
Metabolic pathways
Biosynthesis of cofactors		 Pyridoxal-P biosynthesis, erythrose-4P => pyridoxal-P

Protein Sequence

MSEVLLGINIDHIATVRNARGTNYPDPVQAAFIAEQAGAEGITVHLREDRRHITDRDVDLLRQTIQTRMNLEMAVTDEMVDIACRIKPVFCCLVPEKRQEITTEGGLDVAGQKEKIARAVKRLTEAGIKVSLFIDPDHTQIDAADDVGAPFIEIHTGAYADAVTSQEEDKEFFRIKDAVAYAAGKGLSVNAGHGLNYHNVQRIAALPAIYELNIGHAIIGRAVFSGLAAAVAEMKTLLREARR

Flanking regions ( +/- flanking 50bp)

GGTTGAAAAAGGTTAAACTGAACAATAAAAGTTACCCTGAGGATTAAAAAATGAGTGAAGTTTTATTGGGCATAAACATTGATCACATTGCAACTGTCCGTAACGCACGCGGCACAAACTATCCGGATCCGGTTCAGGCGGCATTTATCGCAGAACAGGCAGGTGCAGAAGGGATCACGGTTCACCTGCGGGAAGATCGCCGTCATATTACGGATCGTGATGTGGATCTTCTCAGACAAACTATTCAGACCCGCATGAATCTGGAAATGGCGGTTACTGATGAAATGGTTGATATCGCGTGTCGCATCAAACCGGTATTTTGTTGTCTGGTGCCGGAGAAACGCCAGGAAATTACAACTGAAGGCGGGCTGGATGTCGCCGGACAAAAAGAGAAAATCGCACGCGCGGTTAAGCGTTTGACTGAAGCAGGAATTAAAGTTTCTCTGTTTATCGACCCGGATCATACCCAGATTGATGCCGCAGATGATGTCGGTGCACCTTTTATTGAAATTCACACTGGTGCTTACGCGGATGCAGTGACCTCACAGGAAGAAGATAAAGAATTTTTCCGGATAAAAGACGCCGTTGCGTATGCTGCGGGCAAAGGTCTGAGTGTTAATGCCGGACACGGTCTGAACTATCATAATGTTCAGCGTATTGCTGCACTCCCTGCCATTTATGAGCTGAATATCGGTCATGCGATTATTGGTCGCGCAGTATTCAGCGGATTAGCCGCAGCGGTTGCAGAGATGAAAACGTTGCTGAGAGAAGCCCGTCGTTAATGGCTATTGTTGGCATTGGTACAGATATTGTTGAAATAAGTCGCATTGAA