Homologs in group_537

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01230 FBDBKF_01230 76.8 Morganella morganii S1 purL phosphoribosylformylglycinamidine synthase
EHELCC_00315 EHELCC_00315 76.8 Morganella morganii S2 purL phosphoribosylformylglycinamidine synthase
NLDBIP_03145 NLDBIP_03145 76.8 Morganella morganii S4 purL phosphoribosylformylglycinamidine synthase
LHKJJB_04660 LHKJJB_04660 76.8 Morganella morganii S3 purL phosphoribosylformylglycinamidine synthase
HKOGLL_02385 HKOGLL_02385 76.8 Morganella morganii S5 purL phosphoribosylformylglycinamidine synthase
F4V73_RS07270 F4V73_RS07270 77.0 Morganella psychrotolerans purL phosphoribosylformylglycinamidine synthase

Distribution of the homologs in the orthogroup group_537

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_537

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N1Z4 0.0 2157 78 1 1295 3 purL Phosphoribosylformylglycinamidine synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q3YYZ8 0.0 2092 76 2 1295 3 purL Phosphoribosylformylglycinamidine synthase Shigella sonnei (strain Ss046)
Q8Z4L6 0.0 2090 75 2 1295 3 purL Phosphoribosylformylglycinamidine synthase Salmonella typhi
P15254 0.0 2088 76 2 1295 1 purL Phosphoribosylformylglycinamidine synthase Escherichia coli (strain K12)
Q31XT0 0.0 2088 76 2 1295 3 purL Phosphoribosylformylglycinamidine synthase Shigella boydii serotype 4 (strain Sb227)
P74881 0.0 2088 75 2 1295 1 purL Phosphoribosylformylglycinamidine synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XA46 0.0 2087 76 2 1295 3 purL Phosphoribosylformylglycinamidine synthase Escherichia coli O157:H7
Q667W1 0.0 2086 76 2 1296 3 purL Phosphoribosylformylglycinamidine synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CKD2 0.0 2083 75 2 1296 3 purL Phosphoribosylformylglycinamidine synthase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8FF26 0.0 2083 75 2 1295 3 purL Phosphoribosylformylglycinamidine synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q32D15 0.0 2080 75 2 1295 3 purL Phosphoribosylformylglycinamidine synthase Shigella dysenteriae serotype 1 (strain Sd197)
Q1R8H7 0.0 2080 75 2 1295 3 purL Phosphoribosylformylglycinamidine synthase Escherichia coli (strain UTI89 / UPEC)
Q8ZCQ2 0.0 2080 75 2 1296 3 purL Phosphoribosylformylglycinamidine synthase Yersinia pestis
Q1C5E7 0.0 2080 75 2 1296 3 purL Phosphoribosylformylglycinamidine synthase Yersinia pestis bv. Antiqua (strain Antiqua)
Q5PIG8 0.0 2079 75 2 1295 3 purL Phosphoribosylformylglycinamidine synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q0TET1 0.0 2078 75 2 1295 3 purL Phosphoribosylformylglycinamidine synthase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q57LE6 0.0 2078 75 2 1295 3 purL Phosphoribosylformylglycinamidine synthase Salmonella choleraesuis (strain SC-B67)
Q6D238 0.0 2070 75 2 1295 3 purL Phosphoribosylformylglycinamidine synthase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NS22 0.0 2020 74 1 1295 3 purL Phosphoribosylformylglycinamidine synthase Sodalis glossinidius (strain morsitans)
Q9KTN2 0.0 1938 70 3 1297 3 purL Phosphoribosylformylglycinamidine synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9CLW4 0.0 1917 71 4 1294 3 purL Phosphoribosylformylglycinamidine synthase Pasteurella multocida (strain Pm70)
Q8DF81 0.0 1909 69 3 1297 3 purL Phosphoribosylformylglycinamidine synthase Vibrio vulnificus (strain CMCP6)
Q7MN70 0.0 1906 69 3 1297 3 purL Phosphoribosylformylglycinamidine synthase Vibrio vulnificus (strain YJ016)
Q87RW0 0.0 1898 69 3 1302 3 purL Phosphoribosylformylglycinamidine synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q65RJ7 0.0 1892 70 4 1297 3 purL Phosphoribosylformylglycinamidine synthase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q0HKU9 0.0 1887 68 4 1293 3 purL Phosphoribosylformylglycinamidine synthase Shewanella sp. (strain MR-4)
Q5E749 0.0 1887 68 4 1303 3 purL Phosphoribosylformylglycinamidine synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6LU24 0.0 1884 68 5 1319 3 purL Phosphoribosylformylglycinamidine synthase Photobacterium profundum (strain SS9)
Q0I5H4 0.0 1881 69 5 1295 3 purL Phosphoribosylformylglycinamidine synthase Histophilus somni (strain 129Pt)
Q0HX47 0.0 1881 68 4 1293 3 purL Phosphoribosylformylglycinamidine synthase Shewanella sp. (strain MR-7)
Q8EC57 0.0 1873 68 4 1293 3 purL Phosphoribosylformylglycinamidine synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q3IHZ2 0.0 1870 68 6 1297 3 purL Phosphoribosylformylglycinamidine synthase Pseudoalteromonas translucida (strain TAC 125)
Q5QWY0 0.0 1862 68 3 1296 3 purL Phosphoribosylformylglycinamidine synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
P43847 0.0 1843 68 4 1297 3 purL Phosphoribosylformylglycinamidine synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q12PR7 0.0 1842 67 4 1296 3 purL Phosphoribosylformylglycinamidine synthase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q085S1 0.0 1842 66 4 1293 3 purL Phosphoribosylformylglycinamidine synthase Shewanella frigidimarina (strain NCIMB 400)
Q4QME6 0.0 1839 68 4 1297 3 purL Phosphoribosylformylglycinamidine synthase Haemophilus influenzae (strain 86-028NP)
Q15R69 0.0 1816 67 5 1296 3 purL Phosphoribosylformylglycinamidine synthase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q47XX7 0.0 1786 65 8 1314 3 purL Phosphoribosylformylglycinamidine synthase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q48LX3 0.0 1733 64 4 1296 3 purL Phosphoribosylformylglycinamidine synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q886W6 0.0 1727 64 4 1296 3 purL Phosphoribosylformylglycinamidine synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZX02 0.0 1727 64 4 1296 3 purL Phosphoribosylformylglycinamidine synthase Pseudomonas syringae pv. syringae (strain B728a)
Q4KHS6 0.0 1724 63 4 1296 3 purL Phosphoribosylformylglycinamidine synthase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3KHL4 0.0 1724 63 4 1296 3 purL Phosphoribosylformylglycinamidine synthase Pseudomonas fluorescens (strain Pf0-1)
Q88P16 0.0 1720 63 5 1297 3 purL Phosphoribosylformylglycinamidine synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9HXN2 0.0 1718 63 4 1300 3 purL Phosphoribosylformylglycinamidine synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2SK05 0.0 1704 63 4 1293 3 purL Phosphoribosylformylglycinamidine synthase Hahella chejuensis (strain KCTC 2396)
Q1H2I8 0.0 1612 61 6 1297 3 purL Phosphoribosylformylglycinamidine synthase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q1D9V4 0.0 1588 60 5 1297 3 purL Phosphoribosylformylglycinamidine synthase Myxococcus xanthus (strain DK1622)
Q8XYN6 0.0 1447 53 17 1374 3 purL Phosphoribosylformylglycinamidine synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9JWC5 0.0 1434 55 9 1321 3 purL Phosphoribosylformylglycinamidine synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JXK5 0.0 1418 54 9 1321 3 purL Phosphoribosylformylglycinamidine synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q5F7J4 0.0 1418 55 9 1322 3 purL Phosphoribosylformylglycinamidine synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q8PCQ7 0.0 1346 52 16 1361 3 purL Phosphoribosylformylglycinamidine synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PGR7 0.0 1324 51 17 1365 3 purL Phosphoribosylformylglycinamidine synthase Xanthomonas axonopodis pv. citri (strain 306)
Q87DN2 0.0 1295 51 14 1341 3 purL Phosphoribosylformylglycinamidine synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PDF6 0.0 1294 51 12 1334 3 purL Phosphoribosylformylglycinamidine synthase Xylella fastidiosa (strain 9a5c)
P38972 0.0 1286 50 27 1356 1 ADE6 Phosphoribosylformylglycinamidine synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O14228 0.0 1259 50 19 1331 1 ade3 Phosphoribosylformylglycinamidine synthase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9M8D3 0.0 842 39 18 1246 2 At1g74260 Probable phosphoribosylformylglycinamidine synthase, chloroplastic/mitochondrial Arabidopsis thaliana
Q54JC8 0.0 779 35 31 1373 1 purL Phosphoribosylformylglycinamidine synthase Dictyostelium discoideum
Q5SUR0 0.0 778 38 22 1262 1 Pfas Phosphoribosylformylglycinamidine synthase Mus musculus
O15067 0.0 756 37 23 1265 1 PFAS Phosphoribosylformylglycinamidine synthase Homo sapiens
P35421 0.0 738 37 25 1274 1 Pfas Phosphoribosylformylglycinamidine synthase Drosophila melanogaster
Q19311 0.0 660 34 32 1315 3 pfas-1 Probable phosphoribosylformylglycinamidine synthase Caenorhabditis elegans
Q6KZR2 8.41e-49 190 26 33 826 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q9HJA4 2.67e-45 180 26 32 847 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
O28339 1.35e-39 162 26 24 781 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q47TL8 6.93e-39 160 25 31 789 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermobifida fusca (strain YX)
A0QAT1 2.67e-38 158 26 32 821 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacterium avium (strain 104)
Q743F0 3.16e-38 158 26 32 824 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
C3PIW7 7.73e-38 157 25 30 831 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
P9WHL6 1.46e-37 155 26 29 805 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WHL7 1.92e-37 155 26 29 805 1 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A5U0J2 1.92e-37 155 26 29 805 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1ALD8 1.92e-37 155 26 29 805 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KGT6 1.92e-37 155 26 29 805 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A5T9 4.83e-37 154 26 29 778 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5Z2C3 9.81e-37 153 26 34 792 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Nocardia farcinica (strain IFM 10152)
Q8FMM3 1.59e-36 152 26 27 762 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q50023 4.22e-36 151 25 30 786 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacterium leprae (strain TN)
B8ZSV5 4.22e-36 151 25 30 786 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacterium leprae (strain Br4923)
B1MHY1 4.56e-36 151 26 30 781 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
A4QGY6 6.25e-36 150 26 27 826 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Corynebacterium glutamicum (strain R)
Q82FW4 6.31e-36 150 25 30 825 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
C4L299 1.57e-35 149 24 29 816 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
A1TFE0 1.84e-35 149 26 28 789 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q97BD5 2.82e-35 149 25 30 761 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
A1SPT8 3.45e-35 148 25 33 813 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q8NMI5 7.05e-35 147 25 27 826 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8RBK5 7.35e-35 147 24 34 842 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q3AD64 1.93e-34 145 25 28 829 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q58660 2.62e-34 145 25 32 781 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q6M0U0 3.8e-34 136 33 7 235 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A9WV65 5.57e-34 144 24 27 770 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
Q9RHW9 5.75e-34 144 25 29 820 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Corynebacterium ammoniagenes
C0ZP44 9.52e-34 144 24 27 810 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodococcus erythropolis (strain PR4 / NBRC 100887)
A4G010 3.12e-33 133 34 7 235 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q9REQ6 3.18e-33 142 26 29 755 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q2RWI3 5.62e-33 141 25 26 741 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q5FNL0 7.4e-33 140 25 25 764 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Gluconobacter oxydans (strain 621H)
Q0S766 1.12e-32 140 25 31 848 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodococcus jostii (strain RHA1)
Q2NAT8 1.24e-32 140 24 27 749 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Erythrobacter litoralis (strain HTCC2594)
Q9RKK5 1.68e-32 140 25 32 826 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B0K3Q4 1.97e-32 139 24 35 842 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermoanaerobacter sp. (strain X514)
B0KBQ5 2.5e-32 139 24 35 842 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q1WU59 4.11e-32 138 23 30 814 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Ligilactobacillus salivarius (strain UCC118)
A4T7J3 4.81e-32 138 25 30 796 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycolicibacterium gilvum (strain PYR-GCK)
Q8NX92 4.94e-32 138 25 35 829 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain MW2)
A8Z1L1 4.94e-32 138 25 35 829 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain USA300 / TCH1516)
Q6GAE4 4.94e-32 138 25 35 829 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain MSSA476)
A6QFS7 4.94e-32 138 25 35 829 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain Newman)
Q5HH15 4.94e-32 138 25 35 829 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain COL)
Q2FZJ0 4.94e-32 138 25 35 829 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FI09 4.94e-32 138 25 35 829 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain USA300)
Q0BRI4 5.4e-32 138 26 25 714 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
B9KZ38 6.29e-32 138 24 24 730 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
A6VIG8 6.35e-32 129 33 7 235 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
C5D4I0 6.47e-32 138 25 38 840 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Geobacillus sp. (strain WCH70)
C1ATA2 7.45e-32 138 25 31 848 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodococcus opacus (strain B4)
Q8ES96 8.34e-32 137 23 32 827 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A7HIJ4 8.35e-32 137 26 29 730 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Anaeromyxobacter sp. (strain Fw109-5)
Q2YX54 9.56e-32 137 24 35 829 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain bovine RF122 / ET3-1)
P65901 1.46e-31 137 25 37 829 1 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain N315)
P65900 1.46e-31 137 25 37 829 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRV6 1.46e-31 137 25 37 829 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain JH9)
A6U0N7 1.46e-31 137 25 37 829 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain JH1)
A7X0W1 1.46e-31 137 25 37 829 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q81IQ3 2.27e-31 136 24 35 843 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A8MCK2 2.89e-31 135 25 31 758 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Caldivirga maquilingensis (strain ATCC 700844 / DSM 13496 / JCM 10307 / IC-167)
B7IUV3 3.43e-31 135 24 37 844 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cereus (strain G9842)
Q02Y55 4.24e-31 135 26 25 672 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactococcus lactis subsp. cremoris (strain SK11)
B9DQ38 5.39e-31 135 26 35 773 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus carnosus (strain TM300)
B7H4T6 5.71e-31 135 24 37 844 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cereus (strain B4264)
B4UIX7 6.29e-31 135 26 29 723 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Anaeromyxobacter sp. (strain K)
A2RJW3 6.51e-31 135 26 25 672 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactococcus lactis subsp. cremoris (strain MG1363)
Q9ZB06 6.51e-31 135 26 25 672 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactococcus lactis subsp. cremoris
Q6GI15 7.79e-31 134 24 37 833 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain MRSA252)
A9VRF1 1.77e-30 133 24 36 844 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus mycoides (strain KBAB4)
Q8CPN9 1.81e-30 133 25 31 769 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQA1 2.03e-30 133 25 31 769 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q037U9 2.13e-30 133 26 27 637 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
C3N674 3.84e-30 132 24 35 811 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfolobus islandicus (strain M.16.27)
B9J1K5 3.91e-30 132 24 34 843 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cereus (strain Q1)
B7GFT8 4.33e-30 132 25 38 828 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Anoxybacillus flavithermus (strain DSM 21510 / WK1)
B7HS32 4.42e-30 132 24 36 844 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cereus (strain AH187)
Q65MS8 4.48e-30 132 24 35 827 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
C1EV63 4.66e-30 132 24 36 844 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cereus (strain 03BB102)
B7JM85 4.66e-30 132 24 36 844 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cereus (strain AH820)
Q81ZH2 4.66e-30 132 24 36 844 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus anthracis
A0R8Z6 4.66e-30 132 24 36 844 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus thuringiensis (strain Al Hakam)
C3L532 4.66e-30 132 24 36 844 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PBN0 4.66e-30 132 24 36 844 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus anthracis (strain A0248)
A4IJX3 4.98e-30 132 25 35 792 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Geobacillus thermodenitrificans (strain NG80-2)
Q9UX24 5.8e-30 131 24 33 801 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q73EN5 6.28e-30 131 24 36 844 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cereus (strain ATCC 10987 / NRS 248)
C3MW31 8.17e-30 131 24 36 813 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
Q03Y89 8.94e-30 131 25 36 778 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q83FE8 9.04e-30 131 24 29 798 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Tropheryma whipplei (strain Twist)
Q83H66 9.04e-30 131 24 29 798 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Tropheryma whipplei (strain TW08/27)
Q88U25 1.07e-29 131 23 30 828 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
C3NEN0 1.15e-29 130 24 36 813 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3NH14 1.15e-29 130 24 36 813 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3MQF3 1.15e-29 130 24 36 813 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C4KHN7 1.15e-29 130 24 36 813 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
Q6L0V9 1.23e-29 122 32 7 254 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q9CFE8 1.61e-29 130 25 27 689 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactococcus lactis subsp. lactis (strain IL1403)
A6TLS3 1.62e-29 130 26 33 765 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Alkaliphilus metalliredigens (strain QYMF)
A1RQQ2 1.89e-29 130 25 27 732 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pyrobaculum islandicum (strain DSM 4184 / JCM 9189 / GEO3)
Q01000 2.01e-29 131 21 26 730 4 3 Probable membrane antigen 3 Saimiriine herpesvirus 2 (strain 11)
Q6ACC3 2.53e-29 130 25 27 759 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Leifsonia xyli subsp. xyli (strain CTCB07)
Q4JXF0 2.59e-29 130 25 30 795 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Corynebacterium jeikeium (strain K411)
Q6HPA4 2.7e-29 129 24 36 844 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus thuringiensis subsp. konkukian (strain 97-27)
A5G1X4 3.31e-29 129 25 27 749 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Acidiphilium cryptum (strain JF-5)
Q63GT3 4.44e-29 129 24 38 844 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cereus (strain ZK / E33L)
Q833Y9 4.48e-29 129 24 29 761 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Enterococcus faecalis (strain ATCC 700802 / V583)
B1YBM5 8.07e-29 128 24 25 736 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pyrobaculum neutrophilum (strain DSM 2338 / JCM 9278 / NBRC 100436 / V24Sta)
Q2J4M9 9.36e-29 128 25 29 805 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
O67691 1.74e-28 127 24 29 794 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Aquifex aeolicus (strain VF5)
A8ABX6 1.87e-28 127 24 24 719 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
A7GKH8 1.94e-28 127 24 35 843 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q2RGU5 2.07e-28 127 24 32 771 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q7NIR9 2.31e-28 127 24 25 800 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A4WMV7 2.44e-28 126 23 26 771 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321 / PZ6)
Q9HIM1 2.58e-28 118 31 7 233 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q9QR70 2.74e-28 127 22 26 736 4 ORF75 Protein ORF75 Human herpesvirus 8 type P (isolate GK18)
Q6A6C0 3.04e-28 126 23 26 790 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q7VEK9 3.04e-28 126 23 32 849 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
P72644 4.86e-28 125 24 28 789 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A9BIH4 5e-28 125 23 28 807 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Petrotoga mobilis (strain DSM 10674 / SJ95)
B9EAY8 5.52e-28 125 25 30 771 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Macrococcus caseolyticus (strain JCSC5402)
Q5L3D2 6.41e-28 125 25 32 787 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Geobacillus kaustophilus (strain HTA426)
Q5SMH8 6.55e-28 125 24 29 773 1 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72IH7 6.55e-28 125 24 29 773 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q2IHC1 6.74e-28 125 26 29 723 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Anaeromyxobacter dehalogenans (strain 2CP-C)
B0C6R3 7.46e-28 125 23 33 843 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Acaryochloris marina (strain MBIC 11017)
Q8ZZJ7 8.25e-28 124 27 14 442 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
A8LCI3 9.43e-28 125 25 32 804 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Parafrankia sp. (strain EAN1pec)
A8FAM7 1e-27 124 24 29 775 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus pumilus (strain SAFR-032)
A8F8I3 1.04e-27 124 24 28 782 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
P11282 1.05e-27 125 22 30 742 4 75 Probable membrane antigen 75 Saimiriine herpesvirus 2 (strain 11)
Q18JI5 1.21e-27 124 25 24 727 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q49WJ3 1.51e-27 124 23 30 814 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2G630 2.23e-27 123 24 32 767 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q4L578 2.46e-27 123 24 36 822 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus haemolyticus (strain JCSC1435)
A4WQY3 2.87e-27 123 24 30 747 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q3J273 4.41e-27 122 24 32 754 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
B9KSY5 8.26e-27 121 25 34 754 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q07R72 8.48e-27 122 24 27 729 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodopseudomonas palustris (strain BisA53)
C6A0I0 1.17e-26 121 23 25 784 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermococcus sibiricus (strain DSM 12597 / MM 739)
A2BTV9 1.42e-26 121 22 26 749 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain MIT 9515)
B8JBS8 1.49e-26 121 26 28 723 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
P12042 2.69e-26 120 24 36 827 1 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus subtilis (strain 168)
Q97C36 2.74e-26 112 29 7 233 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
B2GF74 2.95e-26 120 22 31 800 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q8PYK1 3.58e-26 119 26 33 743 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
A8I8B0 4.83e-26 119 23 24 720 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
O59621 6.15e-26 119 23 26 747 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q9KF57 6.59e-26 119 23 29 806 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q3Z9H5 7.51e-26 111 31 9 263 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q11IV2 7.66e-26 119 24 28 765 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Chelativorans sp. (strain BNC1)
Q3KSV4 8.02e-26 119 24 28 730 3 BNRF1 Major tegument protein Epstein-Barr virus (strain GD1)
Q13AA1 8.58e-26 118 24 29 740 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodopseudomonas palustris (strain BisB5)
Q5WJ86 8.95e-26 118 25 25 649 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Shouchella clausii (strain KSM-K16)
Q218N3 9.44e-26 118 24 27 765 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodopseudomonas palustris (strain BisB18)
Q4FLJ4 1.22e-25 118 22 32 817 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pelagibacter ubique (strain HTCC1062)
P03179 1.37e-25 119 24 28 730 1 BNRF1 Major tegument protein Epstein-Barr virus (strain B95-8)
B9LT08 1.39e-25 118 30 12 391 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
B2IC83 1.4e-25 117 24 26 738 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q98NN7 1.4e-25 118 24 24 736 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P35852 2.03e-25 117 25 27 637 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lacticaseibacillus casei
A4YRR9 2.49e-25 117 24 29 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bradyrhizobium sp. (strain ORS 278)
Q8TIT6 2.63e-25 117 26 31 732 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
C5A4U6 2.72e-25 117 23 25 730 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
Q1HVJ0 3.51e-25 117 24 28 730 1 BNRF1 Major tegument protein Epstein-Barr virus (strain AG876)
Q163V9 3.55e-25 116 24 26 753 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A3MXD4 4.07e-25 116 27 12 410 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pyrobaculum calidifontis (strain DSM 21063 / JCM 11548 / VA1)
C3MD72 5.83e-25 115 23 31 809 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q7M9L5 6.99e-25 115 24 26 765 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q67KF8 7.11e-25 115 23 27 731 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q8U491 7.26e-25 115 22 31 832 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q5FIV1 8.17e-25 115 22 34 829 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q5V2D3 1.79e-24 114 26 32 792 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q71YP9 1.84e-24 114 23 32 827 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Listeria monocytogenes serotype 4b (strain F2365)
C1KW68 2.14e-24 114 23 32 827 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Listeria monocytogenes serotype 4b (strain CLIP80459)
A1UT47 2.46e-24 114 24 29 734 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q2JI39 2.49e-24 114 23 32 827 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Synechococcus sp. (strain JA-2-3B'a(2-13))
A5EMI1 2.51e-24 114 24 29 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q2NEB6 2.56e-24 114 22 27 743 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
B8DDY8 2.61e-24 114 23 31 821 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Listeria monocytogenes serotype 4a (strain HCC23)
A7H373 2.88e-24 113 23 32 801 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q6FZI9 2.97e-24 113 23 26 738 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bartonella quintana (strain Toulouse)
A0AJM3 2.99e-24 113 22 29 819 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q6G335 3.01e-24 113 24 29 729 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q049L7 3.11e-24 113 24 29 743 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G9F8 3.11e-24 113 24 29 743 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q3M6Z4 3.59e-24 113 23 30 788 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A7HWB1 4.09e-24 113 24 32 742 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q9KH12 4.13e-24 113 23 30 805 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhizobium fredii (strain HH103)
Q8Y6C1 4.16e-24 113 23 33 822 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q5JFL7 5.46e-24 112 23 27 768 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A2BNC9 6.42e-24 112 23 31 784 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain AS9601)
A8G1Z0 6.94e-24 112 22 29 781 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain MIT 9215)
Q3IQL3 6.95e-24 112 27 14 461 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
A9IVH5 1.03e-23 112 23 32 804 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q28QC2 1.14e-23 111 23 25 736 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Jannaschia sp. (strain CCS1)
Q9RXT4 1.22e-23 111 26 28 753 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A1B943 1.23e-23 111 26 17 441 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Paracoccus denitrificans (strain Pd 1222)
Q3ST22 1.24e-23 111 24 26 722 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A2BZA6 2.15e-23 111 23 29 767 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain NATL1A)
Q5HUK4 2.66e-23 110 23 31 801 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Campylobacter jejuni (strain RM1221)
Q46I59 2.74e-23 110 23 29 793 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain NATL2A)
O29008 2.89e-23 104 31 8 242 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q9HR49 3.21e-23 110 26 15 476 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R4B5 3.21e-23 110 26 15 476 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q2ITQ2 3.8e-23 110 24 27 765 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodopseudomonas palustris (strain HaA2)
Q8YR06 4.33e-23 110 22 28 791 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A6UX13 5.41e-23 109 26 14 437 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
A6QAK6 5.71e-23 109 23 26 725 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfurovum sp. (strain NBC37-1)
Q92AN9 6e-23 109 23 34 827 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q1QMU2 6.18e-23 109 23 30 771 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A5UMW9 6.9e-23 109 23 31 749 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A8Z6J5 7.14e-23 109 23 30 781 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Campylobacter concisus (strain 13826)
Q31DI1 7.28e-23 109 22 31 757 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain MIT 9312)
A7Z249 8.76e-23 108 23 37 832 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q2RZ77 1.42e-22 108 24 29 761 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Salinibacter ruber (strain DSM 13855 / M31)
Q7VF52 1.56e-22 108 23 30 771 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Helicobacter hepaticus (strain ATCC 51449 / 3B1)
B2G5B8 1.58e-22 108 22 33 824 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VHT8 1.58e-22 108 22 33 824 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Limosilactobacillus reuteri (strain DSM 20016)
Q5LS98 1.95e-22 107 24 31 744 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q73MV2 2.12e-22 102 29 7 243 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q89IC0 2.54e-22 107 24 28 749 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q2K7X0 2.74e-22 107 23 28 758 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B3Q7H9 3.15e-22 107 25 28 742 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodopseudomonas palustris (strain TIE-1)
A3PA50 3.6e-22 107 22 27 752 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain MIT 9301)
Q6N9F2 4.12e-22 107 24 28 742 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q1MG23 4.53e-22 106 23 28 756 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B9JVW2 4.74e-22 106 23 25 742 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q2JQL7 5.69e-22 106 24 28 814 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Synechococcus sp. (strain JA-3-3Ab)
B5ZQU1 1.48e-21 105 23 28 758 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhizobium leguminosarum bv. trifolii (strain WSM2304)
A6X1J9 2.14e-21 104 23 29 756 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B9KFP6 2.65e-21 104 25 18 512 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
A8FM09 3.52e-21 103 23 31 786 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
B2IU46 4.46e-21 103 22 33 800 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q3ARU4 5.5e-21 103 24 34 807 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Chlorobium chlorochromatii (strain CaD3)
Q8YGN1 6.27e-21 103 23 28 733 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RIH1 6.27e-21 103 23 28 733 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella melitensis biotype 2 (strain ATCC 23457)
Q57DR8 6.27e-21 103 23 28 733 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella abortus biovar 1 (strain 9-941)
Q2YNG6 6.27e-21 103 23 28 733 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella abortus (strain 2308)
B2S573 6.27e-21 103 23 28 733 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella abortus (strain S19)
Q1GHL5 6.28e-21 103 25 16 496 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Ruegeria sp. (strain TM1040)
Q92PH7 6.58e-21 103 23 27 754 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhizobium meliloti (strain 1021)
A2C5J9 8.87e-21 102 28 14 364 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain MIT 9303)
Q8G183 1.03e-20 102 23 28 733 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella suis biovar 1 (strain 1330)
B0CLG4 1.03e-20 102 23 28 733 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VQ15 1.03e-20 102 23 28 733 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A9MAL4 1.03e-20 102 23 28 733 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9A5F0 1.11e-20 102 24 27 728 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A6U9L9 1.3e-20 102 23 28 746 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sinorhizobium medicae (strain WSM419)
Q30T55 1.35e-20 102 23 31 765 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q9PNY0 1.39e-20 102 23 32 787 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q7V9E5 1.5e-20 102 28 14 364 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain MIT 9313)
Q3ANP7 1.67e-20 101 28 17 395 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Synechococcus sp. (strain CC9605)
Q8UEB0 1.83e-20 101 22 26 782 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Agrobacterium fabrum (strain C58 / ATCC 33970)
Q66675 1.87e-20 102 23 27 752 4 75 Probable membrane antigen 75 Equine herpesvirus 2 (strain 86/87)
Q3B3Y0 2.12e-20 101 24 39 822 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A1VZU6 2.28e-20 101 23 32 787 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q8TY09 2.58e-20 100 25 15 464 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q2S567 3.05e-20 94 33 6 207 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Salinibacter ruber (strain DSM 13855 / M31)
Q9X0X3 3.3e-20 100 25 17 453 1 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q2RGU4 3.7e-20 94 37 7 185 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
C0ZKC5 4.26e-20 94 30 9 233 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
A7GYY9 4.29e-20 100 26 18 473 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Campylobacter curvus (strain 525.92)
A4YI68 4.81e-20 100 23 31 755 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
Q8TX85 4.94e-20 94 34 8 225 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
O27427 6.62e-20 99 22 24 770 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q9UXW6 8.48e-20 99 23 24 722 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pyrococcus abyssi (strain GE5 / Orsay)
Q7V3R5 8.7e-20 99 22 25 744 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A7I157 1.38e-19 98 23 29 759 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q3B100 1.74e-19 98 27 15 392 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Synechococcus sp. (strain CC9902)
Q9UXW5 2.07e-19 92 33 9 225 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Pyrococcus abyssi (strain GE5 / Orsay)
Q8DIA7 3.06e-19 97 22 29 749 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q4J8F8 3.49e-19 97 24 28 663 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q7UA92 3.87e-19 97 28 17 395 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Parasynechococcus marenigrum (strain WH8102)
A7GKH7 7.17e-19 90 32 10 232 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q5N1Y6 7.46e-19 96 27 16 381 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55041 7.46e-19 96 27 16 381 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B8EPE8 8.28e-19 96 25 15 445 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q5SI57 1e-18 90 35 9 225 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q66609 1.05e-18 96 22 28 730 4 3 Probable membrane antigen 3 Equine herpesvirus 2 (strain 86/87)
Q72IH9 1.06e-18 90 35 9 225 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
B9KZ37 1.27e-18 90 35 6 188 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
Q72PR5 1.79e-18 95 23 33 822 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A5GHL4 1.98e-18 95 27 17 403 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Synechococcus sp. (strain WH7803)
A9VRF0 2.32e-18 89 30 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus mycoides (strain KBAB4)
Q38XW7 2.45e-18 94 23 29 757 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Latilactobacillus sakei subsp. sakei (strain 23K)
Q46F25 2.46e-18 94 27 15 462 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanosarcina barkeri (strain Fusaro / DSM 804)
Q81IQ4 2.5e-18 89 30 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7H4T5 2.5e-18 89 30 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cereus (strain B4264)
Q8U492 2.74e-18 88 34 11 226 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8F6I3 3e-18 94 23 33 822 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q5JFP4 3.35e-18 88 33 9 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q5N459 3.49e-18 88 35 9 196 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31Q18 3.49e-18 88 35 9 196 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B0C7S1 3.7e-18 88 37 8 183 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Acaryochloris marina (strain MBIC 11017)
O59619 5.3e-18 87 34 11 226 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P26500 5.85e-18 93 23 28 777 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
A6Q3E8 6.61e-18 93 26 13 362 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Nitratiruptor sp. (strain SB155-2)
Q053V5 8.54e-18 93 23 38 818 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04QS4 8.54e-18 93 23 38 818 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q468N4 8.66e-18 87 30 9 235 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanosarcina barkeri (strain Fusaro / DSM 804)
B3PPS1 1.34e-17 92 25 17 438 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhizobium etli (strain CIAT 652)
B7IUV2 1.42e-17 86 29 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cereus (strain G9842)
Q30TB2 1.85e-17 86 29 8 230 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A0R8Z5 2.19e-17 86 29 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus thuringiensis (strain Al Hakam)
Q6HPA5 2.24e-17 86 29 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus thuringiensis subsp. konkukian (strain 97-27)
B7HS31 2.24e-17 86 29 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cereus (strain AH187)
Q73EN6 2.24e-17 86 29 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JM84 2.24e-17 86 29 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cereus (strain AH820)
Q81ZH3 2.24e-17 86 29 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus anthracis
C3L531 2.24e-17 86 29 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PBM9 2.24e-17 86 29 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus anthracis (strain A0248)
A0B5C7 2.33e-17 91 23 32 775 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
Q5FIV0 3.15e-17 85 29 8 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q8PTB0 3.78e-17 85 27 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8DGX5 4.73e-17 85 35 10 196 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
C1EV62 5.85e-17 85 29 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cereus (strain 03BB102)
Q63GT4 7.08e-17 84 29 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cereus (strain ZK / E33L)
B9J1K4 7.08e-17 84 29 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cereus (strain Q1)
Q7V834 7.52e-17 84 34 7 185 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Prochlorococcus marinus (strain MIT 9313)
B8HRP1 7.52e-17 90 25 12 363 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Cyanothece sp. (strain PCC 7425 / ATCC 29141)
A8YW85 8.55e-17 89 24 18 505 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactobacillus helveticus (strain DPC 4571)
A8YW85 1.54e-05 53 26 4 147 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactobacillus helveticus (strain DPC 4571)
B2GF73 1.05e-16 84 30 9 231 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
B2G5B7 1.2e-16 84 30 8 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VHT7 1.2e-16 84 30 8 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Limosilactobacillus reuteri (strain DSM 20016)
Q9HNU2 1.26e-16 84 34 7 223 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q8TPF0 1.31e-16 84 29 9 232 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q5LS78 1.7e-16 83 31 8 228 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q18FM4 2.61e-16 83 30 7 223 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
B9JFQ3 2.98e-16 88 24 17 435 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
C4L298 5.01e-16 82 31 7 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q2NF29 5.46e-16 82 28 9 233 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q8CPP0 6.26e-16 82 28 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQA2 6.26e-16 82 28 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5FNL1 7.19e-16 82 33 7 189 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Gluconobacter oxydans (strain 621H)
B8DDY7 7.55e-16 81 28 8 249 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Listeria monocytogenes serotype 4a (strain HCC23)
Q88U24 7.98e-16 81 29 6 204 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q1GGM0 9.05e-16 81 30 7 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Ruegeria sp. (strain TM1040)
Q8Y6C0 1.37e-15 80 27 8 249 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q3AD65 1.69e-15 80 32 6 186 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A8F8I4 1.93e-15 80 32 10 201 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q9CFE7 2.37e-15 80 28 8 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Lactococcus lactis subsp. lactis (strain IL1403)
P99166 2.48e-15 80 29 7 229 1 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus aureus (strain N315)
P65904 2.48e-15 80 29 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GAE5 2.51e-15 80 29 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus aureus (strain MSSA476)
Q71YP8 2.72e-15 80 28 9 250 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Listeria monocytogenes serotype 4b (strain F2365)
C1KW69 2.72e-15 80 28 9 250 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Listeria monocytogenes serotype 4b (strain CLIP80459)
Q8NX93 3e-15 79 29 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus aureus (strain MW2)
Q5HH16 3e-15 79 29 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus aureus (strain COL)
Q2FZJ1 3e-15 79 29 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FI10 3e-15 79 29 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus aureus (strain USA300)
Q2YX55 3.96e-15 79 29 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q3AII4 4.22e-15 79 32 6 185 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Synechococcus sp. (strain CC9605)
Q8KD17 4.25e-15 84 23 31 758 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8RBK6 4.93e-15 79 30 7 191 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B3WF98 5e-15 79 33 7 186 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Lacticaseibacillus casei (strain BL23)
Q92AN8 5.24e-15 79 28 9 250 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q2G9J6 6.32e-15 79 34 6 182 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q55843 7.77e-15 78 32 6 186 1 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O67190 7.8e-15 78 28 6 199 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Aquifex aeolicus (strain VF5)
Q49WJ2 8.62e-15 78 27 8 250 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B1YJ04 9.52e-15 78 29 10 254 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q2RWI2 9.72e-15 78 33 8 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q2ITP9 1.1e-14 78 31 8 222 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Rhodopseudomonas palustris (strain HaA2)
Q8YGN4 1.19e-14 78 30 9 227 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q57DR5 1.19e-14 78 30 9 227 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Brucella abortus biovar 1 (strain 9-941)
Q2YNG3 1.19e-14 78 30 9 227 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Brucella abortus (strain 2308)
Q4FLJ5 1.19e-14 78 29 6 222 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Pelagibacter ubique (strain HTCC1062)
Q1IPG4 1.21e-14 78 32 8 184 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Koribacter versatilis (strain Ellin345)
Q8ES97 1.3e-14 78 33 8 191 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q92PI1 1.35e-14 77 30 8 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Rhizobium meliloti (strain 1021)
O36422 1.37e-14 83 21 28 736 4 75 Probable membrane antigen 75 Alcelaphine herpesvirus 1 (strain C500)
Q6GI16 1.43e-14 77 29 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus aureus (strain MRSA252)
Q2K7X5 1.84e-14 77 30 8 227 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q3MG53 1.93e-14 77 32 6 183 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q9UX21 1.99e-14 77 27 8 222 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
B1HTV3 1.99e-14 77 30 10 247 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Lysinibacillus sphaericus (strain C3-41)
Q037U8 2.01e-14 77 32 7 191 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q1J2B6 2.02e-14 77 34 6 173 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q8G180 2.36e-14 77 30 9 227 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Brucella suis biovar 1 (strain 1330)
A6TLS2 2.7e-14 77 33 7 182 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Alkaliphilus metalliredigens (strain QYMF)
O26270 2.81e-14 77 29 9 226 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q6A6B0 3.11e-14 77 32 7 223 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q6FZJ0 3.35e-14 76 27 10 233 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bartonella quintana (strain Toulouse)
A0AJM4 3.39e-14 77 26 8 249 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q9ZB07 3.42e-14 77 27 8 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Lactococcus lactis subsp. cremoris
Q9KF58 4.46e-14 76 29 9 255 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q7U831 4.55e-14 76 33 7 186 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Parasynechococcus marenigrum (strain WH8102)
Q3IMR2 4.58e-14 76 33 7 173 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q970V6 4.74e-14 80 22 26 697 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q9RXT3 4.84e-14 76 34 6 173 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q6N376 6.46e-14 76 31 8 222 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q1MG27 6.5e-14 75 30 8 227 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8YU79 7.79e-14 75 32 6 183 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8NMI4 8.01e-14 75 31 6 193 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q1AXB7 8.15e-14 75 33 10 225 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q6G336 1.2e-13 75 27 11 249 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q833Y8 1.29e-13 75 30 8 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Enterococcus faecalis (strain ATCC 700802 / V583)
Q7M9X7 1.37e-13 74 29 8 223 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q67KF7 1.71e-13 75 29 8 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q5Z2C8 2.69e-13 74 30 7 223 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Nocardia farcinica (strain IFM 10152)
B7GFT7 2.75e-13 74 30 9 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Anoxybacillus flavithermus (strain DSM 21510 / WK1)
B0ST16 3.04e-13 78 26 15 372 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SB88 3.04e-13 78 26 15 372 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q59042 3.35e-13 73 26 7 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q3AYR1 3.96e-13 73 31 7 186 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Synechococcus sp. (strain CC9902)
Q1GVL0 4.09e-13 73 35 7 181 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q28PA2 4.16e-13 73 30 8 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Jannaschia sp. (strain CCS1)
Q7VFQ4 5.69e-13 73 28 8 223 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q218N7 7.31e-13 73 31 8 222 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Rhodopseudomonas palustris (strain BisB18)
Q7V1S5 7.49e-13 72 31 7 198 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q98NN0 8e-13 72 29 9 227 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9RHX0 9.48e-13 72 29 8 231 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Corynebacterium ammoniagenes
Q8KCS5 9.88e-13 72 30 7 183 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B3QMT1 1.05e-12 73 31 8 186 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q2IG97 1.3e-12 72 29 8 185 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Anaeromyxobacter dehalogenans (strain 2CP-C)
Q31B97 1.39e-12 72 32 7 198 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Prochlorococcus marinus (strain MIT 9312)
Q2JWK2 1.41e-12 72 33 8 187 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Synechococcus sp. (strain JA-3-3Ab)
Q5NMA4 1.52e-12 72 29 8 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q89IB6 1.99e-12 72 33 7 178 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q11IV0 2.66e-12 71 28 8 226 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Chelativorans sp. (strain BNC1)
Q0S774 2.78e-12 71 29 8 223 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Rhodococcus jostii (strain RHA1)
Q167J3 3.67e-12 70 29 8 222 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q4L577 4.11e-12 70 27 8 250 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus haemolyticus (strain JCSC1435)
P12041 4.13e-12 70 30 8 224 1 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus subtilis (strain 168)
Q46LE9 4.2e-12 70 29 6 183 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Prochlorococcus marinus (strain NATL2A)
Q1G9F7 4.51e-12 70 26 8 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q38XW8 4.58e-12 70 31 7 184 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Latilactobacillus sakei subsp. sakei (strain 23K)
Q65MS9 4.94e-12 70 32 10 225 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A7Z248 5.13e-12 70 29 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09255
Feature type CDS
Gene purL
Product phosphoribosylformylglycinamidine synthase
Location 2018372 - 2022262 (strand: -1)
Length 3891 (nucleotides) / 1296 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_537
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02769 AIR synthase related protein, C-terminal domain
PF13507 CobB/CobQ-like glutamine amidotransferase domain
PF18072 Formylglycinamide ribonucleotide amidotransferase linker domain
PF18076 Formylglycinamide ribonucleotide amidotransferase N-terminal
PF22689 FGAR-AT PurM_N-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0046 Nucleotide transport and metabolism (F) F Phosphoribosylformylglycinamidine (FGAM) synthase, synthetase domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01952 phosphoribosylformylglycinamidine synthase [EC:6.3.5.3] Purine metabolism
Metabolic pathways
Biosynthesis of secondary metabolites		 De novo purine biosynthesis, PRPP + glutamine => IMP

Protein Sequence

MEILRGSPALSAFRINKLLTLCQENQLPVRGIYAEFIHFVKVDGQLSEDEQAKLSKLLHYGPSLTEHELVGEMRIVVPRPGTISPWSTKATDIAHNCGLTQVVRIERGIAYYIDSDTMAEEQWQLLYGFIYDRMMETIFTDYQQVNALFAEQTPTPLKTIDVLAHGKDALVAANIEMGLALADDEVDYLVDAFKRLQRNPTDVELYMFAQANSEHCRHKIFNADWIIDGKAQDKSLFKMIKNTFEQTPDYVLSAYKDNAAVMEGSVAGRFYPDTEKGHYRYHQEPVHILMKVETHNHPTAISPWPGAATGSGGEIRDEGATGRGAKPKAGLVGFSVSNLRIPGFEQPWEEDFGRPERIVSALDIMTEGPLGGAAFNNEFGRPALLGYFRTYEEQVNSHNGVEIRGYHKPIMLAGGIGNIREDHVQKGEISVGAKLIVLGGPSMNIGLGGGAASSMTSGQSDADLDFASVQRDNPEMERRCQEVIDRCWQLGDDNPILFIHDVGAGGLSNAMPELVNDGGRGGRFELRNVLNDEPGMSPLEIWCNESQERYVLAVSPEKMPLFDALCQRERAPYAVIGEATQERELVLNDTHFDNKPIDMPLDILLGKAPKMLRDVTSHKTAGEYLDRKDIDLKEAVYRVLHLPAVAEKTFLITIGDRSVTGMVARDQMVGPWQIPVANCAVTTATLDSYYGEAMSIGERAPIALLDFAASARMAVGEALTNMAGCDVQSLNRIKLSANWMAAAGHPGEDAGLYDAVKAIGEELCPQLGITIPVGKDSMSMKTRWQDEQGKTKEVISPLSLVITAFSRVEDVRKTVTPELSTQEGNRLYLIDLGNGHNALGATALAQVYRQLGQKAADLRDVEQLKQFFNVIQQLVSDGKLLAYHDRSDGGLFVTLAEMAFAGHCGLNVDISAYDEDILAGLFNEELGAVFQIKREHQESVETLFTEHGLADCLHYLGQATPSDDIIIQSRETEVYHEKRSTLRVWWAETTWQMQRLRDNPECADEEHRAKQDSHDPGLNVHLTFDPAEDIAAPYIATGSRPRIAVLREQGVNSHVEMAAAFDRAGFDAIDVHMSDLHTAQRSLSDFDVLVACGGFSYGDVLGAGEGWAKSILFNHRLRDEFAQFFARQDTLSLGVCNGCQMMSTLAELIPGADLWPRFVRNRSERFEARFSLVKVTDSPSLLLQGMAGSQMPIAVSHGEGFAEFRDAAQLAQLEAKNLVGLRFVDHYGQPTEQYPLNPNGSVKGITAVTTTDGRSTIMMPHPERVFRTVSHSWHPENWGEDSPWMRLFRNARKQFD

Flanking regions ( +/- flanking 50bp)

TCCCCTGAATGATTGATCAGGCTAGCTGCTAAAAGAGAGAACTCAATATTATGGAAATCCTGCGTGGCTCCCCCGCTTTATCCGCTTTTCGTATTAATAAACTATTAACTTTATGTCAGGAAAACCAACTTCCTGTCCGTGGTATTTATGCGGAGTTTATCCATTTTGTAAAAGTGGATGGACAGCTATCTGAAGATGAACAAGCTAAATTAAGCAAGTTACTGCACTATGGCCCTTCATTAACAGAGCATGAGCTTGTTGGAGAGATGCGTATTGTTGTACCACGACCGGGAACCATTTCGCCATGGTCGACTAAAGCGACAGATATTGCCCATAATTGTGGTTTAACACAAGTGGTTAGAATTGAACGTGGTATTGCTTATTATATAGATAGCGATACGATGGCCGAAGAACAGTGGCAGTTGTTATACGGTTTTATTTATGATCGTATGATGGAAACAATTTTTACCGATTATCAACAAGTTAATGCGCTATTTGCTGAACAGACACCCACCCCATTAAAAACAATTGATGTTCTTGCTCACGGTAAAGATGCGCTAGTTGCTGCCAATATTGAAATGGGGTTAGCGCTGGCTGATGATGAAGTTGATTATCTAGTAGATGCTTTTAAACGTTTGCAACGCAATCCAACTGATGTAGAACTTTATATGTTCGCTCAAGCAAACTCAGAGCATTGCCGTCATAAAATTTTTAATGCAGATTGGATAATCGACGGTAAAGCGCAAGACAAATCATTATTTAAAATGATTAAAAATACTTTTGAGCAAACTCCTGATTATGTCTTGTCGGCTTATAAAGATAATGCTGCTGTAATGGAAGGCTCCGTTGCTGGGCGTTTTTATCCCGATACGGAAAAAGGGCATTACCGTTATCATCAAGAGCCTGTCCATATCTTAATGAAAGTGGAAACGCACAATCACCCAACGGCAATTTCTCCGTGGCCTGGTGCAGCAACCGGCTCTGGCGGTGAAATTCGTGATGAAGGGGCGACAGGCCGTGGGGCAAAACCTAAAGCGGGTTTAGTCGGTTTTTCCGTTTCTAACTTACGTATTCCGGGGTTTGAACAACCTTGGGAAGAAGATTTTGGCAGACCAGAACGTATTGTCAGTGCACTGGACATTATGACAGAAGGCCCTTTAGGTGGAGCCGCATTTAATAATGAATTTGGTCGCCCCGCCTTATTAGGTTATTTCAGAACCTATGAAGAGCAGGTTAATAGTCATAATGGTGTTGAAATTCGAGGCTACCATAAACCTATTATGTTGGCTGGTGGTATTGGTAATATTCGCGAAGATCACGTGCAAAAAGGTGAGATCTCCGTGGGTGCTAAGTTAATTGTACTTGGTGGCCCATCGATGAATATCGGCCTAGGCGGTGGTGCGGCTTCTTCTATGACTTCCGGCCAGTCAGATGCTGATTTAGATTTTGCTTCTGTGCAACGAGATAACCCAGAAATGGAGCGTCGTTGCCAAGAGGTTATCGATCGCTGTTGGCAATTAGGTGATGATAACCCGATTTTATTTATTCATGATGTCGGAGCGGGGGGGCTTTCTAATGCCATGCCTGAGCTTGTCAATGATGGCGGGCGTGGAGGTCGTTTTGAGTTACGTAACGTTTTAAATGATGAACCGGGTATGAGTCCTCTAGAGATCTGGTGTAATGAGTCGCAAGAGCGTTATGTATTAGCGGTATCCCCAGAAAAAATGCCACTATTTGATGCGCTATGCCAACGAGAAAGAGCCCCTTACGCTGTCATTGGCGAGGCAACACAAGAGCGTGAGTTAGTGTTAAATGATACACATTTTGATAATAAACCAATAGATATGCCTTTAGATATCTTGTTAGGTAAAGCGCCGAAAATGTTGCGTGATGTCACATCACATAAAACAGCAGGTGAATATCTCGATCGTAAAGATATCGATTTAAAAGAAGCGGTTTATCGCGTACTTCATTTACCCGCCGTTGCTGAGAAGACGTTCTTAATTACTATTGGTGATCGTAGTGTTACGGGAATGGTTGCGCGTGACCAAATGGTTGGACCTTGGCAAATTCCGGTGGCTAACTGTGCGGTAACAACGGCCACATTAGATAGTTATTACGGCGAGGCGATGTCAATAGGGGAAAGAGCCCCTATTGCACTATTAGATTTTGCCGCATCAGCGCGAATGGCGGTAGGTGAAGCCTTAACCAATATGGCGGGTTGCGATGTACAGTCACTTAATCGTATAAAACTTTCCGCAAACTGGATGGCTGCGGCGGGTCACCCTGGTGAAGATGCGGGATTATATGATGCAGTAAAAGCCATTGGTGAAGAGCTATGCCCACAATTAGGTATTACTATTCCGGTGGGTAAGGACTCAATGTCCATGAAAACGCGTTGGCAAGATGAACAAGGGAAAACGAAAGAAGTTATTTCCCCTCTCTCTTTAGTTATCACCGCATTTTCCCGTGTTGAAGATGTACGTAAAACTGTCACCCCTGAGCTTTCTACCCAAGAAGGAAACCGTTTATATCTAATCGATTTAGGTAATGGTCATAATGCATTAGGGGCAACAGCATTAGCTCAGGTTTATCGTCAGCTAGGACAAAAAGCGGCTGATTTACGTGATGTAGAGCAGTTAAAACAGTTTTTTAATGTCATTCAACAATTGGTGAGCGACGGTAAATTACTGGCTTATCATGACCGCTCTGATGGTGGCTTATTTGTGACTTTGGCCGAAATGGCGTTTGCGGGACATTGTGGCCTTAATGTTGATATCAGTGCTTATGACGAAGATATTTTAGCCGGTCTATTTAATGAAGAGCTAGGTGCGGTGTTCCAAATTAAAAGGGAGCATCAAGAAAGCGTTGAAACACTGTTTACTGAACATGGTTTAGCAGATTGTTTACATTACTTAGGGCAAGCAACACCAAGTGATGACATTATTATTCAAAGCCGTGAAACGGAAGTTTACCATGAAAAGCGTAGTACATTACGTGTCTGGTGGGCTGAAACGACATGGCAAATGCAACGTTTACGTGATAATCCTGAATGTGCAGATGAAGAACATCGTGCCAAACAAGATAGTCACGATCCGGGATTAAATGTTCACTTAACCTTTGATCCCGCAGAGGATATTGCGGCGCCTTATATTGCTACAGGCAGTCGTCCTCGTATTGCGGTATTAAGAGAGCAAGGTGTTAACTCTCATGTGGAAATGGCAGCAGCTTTTGATCGCGCTGGATTTGATGCTATTGATGTTCATATGAGCGATTTACATACGGCACAACGCTCATTAAGTGATTTTGATGTATTGGTTGCTTGTGGTGGTTTCTCTTATGGTGATGTACTCGGTGCGGGTGAGGGATGGGCTAAATCTATTTTATTTAATCATCGTTTACGTGATGAGTTTGCCCAATTCTTTGCACGTCAAGATACGTTATCACTTGGGGTTTGTAATGGTTGCCAAATGATGTCAACGTTGGCCGAGCTTATTCCGGGGGCAGATTTATGGCCACGCTTTGTACGCAATCGCTCAGAGCGTTTTGAAGCCCGCTTTAGCTTAGTAAAAGTGACTGATAGCCCGTCGCTATTATTACAAGGTATGGCGGGTTCACAGATGCCAATTGCGGTATCTCATGGTGAAGGTTTTGCTGAATTTCGTGACGCTGCACAATTAGCGCAGTTAGAAGCAAAAAATTTAGTAGGACTGCGTTTTGTTGATCACTATGGTCAACCAACAGAGCAATACCCATTAAACCCTAACGGATCAGTAAAAGGGATCACCGCTGTTACCACAACAGATGGCCGCTCAACAATCATGATGCCTCACCCTGAGCGCGTTTTTAGAACAGTGAGCCATTCTTGGCATCCAGAAAATTGGGGAGAAGATAGCCCTTGGATGCGCTTATTCCGTAATGCCAGAAAGCAATTTGACTAATGATGTAATAAAAAAGAGTCAGTGTTATAACCCAAAGCCCCTCAAGTTAG