Homologs in group_630

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01400 FBDBKF_01400 100.0 Morganella morganii S1 pdxJ pyridoxine 5'-phosphate synthase
EHELCC_00145 EHELCC_00145 100.0 Morganella morganii S2 pdxJ pyridoxine 5'-phosphate synthase
LHKJJB_04830 LHKJJB_04830 100.0 Morganella morganii S3 pdxJ pyridoxine 5'-phosphate synthase
HKOGLL_02215 HKOGLL_02215 100.0 Morganella morganii S5 pdxJ pyridoxine 5'-phosphate synthase
F4V73_RS01995 F4V73_RS01995 95.5 Morganella psychrotolerans pdxJ pyridoxine 5'-phosphate synthase
PMI_RS09305 PMI_RS09305 79.8 Proteus mirabilis HI4320 pdxJ pyridoxine 5'-phosphate synthase

Distribution of the homologs in the orthogroup group_630

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_630

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N1X8 6.92e-151 422 83 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8ZCP4 3.93e-137 388 78 0 243 1 pdxJ Pyridoxine 5'-phosphate synthase Yersinia pestis
Q3V7P0 6.15e-136 385 77 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q3V7N3 3.28e-133 378 76 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q31XS3 4.64e-130 370 73 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Shigella boydii serotype 4 (strain Sb227)
Q3YYV2 8.2e-130 369 73 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Shigella sonnei (strain Ss046)
Q8ZN19 2.59e-129 368 74 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q3V7K1 1.84e-128 366 73 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57LD3 1.84e-128 366 73 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Salmonella choleraesuis (strain SC-B67)
Q8Z4K6 3.18e-128 365 73 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Salmonella typhi
P0A794 5.33e-128 365 73 0 242 1 pdxJ Pyridoxine 5'-phosphate synthase Escherichia coli (strain K12)
P0A795 5.33e-128 365 73 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Escherichia coli O157:H7
Q8FF18 1.63e-127 363 73 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q32CV7 5.03e-127 362 72 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Shigella dysenteriae serotype 1 (strain Sd197)
Q5E317 6.27e-123 352 69 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q3V7I6 1.36e-121 348 69 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Photobacterium profundum (strain SS9)
Q7MHP1 1.86e-119 343 68 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Vibrio vulnificus (strain YJ016)
Q8DC73 1.86e-119 343 68 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Vibrio vulnificus (strain CMCP6)
Q492D2 1.29e-118 341 63 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Blochmanniella pennsylvanica (strain BPEN)
Q9KPB5 7.35e-117 336 68 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q0VP22 3.16e-116 335 68 0 238 3 pdxJ Pyridoxine 5'-phosphate synthase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q87LP2 3.11e-115 332 68 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8EH78 5.1e-115 332 69 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q47WP8 6.22e-115 332 66 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q3IDK9 1.14e-114 331 66 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudoalteromonas translucida (strain TAC 125)
Q7VRR1 7.6e-110 319 61 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Blochmanniella floridana
Q3KHL6 3.33e-107 312 63 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas fluorescens (strain Pf0-1)
Q3V8A2 2.44e-106 310 64 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1I5W1 5.14e-106 309 64 0 240 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas entomophila (strain L48)
Q88MY2 1.02e-105 308 63 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B1J4E3 1.09e-105 308 63 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas putida (strain W619)
B0KV24 1.12e-105 308 63 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas putida (strain GB-1)
A5W8E9 1.71e-105 307 64 0 240 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q48EV6 2.62e-105 307 63 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q87XG4 3.4e-105 307 62 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B7UYW9 7.42e-105 306 62 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas aeruginosa (strain LESB58)
Q9I5G5 1.1e-104 306 62 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02HS5 1.1e-104 306 62 0 237 1 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q4ZPE4 1.15e-104 306 62 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas syringae pv. syringae (strain B728a)
A4XSC7 1.96e-104 305 64 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas mendocina (strain ymp)
Q2Y865 3.25e-104 304 61 0 238 3 pdxJ Pyridoxine 5'-phosphate synthase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B5EQL6 3.92e-104 304 61 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J9K4 3.92e-104 304 61 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q5R109 9.52e-104 303 63 0 242 3 pdxJ Pyridoxine 5'-phosphate synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q3V7G6 1.24e-103 303 63 0 238 3 pdxJ Pyridoxine 5'-phosphate synthase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q3V7G1 1.81e-103 303 61 0 241 3 pdxJ Pyridoxine 5'-phosphate synthase Legionella pneumophila (strain Paris)
C1DQS7 1.85e-103 303 61 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q3V7F6 2.51e-103 302 61 0 241 3 pdxJ Pyridoxine 5'-phosphate synthase Legionella pneumophila (strain Lens)
Q3V870 3.23e-103 302 61 0 241 3 pdxJ Pyridoxine 5'-phosphate synthase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IFW5 3.23e-103 302 61 0 241 3 pdxJ Pyridoxine 5'-phosphate synthase Legionella pneumophila (strain Corby)
Q4KHS8 7.58e-103 301 63 0 233 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q0AF72 1.16e-102 300 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q3JCY8 2.14e-102 300 62 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A6VAK3 1.11e-101 298 62 0 232 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas aeruginosa (strain PA7)
Q82SJ7 1.39e-101 298 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q83BL1 3.77e-101 296 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9N936 3.77e-101 296 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KFA7 3.77e-101 296 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Coxiella burnetii (strain Dugway 5J108-111)
C3K6Z0 2.93e-100 295 63 0 233 3 pdxJ Pyridoxine 5'-phosphate synthase Pseudomonas fluorescens (strain SBW25)
B3R1Z6 1.45e-99 293 63 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A9M276 5.01e-99 291 61 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Neisseria meningitidis serogroup C (strain 053442)
Q7NWC0 5.53e-99 291 59 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1LKN4 1.2e-98 291 62 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q5F6P1 2.5e-98 289 61 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9RQV9 1.22e-97 288 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9K0V9 1.71e-97 287 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1KVH8 2.18e-97 287 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9RML6 2.18e-97 287 60 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Neisseria meningitidis serogroup C
Q3SH53 1.2e-96 285 64 0 235 3 pdxJ Pyridoxine 5'-phosphate synthase Thiobacillus denitrificans (strain ATCC 25259)
A4VIX8 3.48e-96 284 58 0 240 3 pdxJ Pyridoxine 5'-phosphate synthase Stutzerimonas stutzeri (strain A1501)
Q7VWW0 4.24e-96 284 61 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W9J7 4.24e-96 284 61 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WH63 4.24e-96 284 61 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
C1D7L7 7.53e-96 283 59 0 239 3 pdxJ Pyridoxine 5'-phosphate synthase Laribacter hongkongensis (strain HLHK9)
Q3AJ26 1.37e-95 283 59 1 237 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain CC9605)
Q3JQ80 1.75e-95 283 63 0 237 1 pdxJ Pyridoxine 5'-phosphate synthase Burkholderia pseudomallei (strain 1710b)
Q3V7M2 1.79e-95 283 63 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Burkholderia mallei (strain ATCC 23344)
Q3V7S9 2.15e-95 283 63 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Burkholderia pseudomallei (strain K96243)
B3E693 1.02e-94 280 60 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A0L8S5 3.16e-94 279 61 0 238 3 pdxJ Pyridoxine 5'-phosphate synthase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q2JSG7 4.49e-94 279 59 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain JA-3-3Ab)
Q0K8N6 4.69e-94 279 63 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q39I70 1.04e-93 278 61 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q31HP0 1.07e-93 278 58 0 243 3 pdxJ Pyridoxine 5'-phosphate synthase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A5G535 1.59e-93 277 61 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Geotalea uraniireducens (strain Rf4)
Q3V8C9 2.29e-92 274 60 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B9M5K2 3.04e-92 274 61 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q2JP46 4.12e-92 273 60 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q39UG0 8.77e-92 273 60 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A5GLI2 8.81e-92 273 56 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain WH7803)
B3DF93 3.71e-91 271 58 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q8DKM1 4.61e-91 271 59 0 233 3 pdxJ Pyridoxine 5'-phosphate synthase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8Y0H8 5.56e-91 271 61 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3AVH3 1.04e-90 270 56 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain CC9902)
B8GPL4 1.51e-90 270 57 0 238 3 pdxJ Pyridoxine 5'-phosphate synthase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
B5YGR4 1.79e-90 270 55 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q46Z21 2.08e-90 270 61 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q7U7S1 5.54e-90 268 56 1 237 3 pdxJ Pyridoxine 5'-phosphate synthase Parasynechococcus marenigrum (strain WH8102)
Q3M9L4 9.62e-90 268 59 2 236 3 pdxJ Pyridoxine 5'-phosphate synthase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A2C897 1.25e-89 267 57 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain MIT 9303)
B1WY64 1.51e-89 267 57 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Crocosphaera subtropica (strain ATCC 51142 / BH68)
A5GU97 1.75e-89 267 56 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain RCC307)
A9BAZ9 1.96e-89 267 55 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain MIT 9211)
Q2KXM4 3.73e-89 266 60 1 237 3 pdxJ Pyridoxine 5'-phosphate synthase Bordetella avium (strain 197N)
Q8Z080 4.16e-89 266 59 2 236 3 pdxJ Pyridoxine 5'-phosphate synthase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7V6Q5 5.42e-89 266 57 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain MIT 9313)
B7K7E4 7.11e-89 265 57 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Gloeothece citriformis (strain PCC 7424)
B8HKL1 1.17e-88 265 56 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q3A5V4 5.36e-88 263 58 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A9IUY4 3.71e-87 261 60 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A2BRT6 6.6e-87 260 55 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain AS9601)
Q7VBK3 7.8e-87 260 52 1 237 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q1QDV0 7.99e-87 261 56 2 237 3 pdxJ Pyridoxine 5'-phosphate synthase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q5FNS2 1.21e-86 259 56 2 233 3 pdxJ Pyridoxine 5'-phosphate synthase Gluconobacter oxydans (strain 621H)
Q3V7J3 1.42e-86 260 54 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
C6E5P6 1.47e-86 259 60 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Geobacter sp. (strain M21)
Q4FUV3 1.5e-86 260 57 2 236 3 pdxJ Pyridoxine 5'-phosphate synthase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A2C3H1 2.18e-86 259 54 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain NATL1A)
Q46K45 2.45e-86 259 53 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain NATL2A)
A8G5H7 3.55e-86 258 54 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain MIT 9215)
Q16AJ0 3.84e-86 259 54 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q31AB8 5.99e-86 258 54 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain MIT 9312)
B2U984 6.78e-86 259 60 0 237 3 pdxJ Pyridoxine 5'-phosphate synthase Ralstonia pickettii (strain 12J)
P72776 9.7e-86 258 55 1 231 3 pdxJ Pyridoxine 5'-phosphate synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7V0Y7 1.27e-85 257 53 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q0IB11 2.33e-85 257 54 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain CC9311)
B5EHA6 2.98e-85 256 59 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q2RT91 3.89e-85 256 56 1 244 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A2BX94 4.23e-85 256 54 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Prochlorococcus marinus (strain MIT 9515)
Q7NPF2 5.44e-85 255 58 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A1AR94 1.81e-84 254 57 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B1ZNA6 4.63e-84 253 53 2 242 3 pdxJ Pyridoxine 5'-phosphate synthase Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
Q2IWU8 8.43e-84 253 53 1 244 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodopseudomonas palustris (strain HaA2)
A4YWD1 9.2e-84 253 55 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Bradyrhizobium sp. (strain ORS 278)
A1K607 1.71e-83 252 55 1 243 3 pdxJ Pyridoxine 5'-phosphate synthase Azoarcus sp. (strain BH72)
Q10X41 1.79e-83 251 57 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Trichodesmium erythraeum (strain IMS101)
Q8D304 1.95e-83 252 49 2 239 3 pdxJ Pyridoxine 5'-phosphate synthase Wigglesworthia glossinidia brevipalpis
Q3V812 2.06e-83 251 60 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q8KPR0 2.06e-83 251 60 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
C0QU74 3.19e-83 251 56 1 239 3 pdxJ Pyridoxine 5'-phosphate synthase Persephonella marina (strain DSM 14350 / EX-H1)
Q47EF4 7.4e-83 250 55 1 243 3 pdxJ Pyridoxine 5'-phosphate synthase Dechloromonas aromatica (strain RCB)
P46212 2.25e-82 249 55 3 233 3 pdxJ Pyridoxine 5'-phosphate synthase (Fragment) Aquifex pyrophilus
C6BV77 2.86e-82 249 53 0 235 3 pdxJ Pyridoxine 5'-phosphate synthase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
B3QTV1 6.93e-82 248 52 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
O67417 7.64e-82 248 54 2 239 3 pdxJ Pyridoxine 5'-phosphate synthase Aquifex aeolicus (strain VF5)
O69158 7.89e-82 248 52 1 244 3 pdxJ Pyridoxine 5'-phosphate synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5P083 1.75e-81 247 54 2 243 3 pdxJ Pyridoxine 5'-phosphate synthase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
B8H623 2.4e-81 247 54 2 243 3 pdxJ Pyridoxine 5'-phosphate synthase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A808 2.4e-81 247 54 2 243 3 pdxJ Pyridoxine 5'-phosphate synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B2J448 3.19e-81 246 57 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q28V29 4.52e-81 246 51 1 245 3 pdxJ Pyridoxine 5'-phosphate synthase Jannaschia sp. (strain CCS1)
B8FJ89 4.83e-81 245 51 1 235 3 pdxJ Pyridoxine 5'-phosphate synthase Desulfatibacillum aliphaticivorans
A7IM59 5.86e-81 246 58 1 230 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
A1BE95 2.11e-80 244 52 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q5NLS8 2.85e-80 244 56 1 237 3 pdxJ Pyridoxine 5'-phosphate synthase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q7UYK5 6.48e-80 243 52 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q3B5P7 7.64e-80 242 51 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
B0C977 4.47e-79 240 60 0 233 3 pdxJ Pyridoxine 5'-phosphate synthase Acaryochloris marina (strain MBIC 11017)
B4S3G9 4.23e-78 238 50 0 229 3 pdxJ Pyridoxine 5'-phosphate synthase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q30ZQ6 1.18e-77 237 52 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q3ATB8 2.04e-77 236 51 1 234 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobium chlorochromatii (strain CaD3)
B3ELU3 8.04e-77 234 50 0 236 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobium phaeobacteroides (strain BS1)
C4XGU0 1.15e-76 234 55 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
B2V6U1 2.05e-76 234 55 2 241 3 pdxJ Pyridoxine 5'-phosphate synthase Sulfurihydrogenibium sp. (strain YO3AOP1)
A1VCV9 5.18e-76 233 53 0 230 3 pdxJ Pyridoxine 5'-phosphate synthase Nitratidesulfovibrio vulgaris (strain DP4)
Q3V891 5.18e-76 233 53 0 230 1 pdxJ Pyridoxine 5'-phosphate synthase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B0T3H6 6.07e-76 233 55 2 243 3 pdxJ Pyridoxine 5'-phosphate synthase Caulobacter sp. (strain K31)
B8DPF1 7.26e-76 232 50 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q136W2 1.72e-75 232 55 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodopseudomonas palustris (strain BisB5)
B4SDS5 2.07e-75 231 50 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A0LK96 1.34e-74 229 51 0 233 3 pdxJ Pyridoxine 5'-phosphate synthase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B2URE7 1.6e-74 229 47 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
C0R576 2.33e-74 228 47 2 235 3 pdxJ Pyridoxine 5'-phosphate synthase Wolbachia sp. subsp. Drosophila simulans (strain wRi)
B3QJH1 2.48e-74 229 52 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodopseudomonas palustris (strain TIE-1)
Q3V8B3 2.49e-74 228 47 2 235 3 pdxJ Pyridoxine 5'-phosphate synthase Wolbachia pipientis wMel
Q3V7S0 3.37e-74 229 52 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q3J5W4 4.92e-73 226 50 2 245 3 pdxJ Pyridoxine 5'-phosphate synthase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PGF5 4.92e-73 226 50 2 245 3 pdxJ Pyridoxine 5'-phosphate synthase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A8ZVC5 2.03e-72 223 51 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
A4SDF7 4e-72 223 49 1 229 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
B3QQ93 6.17e-72 222 48 0 229 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q2GG30 6.51e-72 222 47 2 241 3 pdxJ Pyridoxine 5'-phosphate synthase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
A6QAX8 1.34e-71 222 46 1 258 3 pdxJ Pyridoxine 5'-phosphate synthase Sulfurovum sp. (strain NBC37-1)
B3CLF3 1.76e-71 221 47 3 232 3 pdxJ Pyridoxine 5'-phosphate synthase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q214J9 2.44e-71 221 48 2 249 3 pdxJ Pyridoxine 5'-phosphate synthase Rhodopseudomonas palustris (strain BisB18)
B2KEC4 5.14e-71 220 49 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Elusimicrobium minutum (strain Pei191)
Q7MAP8 5.98e-71 221 44 2 258 3 pdxJ Pyridoxine 5'-phosphate synthase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A8ESJ1 1.72e-70 219 42 2 259 3 pdxJ Pyridoxine 5'-phosphate synthase Aliarcobacter butzleri (strain RM4018)
A6Q3Y6 2.7e-70 219 46 2 259 3 pdxJ Pyridoxine 5'-phosphate synthase Nitratiruptor sp. (strain SB155-2)
Q3YSI5 6.11e-70 217 46 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Ehrlichia canis (strain Jake)
Q3SRB0 2.52e-69 216 50 1 240 3 pdxJ Pyridoxine 5'-phosphate synthase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B9LAE4 2.82e-69 216 44 1 256 3 pdxJ Pyridoxine 5'-phosphate synthase Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
Q5FHH4 3.16e-69 215 46 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Ehrlichia ruminantium (strain Gardel)
Q5HBN7 4.53e-69 215 46 1 238 3 pdxJ Pyridoxine 5'-phosphate synthase Ehrlichia ruminantium (strain Welgevonden)
B4U872 8.14e-69 214 48 3 235 3 pdxJ Pyridoxine 5'-phosphate synthase Hydrogenobaculum sp. (strain Y04AAS1)
Q3V7J9 2.04e-67 211 44 1 237 3 pdxJ Pyridoxine 5'-phosphate synthase Anaplasma marginale (strain St. Maries)
Q30S57 5.56e-67 210 43 1 255 3 pdxJ Pyridoxine 5'-phosphate synthase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A7I3Y5 3.25e-66 208 43 3 259 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q2S0U5 6.6e-66 207 45 2 239 3 pdxJ Pyridoxine 5'-phosphate synthase Salinibacter ruber (strain DSM 13855 / M31)
C0Q9S7 9.3e-66 206 50 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q7VHV1 7.05e-65 205 43 2 259 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q8KFJ5 2.09e-64 203 48 0 234 3 pdxJ Pyridoxine 5'-phosphate synthase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q3V7R4 1.1e-62 199 41 2 239 3 pdxJ Pyridoxine 5'-phosphate synthase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
A8FMU3 2.04e-62 199 41 4 259 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A1W0M1 3.36e-62 198 41 4 262 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A0RNS2 4.87e-62 197 40 2 257 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter fetus subsp. fetus (strain 82-40)
A7H2E1 7.68e-62 197 41 4 259 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q9PN59 6.44e-61 195 41 4 259 1 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5HTM5 1e-60 194 41 4 259 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter jejuni (strain RM1221)
Q4FLS6 2.57e-59 190 42 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Pelagibacter ubique (strain HTCC1062)
B9KCG6 4.26e-59 190 38 4 259 3 pdxJ Pyridoxine 5'-phosphate synthase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q2GJT4 1.46e-57 186 42 1 233 3 pdxJ Pyridoxine 5'-phosphate synthase Anaplasma phagocytophilum (strain HZ)
Q17ZN1 1.97e-49 166 36 5 261 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter acinonychis (strain Sheeba)
Q9ZJ29 2.57e-48 163 35 5 262 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter pylori (strain J99 / ATCC 700824)
O26102 9.36e-48 161 34 4 261 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter pylori (strain ATCC 700392 / 26695)
B5Z9L2 5.36e-47 159 35 5 262 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter pylori (strain G27)
B6JP91 8.34e-47 159 35 5 262 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter pylori (strain P12)
Q1CR25 1.23e-46 158 34 4 261 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter pylori (strain HPAG1)
B2UVZ8 1.98e-46 158 34 4 261 3 pdxJ Pyridoxine 5'-phosphate synthase Helicobacter pylori (strain Shi470)
Q11PM4 6.01e-43 148 36 4 241 3 pdxJ Pyridoxine 5'-phosphate synthase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
A6LC86 9.65e-43 147 36 2 236 3 pdxJ Pyridoxine 5'-phosphate synthase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A6KXM3 1.47e-41 144 35 3 237 3 pdxJ Pyridoxine 5'-phosphate synthase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q51843 2.41e-41 144 38 2 227 3 pdxJ Pyridoxine 5'-phosphate synthase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B2RIJ5 4.21e-41 143 38 2 227 3 pdxJ Pyridoxine 5'-phosphate synthase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q3V814 5.31e-41 143 34 2 235 3 pdxJ Pyridoxine 5'-phosphate synthase Bacteroides fragilis (strain YCH46)
Q5L912 5.31e-41 143 34 2 235 3 pdxJ Pyridoxine 5'-phosphate synthase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q8A0V3 8.07e-41 142 34 2 235 3 pdxJ Pyridoxine 5'-phosphate synthase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A0LXW0 1.62e-39 139 32 2 235 3 pdxJ Pyridoxine 5'-phosphate synthase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
B0SJ25 4.99e-39 139 35 4 243 3 pdxJ Pyridoxine 5'-phosphate synthase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SBH6 4.99e-39 139 35 4 243 3 pdxJ Pyridoxine 5'-phosphate synthase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q5H704 1.15e-38 137 35 3 248 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SUX4 1.15e-38 137 35 3 248 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P9L0 9.58e-38 135 35 3 250 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A5FJ95 1.36e-36 132 33 2 227 3 pdxJ Pyridoxine 5'-phosphate synthase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q8PEG8 1.38e-35 130 36 4 239 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RLF1 1.38e-35 130 36 4 239 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas campestris pv. campestris (strain B100)
Q4V0R7 1.38e-35 130 36 4 239 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas campestris pv. campestris (strain 8004)
Q98KL6 8.55e-34 125 33 3 233 3 pdxJ Pyridoxine 5'-phosphate synthase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q3BZR9 2.6e-33 124 36 3 245 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q21XM2 1.97e-32 121 34 5 236 3 pdxJ Pyridoxine 5'-phosphate synthase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q8PRF1 9.15e-32 120 35 3 247 3 pdxJ Pyridoxine 5'-phosphate synthase Xanthomonas axonopodis pv. citri (strain 306)
B9JXN7 1.28e-31 119 34 4 235 3 pdxJ Pyridoxine 5'-phosphate synthase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q8UDU5 1.4e-31 119 33 4 235 3 pdxJ Pyridoxine 5'-phosphate synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9PH84 2.35e-31 119 34 3 237 3 pdxJ Pyridoxine 5'-phosphate synthase Xylella fastidiosa (strain 9a5c)
Q87F88 2.67e-31 119 34 3 237 3 pdxJ Pyridoxine 5'-phosphate synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I669 2.67e-31 119 34 3 237 3 pdxJ Pyridoxine 5'-phosphate synthase Xylella fastidiosa (strain M23)
B0U2A9 3.27e-31 118 34 3 237 3 pdxJ Pyridoxine 5'-phosphate synthase Xylella fastidiosa (strain M12)
Q11I86 6.22e-31 117 33 4 237 3 pdxJ Pyridoxine 5'-phosphate synthase Chelativorans sp. (strain BNC1)
Q92NT6 7.38e-30 115 33 4 235 3 pdxJ Pyridoxine 5'-phosphate synthase Rhizobium meliloti (strain 1021)
Q8FZT6 7.36e-29 112 33 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella suis biovar 1 (strain 1330)
B0CHH2 7.36e-29 112 33 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella suis (strain ATCC 23445 / NCTC 10510)
A9M642 7.36e-29 112 33 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
A5VRD3 1.42e-28 111 33 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YI24 1.42e-28 111 33 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RE25 1.42e-28 111 33 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella melitensis biotype 2 (strain ATCC 23457)
Q57CC2 1.42e-28 111 33 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella abortus biovar 1 (strain 9-941)
Q2YQM7 1.42e-28 111 33 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella abortus (strain 2308)
B2S6L0 1.42e-28 111 33 3 240 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella abortus (strain S19)
A6WZX2 2.59e-28 110 32 3 234 3 pdxJ Pyridoxine 5'-phosphate synthase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_03315
Feature type CDS
Gene pdxJ
Product pyridoxine 5'-phosphate synthase
Location 644919 - 645650 (strand: -1)
Length 732 (nucleotides) / 243 (amino acids)
In genomic island -

Contig

Accession ZDB_519
Length 680340 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_630
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03740 Pyridoxal phosphate biosynthesis protein PdxJ

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0854 Coenzyme transport and metabolism (H) H Pyridoxine 5'-phosphate synthase PdxJ

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03474 pyridoxine 5-phosphate synthase [EC:2.6.99.2] Vitamin B6 metabolism
Metabolic pathways
Biosynthesis of cofactors
Pyridoxal-P biosynthesis, erythrose-4P => pyridoxal-P

Protein Sequence

MSEVLLGVNIDHIATVRNARGTNYPDPVQAAFVAEQAGAEGITVHLREDRRHITDRDVELLRQTIQTRMNLEMAVTDEMVDIACRIRPAFCCLVPEKRQEVTTEGGLDVAGQKEKIARAVKRLTEAGIKVSLFIDPDHTQIDAADDVGAPFIEIHTGAYADAETSQEEDKEFIRIKDAVAYAAGKGLKVNAGHGLNYHNVQRVAALPAIYELNIGHAIIGRAVFSGLAAAVADMKTLLREARR

Flanking regions ( +/- flanking 50bp)

CTGAAAAAGGTTAAACTGAATAACAAAAGTTACCCGGAGGATGATAAAAAATGAGTGAAGTTTTATTGGGTGTAAACATTGACCACATTGCAACTGTCCGTAATGCACGAGGCACCAACTATCCTGACCCGGTTCAGGCGGCATTTGTCGCAGAGCAGGCGGGGGCGGAAGGTATCACTGTGCATCTGCGCGAAGACCGCCGTCATATCACCGACCGTGATGTGGAACTGCTGAGACAAACCATTCAGACCCGTATGAACCTGGAAATGGCGGTCACTGATGAAATGGTCGATATCGCCTGCCGTATCAGACCGGCATTCTGCTGCCTGGTACCGGAAAAGCGTCAGGAAGTTACTACGGAAGGCGGTCTGGATGTTGCCGGTCAGAAAGAAAAAATCGCCCGTGCGGTGAAACGTCTGACTGAAGCCGGAATTAAAGTCTCCCTGTTTATCGACCCTGACCATACCCAGATTGATGCTGCGGACGATGTCGGCGCGCCGTTTATTGAGATCCACACCGGTGCTTATGCGGACGCGGAAACGTCTCAGGAAGAAGACAAAGAATTTATCCGTATCAAAGATGCGGTTGCCTATGCGGCTGGTAAGGGCCTGAAAGTGAATGCCGGACACGGTCTGAACTATCACAACGTCCAGCGTGTTGCGGCACTGCCGGCGATTTATGAGCTGAATATCGGCCATGCGATCATCGGCCGTGCGGTCTTCAGCGGACTGGCTGCTGCTGTTGCGGATATGAAAACCCTGCTGCGGGAAGCCCGTCGTTAATGGCAATTGTCGGCATTGGTACAGATATTGTTGAAATAAGTCGTATTGAA