Homologs in group_537

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01230 FBDBKF_01230 100.0 Morganella morganii S1 purL phosphoribosylformylglycinamidine synthase
NLDBIP_03145 NLDBIP_03145 100.0 Morganella morganii S4 purL phosphoribosylformylglycinamidine synthase
LHKJJB_04660 LHKJJB_04660 100.0 Morganella morganii S3 purL phosphoribosylformylglycinamidine synthase
HKOGLL_02385 HKOGLL_02385 100.0 Morganella morganii S5 purL phosphoribosylformylglycinamidine synthase
F4V73_RS07270 F4V73_RS07270 91.6 Morganella psychrotolerans purL phosphoribosylformylglycinamidine synthase
PMI_RS09255 PMI_RS09255 76.8 Proteus mirabilis HI4320 purL phosphoribosylformylglycinamidine synthase

Distribution of the homologs in the orthogroup group_537

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_537

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N1Z4 0.0 2160 78 0 1295 3 purL Phosphoribosylformylglycinamidine synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q3YYZ8 0.0 2142 78 1 1295 3 purL Phosphoribosylformylglycinamidine synthase Shigella sonnei (strain Ss046)
P15254 0.0 2139 78 1 1295 1 purL Phosphoribosylformylglycinamidine synthase Escherichia coli (strain K12)
Q8XA46 0.0 2139 78 1 1295 3 purL Phosphoribosylformylglycinamidine synthase Escherichia coli O157:H7
Q31XT0 0.0 2137 78 1 1295 3 purL Phosphoribosylformylglycinamidine synthase Shigella boydii serotype 4 (strain Sb227)
Q8FF26 0.0 2136 78 1 1295 3 purL Phosphoribosylformylglycinamidine synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q32D15 0.0 2134 78 1 1295 3 purL Phosphoribosylformylglycinamidine synthase Shigella dysenteriae serotype 1 (strain Sd197)
Q0TET1 0.0 2132 78 1 1295 3 purL Phosphoribosylformylglycinamidine synthase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1R8H7 0.0 2129 78 1 1295 3 purL Phosphoribosylformylglycinamidine synthase Escherichia coli (strain UTI89 / UPEC)
P74881 0.0 2116 78 1 1295 1 purL Phosphoribosylformylglycinamidine synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PIG8 0.0 2109 77 1 1295 3 purL Phosphoribosylformylglycinamidine synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57LE6 0.0 2109 77 1 1295 3 purL Phosphoribosylformylglycinamidine synthase Salmonella choleraesuis (strain SC-B67)
Q8Z4L6 0.0 2108 77 1 1295 3 purL Phosphoribosylformylglycinamidine synthase Salmonella typhi
Q667W1 0.0 2091 77 1 1296 3 purL Phosphoribosylformylglycinamidine synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CKD2 0.0 2089 77 1 1296 3 purL Phosphoribosylformylglycinamidine synthase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCQ2 0.0 2086 77 1 1296 3 purL Phosphoribosylformylglycinamidine synthase Yersinia pestis
Q1C5E7 0.0 2086 77 1 1296 3 purL Phosphoribosylformylglycinamidine synthase Yersinia pestis bv. Antiqua (strain Antiqua)
Q6D238 0.0 2076 76 3 1298 3 purL Phosphoribosylformylglycinamidine synthase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NS22 0.0 2023 75 0 1295 3 purL Phosphoribosylformylglycinamidine synthase Sodalis glossinidius (strain morsitans)
Q9KTN2 0.0 1973 71 2 1297 3 purL Phosphoribosylformylglycinamidine synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8DF81 0.0 1956 71 2 1297 3 purL Phosphoribosylformylglycinamidine synthase Vibrio vulnificus (strain CMCP6)
Q7MN70 0.0 1951 71 2 1296 3 purL Phosphoribosylformylglycinamidine synthase Vibrio vulnificus (strain YJ016)
Q87RW0 0.0 1948 71 3 1302 3 purL Phosphoribosylformylglycinamidine synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6LU24 0.0 1926 69 4 1322 3 purL Phosphoribosylformylglycinamidine synthase Photobacterium profundum (strain SS9)
Q5E749 0.0 1913 70 4 1305 3 purL Phosphoribosylformylglycinamidine synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9CLW4 0.0 1895 70 3 1293 3 purL Phosphoribosylformylglycinamidine synthase Pasteurella multocida (strain Pm70)
Q65RJ7 0.0 1882 70 3 1293 3 purL Phosphoribosylformylglycinamidine synthase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q3IHZ2 0.0 1874 68 7 1301 3 purL Phosphoribosylformylglycinamidine synthase Pseudoalteromonas translucida (strain TAC 125)
Q0HKU9 0.0 1867 68 3 1296 3 purL Phosphoribosylformylglycinamidine synthase Shewanella sp. (strain MR-4)
Q0I5H4 0.0 1866 69 5 1298 3 purL Phosphoribosylformylglycinamidine synthase Histophilus somni (strain 129Pt)
Q0HX47 0.0 1865 68 3 1296 3 purL Phosphoribosylformylglycinamidine synthase Shewanella sp. (strain MR-7)
Q5QWY0 0.0 1860 68 2 1296 3 purL Phosphoribosylformylglycinamidine synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q8EC57 0.0 1848 67 3 1296 3 purL Phosphoribosylformylglycinamidine synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P43847 0.0 1841 68 3 1293 3 purL Phosphoribosylformylglycinamidine synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QME6 0.0 1839 68 3 1293 3 purL Phosphoribosylformylglycinamidine synthase Haemophilus influenzae (strain 86-028NP)
Q085S1 0.0 1824 66 3 1296 3 purL Phosphoribosylformylglycinamidine synthase Shewanella frigidimarina (strain NCIMB 400)
Q12PR7 0.0 1822 66 3 1296 3 purL Phosphoribosylformylglycinamidine synthase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q47XX7 0.0 1810 65 7 1317 3 purL Phosphoribosylformylglycinamidine synthase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q15R69 0.0 1797 66 2 1296 3 purL Phosphoribosylformylglycinamidine synthase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q9HXN2 0.0 1736 64 5 1298 3 purL Phosphoribosylformylglycinamidine synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3KHL4 0.0 1706 63 5 1298 3 purL Phosphoribosylformylglycinamidine synthase Pseudomonas fluorescens (strain Pf0-1)
Q4KHS6 0.0 1705 63 5 1298 3 purL Phosphoribosylformylglycinamidine synthase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4ZX02 0.0 1701 63 4 1295 3 purL Phosphoribosylformylglycinamidine synthase Pseudomonas syringae pv. syringae (strain B728a)
Q88P16 0.0 1694 63 6 1299 3 purL Phosphoribosylformylglycinamidine synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q48LX3 0.0 1693 63 4 1295 3 purL Phosphoribosylformylglycinamidine synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q886W6 0.0 1685 63 4 1295 3 purL Phosphoribosylformylglycinamidine synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2SK05 0.0 1684 62 3 1296 3 purL Phosphoribosylformylglycinamidine synthase Hahella chejuensis (strain KCTC 2396)
Q1H2I8 0.0 1618 61 5 1299 3 purL Phosphoribosylformylglycinamidine synthase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q1D9V4 0.0 1595 61 5 1301 3 purL Phosphoribosylformylglycinamidine synthase Myxococcus xanthus (strain DK1622)
Q9JWC5 0.0 1437 54 9 1324 3 purL Phosphoribosylformylglycinamidine synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q5F7J4 0.0 1435 55 8 1322 3 purL Phosphoribosylformylglycinamidine synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9JXK5 0.0 1425 54 9 1324 3 purL Phosphoribosylformylglycinamidine synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8XYN6 0.0 1414 53 15 1374 3 purL Phosphoribosylformylglycinamidine synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P38972 0.0 1295 50 25 1358 1 ADE6 Phosphoribosylformylglycinamidine synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8PCQ7 0.0 1276 51 13 1365 3 purL Phosphoribosylformylglycinamidine synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
O14228 0.0 1272 52 21 1272 1 ade3 Phosphoribosylformylglycinamidine synthase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8PGR7 0.0 1268 51 21 1372 3 purL Phosphoribosylformylglycinamidine synthase Xanthomonas axonopodis pv. citri (strain 306)
Q87DN2 0.0 1257 50 12 1337 3 purL Phosphoribosylformylglycinamidine synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PDF6 0.0 1255 50 12 1337 3 purL Phosphoribosylformylglycinamidine synthase Xylella fastidiosa (strain 9a5c)
Q9M8D3 0.0 837 37 20 1294 2 At1g74260 Probable phosphoribosylformylglycinamidine synthase, chloroplastic/mitochondrial Arabidopsis thaliana
Q5SUR0 0.0 815 39 23 1267 1 Pfas Phosphoribosylformylglycinamidine synthase Mus musculus
O15067 0.0 792 38 24 1268 1 PFAS Phosphoribosylformylglycinamidine synthase Homo sapiens
Q54JC8 0.0 764 36 24 1270 1 purL Phosphoribosylformylglycinamidine synthase Dictyostelium discoideum
P35421 0.0 748 37 27 1326 1 Pfas Phosphoribosylformylglycinamidine synthase Drosophila melanogaster
Q19311 0.0 658 34 35 1321 3 pfas-1 Probable phosphoribosylformylglycinamidine synthase Caenorhabditis elegans
Q6KZR2 1.21e-52 202 26 30 821 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q9HJA4 1.42e-48 190 27 33 840 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q9RHW9 1.07e-44 178 27 26 781 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Corynebacterium ammoniagenes
C3PIW7 1.85e-43 174 26 25 776 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
Q5Z2C3 1.21e-39 162 27 30 771 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Nocardia farcinica (strain IFM 10152)
Q47TL8 3.53e-39 160 27 28 761 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermobifida fusca (strain YX)
Q97BD5 4.82e-39 160 25 33 829 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q50023 7.32e-39 160 27 30 773 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacterium leprae (strain TN)
B8ZSV5 7.32e-39 160 27 30 773 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacterium leprae (strain Br4923)
A0QAT1 4.83e-38 157 27 30 769 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacterium avium (strain 104)
Q743F0 5.23e-38 157 27 30 769 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8FMM3 1.27e-37 156 26 28 762 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P9WHL6 8.39e-37 153 27 31 754 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5T9 8.88e-37 153 27 32 755 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WHL7 1.24e-36 153 27 31 754 1 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A5U0J2 1.24e-36 153 27 31 754 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1ALD8 1.24e-36 153 27 31 754 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KGT6 1.24e-36 153 27 31 754 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A4QGY6 1.32e-36 153 26 32 833 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Corynebacterium glutamicum (strain R)
O28339 4.42e-36 151 24 18 767 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8NMI5 5.66e-36 150 27 29 762 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q2RWI3 1.18e-35 149 26 27 762 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q3AD64 3.56e-35 148 25 30 821 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B1MHY1 8.65e-35 147 26 31 777 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
B0K3Q4 1.07e-34 146 25 30 763 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermoanaerobacter sp. (strain X514)
Q8RBK5 1.75e-34 146 25 35 840 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B0KBQ5 2.42e-34 145 25 30 763 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q58660 2.94e-34 145 23 33 836 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A1TFE0 3.12e-34 145 27 30 771 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q82FW4 4.75e-34 144 26 27 768 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A1SPT8 7.14e-34 144 25 30 813 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Nocardioides sp. (strain ATCC BAA-499 / JS614)
B4UIX7 1.49e-33 143 27 29 724 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Anaeromyxobacter sp. (strain K)
A9WV65 2.51e-33 142 25 26 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
C0ZP44 4.78e-33 141 26 30 772 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q9RKK5 8.56e-33 140 26 26 766 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q0BRI4 9.42e-33 140 26 27 718 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q9REQ6 1.25e-32 140 25 29 800 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q0S766 1.37e-32 140 26 30 775 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodococcus jostii (strain RHA1)
A7HIJ4 1.39e-32 140 26 30 727 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Anaeromyxobacter sp. (strain Fw109-5)
C4L299 1.53e-32 140 25 30 766 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q1WU59 1.75e-32 139 23 30 844 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Ligilactobacillus salivarius (strain UCC118)
C1ATA2 6.14e-32 138 26 30 774 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodococcus opacus (strain B4)
O59621 1.06e-31 137 25 30 808 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q5V2D3 1.28e-31 137 27 29 779 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
A4T7J3 1.32e-31 137 26 30 789 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mycolicibacterium gilvum (strain PYR-GCK)
B9LT08 1.85e-31 136 26 28 781 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
Q4JXF0 6.63e-31 135 26 29 748 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Corynebacterium jeikeium (strain K411)
Q18JI5 7.5e-31 134 26 29 761 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q8ES96 8.95e-31 134 23 29 833 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q037U9 9.43e-31 134 25 31 749 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B9KZ38 2.01e-30 133 26 39 834 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
A9BIH4 2.37e-30 133 24 31 809 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Petrotoga mobilis (strain DSM 10674 / SJ95)
B8JBS8 3.96e-30 132 27 29 724 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q2IHC1 4.48e-30 132 27 29 724 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Anaeromyxobacter dehalogenans (strain 2CP-C)
Q6M0U0 4.9e-30 124 33 7 237 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q83FE8 4.91e-30 132 25 30 781 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Tropheryma whipplei (strain Twist)
Q83H66 4.91e-30 132 25 30 781 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Tropheryma whipplei (strain TW08/27)
B9DQ38 5.94e-30 131 24 31 766 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus carnosus (strain TM300)
A4G010 8.64e-30 123 33 7 235 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q07R72 1.04e-29 131 24 27 763 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodopseudomonas palustris (strain BisA53)
Q6A6C0 1.97e-29 130 24 24 765 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Cutibacterium acnes (strain DSM 16379 / KPA171202)
A2BTV9 2.56e-29 130 23 28 765 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain MIT 9515)
Q13AA1 2.81e-29 129 24 29 782 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodopseudomonas palustris (strain BisB5)
B1YBM5 2.91e-29 129 24 30 826 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pyrobaculum neutrophilum (strain DSM 2338 / JCM 9278 / NBRC 100436 / V24Sta)
C6A0I0 3.5e-29 129 24 34 813 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermococcus sibiricus (strain DSM 12597 / MM 739)
Q8NX92 3.54e-29 129 24 37 839 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain MW2)
A8Z1L1 3.54e-29 129 24 37 839 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain USA300 / TCH1516)
Q6GAE4 3.54e-29 129 24 37 839 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain MSSA476)
A6QFS7 3.54e-29 129 24 37 839 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain Newman)
Q5HH15 3.54e-29 129 24 37 839 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain COL)
Q2FZJ0 3.54e-29 129 24 37 839 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FI09 3.54e-29 129 24 37 839 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain USA300)
Q6ACC3 3.9e-29 129 26 29 796 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Leifsonia xyli subsp. xyli (strain CTCB07)
A1RQQ2 6.25e-29 128 24 31 825 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pyrobaculum islandicum (strain DSM 4184 / JCM 9189 / GEO3)
Q2J4M9 6.95e-29 128 26 30 791 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
C5D4I0 7e-29 128 24 35 818 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Geobacillus sp. (strain WCH70)
Q8PYK1 7.67e-29 128 26 36 818 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
A8ABX6 9.51e-29 127 23 23 727 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
Q218N3 1e-28 127 24 23 720 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodopseudomonas palustris (strain BisB18)
P65901 1.05e-28 127 24 37 839 1 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain N315)
P65900 1.05e-28 127 24 37 839 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRV6 1.05e-28 127 24 37 839 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain JH9)
A6U0N7 1.05e-28 127 24 37 839 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain JH1)
A7X0W1 1.05e-28 127 24 37 839 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain Mu3 / ATCC 700698)
C5A4U6 1.34e-28 127 24 24 720 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
A6VIG8 2.03e-28 119 32 7 237 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q6L0V9 2.29e-28 118 34 7 252 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q5FNL0 2.83e-28 126 24 23 774 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Gluconobacter oxydans (strain 621H)
Q6GI15 3.03e-28 126 23 37 840 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain MRSA252)
Q9QR70 3.71e-28 127 22 20 722 4 ORF75 Protein ORF75 Human herpesvirus 8 type P (isolate GK18)
Q3KSV4 4.42e-28 127 24 25 734 3 BNRF1 Major tegument protein Epstein-Barr virus (strain GD1)
A7HWB1 5.05e-28 125 24 28 738 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A8I8B0 5.06e-28 125 23 23 719 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A5G1X4 6.26e-28 125 26 32 745 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Acidiphilium cryptum (strain JF-5)
A4WQY3 6.67e-28 125 26 17 462 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A8F8I3 7.05e-28 125 23 26 811 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
B0C6R3 8.49e-28 125 24 28 844 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Acaryochloris marina (strain MBIC 11017)
Q2YX54 1.14e-27 124 23 36 838 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q5SMH8 1.19e-27 124 24 28 756 1 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72IH7 1.19e-27 124 24 28 756 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q8U491 1.41e-27 124 24 27 723 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q9HIM1 1.51e-27 116 32 6 231 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
A0AJM3 2.01e-27 124 24 30 803 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q02Y55 2.18e-27 123 25 27 743 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactococcus lactis subsp. cremoris (strain SK11)
Q02Y55 0.000257 49 26 8 209 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactococcus lactis subsp. cremoris (strain SK11)
B7GFT8 2.28e-27 123 24 33 827 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q1HVJ0 2.99e-27 124 24 25 734 1 BNRF1 Major tegument protein Epstein-Barr virus (strain AG876)
Q6G335 3.09e-27 123 24 27 741 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q3J273 3.93e-27 122 26 17 462 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
B7IUV3 4.11e-27 122 24 29 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cereus (strain G9842)
P03179 4.31e-27 124 24 25 734 1 BNRF1 Major tegument protein Epstein-Barr virus (strain B95-8)
Q3IQL3 4.33e-27 122 28 15 460 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
B2GF74 5.37e-27 122 23 32 840 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
A8MCK2 5.37e-27 122 27 19 495 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Caldivirga maquilingensis (strain ATCC 700844 / DSM 13496 / JCM 10307 / IC-167)
A2RJW3 5.38e-27 122 25 26 742 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactococcus lactis subsp. cremoris (strain MG1363)
A2RJW3 0.000706 47 26 8 209 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactococcus lactis subsp. cremoris (strain MG1363)
Q9ZB06 5.38e-27 122 25 26 742 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactococcus lactis subsp. cremoris
Q9ZB06 0.000706 47 26 8 209 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactococcus lactis subsp. cremoris
C3MD72 6.52e-27 122 24 25 749 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P11282 6.63e-27 123 24 26 707 4 75 Probable membrane antigen 75 Saimiriine herpesvirus 2 (strain 11)
Q8ZZJ7 8.36e-27 121 27 14 433 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q63GT3 8.6e-27 122 24 29 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cereus (strain ZK / E33L)
A4WMV7 9.13e-27 121 26 22 653 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321 / PZ6)
Q01000 9.51e-27 122 24 10 398 4 3 Probable membrane antigen 3 Saimiriine herpesvirus 2 (strain 11)
B7H4T6 9.54e-27 121 24 29 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cereus (strain B4264)
A6UX13 9.56e-27 121 22 32 832 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q81IQ3 9.97e-27 121 24 29 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q2G630 1e-26 121 25 32 783 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q8CPN9 1.07e-26 121 24 33 775 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
B9KSY5 1.26e-26 121 26 17 462 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q5HQA1 1.27e-26 121 24 33 775 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q98NN7 1.55e-26 120 24 30 772 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q6N9F2 1.88e-26 120 25 30 770 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q92AN9 1.9e-26 120 24 32 804 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q67KF8 1.9e-26 120 24 29 787 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
C1EV63 1.95e-26 120 24 29 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cereus (strain 03BB102)
B7JM85 1.95e-26 120 24 29 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cereus (strain AH820)
Q81ZH2 1.95e-26 120 24 29 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus anthracis
A0R8Z6 1.95e-26 120 24 29 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus thuringiensis (strain Al Hakam)
C3L532 1.95e-26 120 24 29 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PBN0 1.95e-26 120 24 29 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus anthracis (strain A0248)
Q4FLJ4 2.39e-26 120 23 33 782 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pelagibacter ubique (strain HTCC1062)
Q4L578 2.57e-26 120 23 35 829 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus haemolyticus (strain JCSC1435)
Q163V9 2.71e-26 120 24 29 772 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B9J1K5 2.93e-26 120 24 29 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cereus (strain Q1)
Q73EN5 2.95e-26 120 24 29 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cereus (strain ATCC 10987 / NRS 248)
B7HS32 3.57e-26 119 24 28 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cereus (strain AH187)
Q71YP9 3.76e-26 119 24 32 806 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Listeria monocytogenes serotype 4b (strain F2365)
B3Q7H9 3.99e-26 119 25 30 770 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodopseudomonas palustris (strain TIE-1)
Q49WJ3 4.04e-26 119 23 28 752 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
C1KW68 4.25e-26 119 24 32 806 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Listeria monocytogenes serotype 4b (strain CLIP80459)
P35852 4.53e-26 119 24 32 761 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lacticaseibacillus casei
Q9CFE8 5.05e-26 119 25 28 744 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactococcus lactis subsp. lactis (strain IL1403)
Q6FZI9 6.06e-26 119 23 28 773 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bartonella quintana (strain Toulouse)
Q049L7 7.43e-26 119 24 36 788 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G9F8 7.43e-26 119 24 36 788 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q8Y6C1 7.93e-26 119 24 31 809 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A1UT47 9.22e-26 118 24 29 777 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q5JFL7 1.04e-25 118 24 27 767 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A9IVH5 1.09e-25 118 23 28 782 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bartonella tribocorum (strain CIP 105476 / IBS 506)
A4IJX3 1.1e-25 118 24 35 821 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Geobacillus thermodenitrificans (strain NG80-2)
Q6HPA4 1.18e-25 118 24 29 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus thuringiensis subsp. konkukian (strain 97-27)
B8DDY8 1.28e-25 118 24 31 804 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Listeria monocytogenes serotype 4a (strain HCC23)
O67691 1.36e-25 118 24 27 778 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Aquifex aeolicus (strain VF5)
A9VRF1 1.49e-25 117 24 30 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus mycoides (strain KBAB4)
A4YRR9 1.73e-25 117 24 26 723 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bradyrhizobium sp. (strain ORS 278)
Q1QMU2 1.98e-25 117 23 27 748 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A8LCI3 2.2e-25 117 26 33 783 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Parafrankia sp. (strain EAN1pec)
A7GKH8 2.58e-25 117 24 29 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q3Z9H5 3.8e-25 109 32 8 257 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
A6TLS3 4e-25 116 24 32 807 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Alkaliphilus metalliredigens (strain QYMF)
Q2ITQ2 4.34e-25 116 24 30 783 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhodopseudomonas palustris (strain HaA2)
Q9UX24 4.57e-25 116 23 31 775 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q11IV2 5.01e-25 116 24 33 805 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Chelativorans sp. (strain BNC1)
Q9HR49 5.32e-25 115 27 17 473 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R4B5 5.32e-25 115 27 17 473 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q3ST22 5.99e-25 115 24 27 734 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A3MXD4 6.01e-25 115 28 11 403 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pyrobaculum calidifontis (strain DSM 21063 / JCM 11548 / VA1)
Q7VEK9 7.16e-25 115 23 33 846 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q8UEB0 7.75e-25 115 23 25 780 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8TIT6 7.79e-25 115 25 32 785 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q2RGU5 8.23e-25 115 24 29 747 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B9EAY8 1.08e-24 115 24 29 772 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Macrococcus caseolyticus (strain JCSC5402)
A8FAM7 1.21e-24 115 24 33 750 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus pumilus (strain SAFR-032)
Q2RZ77 1.3e-24 115 24 28 776 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Salinibacter ruber (strain DSM 13855 / M31)
Q5L3D2 1.37e-24 114 23 31 823 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Geobacillus kaustophilus (strain HTA426)
Q92PH7 1.4e-24 114 24 27 754 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhizobium meliloti (strain 1021)
Q7V3R5 1.76e-24 114 23 26 743 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
C3N674 2e-24 114 23 34 775 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfolobus islandicus (strain M.16.27)
A2BNC9 2.34e-24 114 22 29 765 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain AS9601)
Q03Y89 2.4e-24 114 25 29 654 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
A6U9L9 2.94e-24 114 24 27 741 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sinorhizobium medicae (strain WSM419)
Q97C36 3.17e-24 107 28 5 227 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
A5EMI1 3.28e-24 113 23 28 779 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A8YW85 3.53e-24 113 23 29 786 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactobacillus helveticus (strain DPC 4571)
Q8TY09 3.98e-24 113 24 26 726 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q9KH12 4.38e-24 113 24 27 769 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhizobium fredii (strain HH103)
C3NEN0 5.87e-24 112 24 33 773 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3NH14 5.87e-24 112 24 33 773 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3MQF3 5.87e-24 112 24 33 773 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
A8G1Z0 8.09e-24 112 22 32 767 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain MIT 9215)
C3MW31 8.23e-24 112 23 34 775 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
Q9KF57 8.31e-24 112 23 22 728 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
C4KHN7 9.96e-24 112 23 34 775 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
B2IC83 1e-23 112 25 29 781 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q5WJ86 1.14e-23 112 24 29 745 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Shouchella clausii (strain KSM-K16)
A1B943 1.14e-23 111 26 17 423 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Paracoccus denitrificans (strain Pd 1222)
Q7NIR9 1.35e-23 111 25 30 766 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q89IC0 1.36e-23 111 23 27 797 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q28QC2 1.52e-23 111 24 30 753 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Jannaschia sp. (strain CCS1)
Q2NAT8 1.72e-23 111 26 17 442 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Erythrobacter litoralis (strain HTCC2594)
Q31DI1 1.9e-23 111 22 33 744 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain MIT 9312)
A3PA50 2.7e-23 110 22 29 738 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain MIT 9301)
A5UMW9 2.75e-23 110 25 15 480 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q2K7X0 4e-23 110 23 32 801 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q9UXW6 4.77e-23 109 24 31 805 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Pyrococcus abyssi (strain GE5 / Orsay)
Q833Y9 7.97e-23 109 25 28 644 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Enterococcus faecalis (strain ATCC 700802 / V583)
Q66675 8.19e-23 110 25 28 736 4 75 Probable membrane antigen 75 Equine herpesvirus 2 (strain 86/87)
B2G5B8 9.96e-23 108 22 27 830 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VHT8 9.96e-23 108 22 27 830 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Limosilactobacillus reuteri (strain DSM 20016)
B9JVW2 2.07e-22 107 23 29 792 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
P12042 2.17e-22 107 23 34 815 1 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus subtilis (strain 168)
Q2NEB6 2.27e-22 107 24 18 553 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q46F25 2.41e-22 107 25 36 819 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanosarcina barkeri (strain Fusaro / DSM 804)
B8EPE8 2.49e-22 107 25 25 735 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q9RXT4 2.91e-22 107 25 26 751 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q65MS8 3.3e-22 107 25 20 537 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q9X0X3 7.21e-22 105 26 15 441 1 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q5FIV1 7.24e-22 106 22 29 767 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q8DIA7 7.93e-22 105 23 33 821 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A6X1J9 1.02e-21 105 22 27 785 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q5LS98 1.04e-21 105 23 29 726 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q1GHL5 1.8e-21 104 25 16 491 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Ruegeria sp. (strain TM1040)
Q7M9L5 2.25e-21 104 24 35 789 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A0B5C7 4.77e-21 103 23 35 828 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
Q9A5F0 5.54e-21 103 25 16 506 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q3M6Z4 9.31e-21 102 23 30 767 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3B100 1.1e-20 102 27 16 418 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Synechococcus sp. (strain CC9902)
O27427 2.25e-20 101 24 17 533 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A6QAK6 2.46e-20 101 23 32 782 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfurovum sp. (strain NBC37-1)
Q8YGN1 3.32e-20 100 22 24 721 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RIH1 3.32e-20 100 22 24 721 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella melitensis biotype 2 (strain ATCC 23457)
Q57DR8 3.32e-20 100 22 24 721 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella abortus biovar 1 (strain 9-941)
Q2YNG6 3.32e-20 100 22 24 721 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella abortus (strain 2308)
B2S573 3.32e-20 100 22 24 721 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella abortus (strain S19)
Q8G183 3.65e-20 100 22 27 786 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella suis biovar 1 (strain 1330)
B0CLG4 3.65e-20 100 22 27 786 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VQ15 3.65e-20 100 22 27 786 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A9MAL4 3.65e-20 100 22 27 786 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q46I59 3.7e-20 100 22 32 788 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain NATL2A)
Q72PR5 3.99e-20 100 23 30 759 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P72644 4.05e-20 100 27 13 368 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P26500 4.45e-20 100 26 17 532 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q8F6I3 4.69e-20 100 23 30 759 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
B3PPS1 8.99e-20 99 25 15 438 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhizobium etli (strain CIAT 652)
A2C5J9 1.18e-19 99 25 15 437 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain MIT 9303)
B5ZQU1 1.18e-19 99 25 15 438 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q88U25 1.29e-19 99 25 16 489 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
O29008 1.37e-19 94 30 9 245 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A2BZA6 1.41e-19 99 22 32 788 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain NATL1A)
Q5N1Y6 1.57e-19 98 27 18 408 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55041 1.57e-19 98 27 18 408 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O36422 1.59e-19 99 22 24 726 4 75 Probable membrane antigen 75 Alcelaphine herpesvirus 1 (strain C500)
A4YI68 2.6e-19 97 24 34 758 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
Q2JI39 4.1e-19 97 23 35 809 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Synechococcus sp. (strain JA-2-3B'a(2-13))
B9JFQ3 4.15e-19 97 24 14 420 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q8YR06 4.41e-19 97 23 28 749 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7V9E5 4.77e-19 97 26 13 365 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Prochlorococcus marinus (strain MIT 9313)
Q4J8F8 5.22e-19 96 25 26 662 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q73MV2 6.01e-19 92 30 8 247 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
B9KFP6 6.55e-19 96 22 29 749 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
A7H373 6.59e-19 96 23 26 730 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q1MG23 6.78e-19 96 25 15 435 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q053V5 7.09e-19 96 24 36 791 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04QS4 7.09e-19 96 24 36 791 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q3IMR2 1.06e-18 90 34 10 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
A5GHL4 1.16e-18 95 28 17 395 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Synechococcus sp. (strain WH7803)
Q3ANP7 1.35e-18 95 26 13 379 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Synechococcus sp. (strain CC9605)
B8HRP1 1.43e-18 95 27 13 365 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q66609 1.68e-18 95 23 28 697 4 3 Probable membrane antigen 3 Equine herpesvirus 2 (strain 86/87)
Q7VF52 1.69e-18 95 23 28 726 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q5HUK4 1.88e-18 95 22 25 730 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Campylobacter jejuni (strain RM1221)
A6Q3E8 1.99e-18 95 25 13 389 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Nitratiruptor sp. (strain SB155-2)
Q7UA92 2.06e-18 95 26 17 421 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Parasynechococcus marenigrum (strain WH8102)
A7Z249 2.17e-18 94 23 30 719 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A7I157 2.19e-18 94 24 17 536 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q9HNU2 2.55e-18 89 37 11 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q8TX85 2.56e-18 89 35 11 234 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q3ARU4 3.43e-18 94 24 34 734 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Chlorobium chlorochromatii (strain CaD3)
Q30T55 5.49e-18 93 24 18 527 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
B2IU46 1.44e-17 92 25 12 365 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q38XW7 2.63e-17 91 23 27 730 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Latilactobacillus sakei subsp. sakei (strain 23K)
Q18FM4 3.31e-17 85 32 8 223 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q2JQL7 5.84e-17 90 23 33 825 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Synechococcus sp. (strain JA-3-3Ab)
Q8CPP0 6.13e-17 84 29 8 230 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQA2 6.13e-17 84 29 8 230 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A7GYY9 6.3e-17 90 27 15 396 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Campylobacter curvus (strain 525.92)
A8Z6J5 8.73e-17 89 26 14 361 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Campylobacter concisus (strain 13826)
Q970V6 9.69e-17 89 22 28 754 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q3B3Y0 1.2e-16 89 24 33 728 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A8FM09 1.35e-16 89 22 27 731 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q5JFP4 1.76e-16 83 32 12 252 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q9UX21 1.98e-16 83 29 10 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q9PNY0 2.46e-16 88 22 28 738 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9UXW5 3.03e-16 82 32 12 253 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Pyrococcus abyssi (strain GE5 / Orsay)
A1VZU6 5.1e-16 87 22 27 731 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
B9KZ37 8.71e-16 81 35 7 185 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
P99166 9.41e-16 81 30 7 229 1 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus aureus (strain N315)
P65904 9.41e-16 81 30 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8NX93 1.14e-15 81 30 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus aureus (strain MW2)
Q5HH16 1.14e-15 81 30 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus aureus (strain COL)
Q2FZJ1 1.14e-15 81 30 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FI10 1.14e-15 81 30 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus aureus (strain USA300)
O59619 1.31e-15 80 32 10 226 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q2YX55 1.49e-15 80 30 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q468N4 1.87e-15 80 29 11 252 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanosarcina barkeri (strain Fusaro / DSM 804)
Q6GAE5 2.09e-15 80 30 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus aureus (strain MSSA476)
Q1G9F7 3.92e-15 79 30 10 226 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q8U492 4.18e-15 79 32 10 226 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q2RGU4 4.61e-15 79 31 7 205 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q6GI16 5.41e-15 79 29 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus aureus (strain MRSA252)
B1YJ04 7.57e-15 79 29 10 255 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q81IQ4 8.02e-15 78 29 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7H4T5 8.02e-15 78 29 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cereus (strain B4264)
Q3AD65 9.55e-15 78 33 9 195 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q8PTB0 1.06e-14 78 26 7 232 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
A9VRF0 1.14e-14 78 29 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus mycoides (strain KBAB4)
Q4L577 1.17e-14 78 29 9 251 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus haemolyticus (strain JCSC1435)
Q8TPF0 1.2e-14 78 30 10 235 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
A7GKH7 1.53e-14 77 28 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q1GGM0 1.74e-14 77 32 8 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Ruegeria sp. (strain TM1040)
B0ST16 2.09e-14 82 26 15 367 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SB88 2.09e-14 82 26 15 367 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
C0ZKC5 2.09e-14 77 28 9 251 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q5FIV0 2.52e-14 77 30 9 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
B7IUV2 2.75e-14 77 28 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cereus (strain G9842)
Q63GT4 3.14e-14 77 28 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cereus (strain ZK / E33L)
B9J1K4 3.14e-14 77 28 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cereus (strain Q1)
Q67KF7 3.15e-14 77 33 7 191 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q7V834 3.29e-14 76 33 7 183 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Prochlorococcus marinus (strain MIT 9313)
A0R8Z5 3.48e-14 77 28 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus thuringiensis (strain Al Hakam)
Q6HPA5 3.55e-14 76 28 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus thuringiensis subsp. konkukian (strain 97-27)
B7HS31 3.55e-14 76 28 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cereus (strain AH187)
Q73EN6 3.55e-14 76 28 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JM84 3.55e-14 76 28 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cereus (strain AH820)
Q81ZH3 3.55e-14 76 28 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus anthracis
C3L531 3.55e-14 76 28 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PBM9 3.55e-14 76 28 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus anthracis (strain A0248)
C1EV62 4.63e-14 76 28 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus cereus (strain 03BB102)
Q59042 5.24e-14 76 27 9 234 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5N459 5.57e-14 76 33 7 190 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31Q18 5.57e-14 76 33 7 190 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A8F8I4 6.15e-14 76 31 10 201 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q3AS25 1.1e-13 75 34 8 183 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Chlorobium chlorochromatii (strain CaD3)
O26270 1.41e-13 74 31 11 226 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A7Z248 1.48e-13 75 29 10 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
C4L298 1.56e-13 75 30 12 256 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q7U831 1.7e-13 74 32 8 201 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Parasynechococcus marenigrum (strain WH8102)
Q8KD17 2.2e-13 78 23 35 792 3 purL Phosphoribosylformylglycinamidine synthase subunit PurL Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q49WJ2 2.31e-13 74 27 8 250 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q30TB2 3.51e-13 73 29 11 233 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A8FAM6 5.32e-13 73 28 9 232 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus pumilus (strain SAFR-032)
Q2G9J6 6.49e-13 73 34 6 175 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q2S567 7.23e-13 73 30 7 211 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Salinibacter ruber (strain DSM 13855 / M31)
Q9RHX0 7.48e-13 72 28 7 230 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Corynebacterium ammoniagenes
Q8DGX5 7.73e-13 73 34 8 183 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q2RWI2 9.81e-13 72 33 9 227 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q5LS78 1.16e-12 72 31 8 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q2NF29 1.37e-12 72 27 13 251 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q8KCS5 1.48e-12 72 31 7 183 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B0C7S1 1.59e-12 72 30 7 182 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Acaryochloris marina (strain MBIC 11017)
Q5SI57 1.65e-12 72 31 7 223 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q1WU60 1.66e-12 72 27 10 250 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Ligilactobacillus salivarius (strain UCC118)
Q88U24 1.67e-12 72 30 8 191 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q72IH9 1.72e-12 72 31 7 223 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
C5D4H9 1.75e-12 72 29 9 234 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Geobacillus sp. (strain WCH70)
Q28PA2 1.93e-12 71 33 9 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Jannaschia sp. (strain CCS1)
Q89IB6 2.16e-12 71 35 7 176 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q71YP8 2.17e-12 71 29 10 254 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Listeria monocytogenes serotype 4b (strain F2365)
C1KW69 2.17e-12 71 29 10 254 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Listeria monocytogenes serotype 4b (strain CLIP80459)
Q8FMM2 2.33e-12 71 27 8 230 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q4JXF1 3.12e-12 70 29 7 230 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Corynebacterium jeikeium (strain K411)
Q2ITP9 3.12e-12 71 31 9 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Rhodopseudomonas palustris (strain HaA2)
Q3AII4 3.44e-12 70 30 6 182 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Synechococcus sp. (strain CC9605)
Q3B397 3.67e-12 70 30 12 234 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
B2G5B7 3.94e-12 70 29 10 235 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VHT7 3.94e-12 70 29 10 235 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Limosilactobacillus reuteri (strain DSM 20016)
B3WF98 4.09e-12 70 32 8 183 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Lacticaseibacillus casei (strain BL23)
Q0S774 4.5e-12 70 30 9 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Rhodococcus jostii (strain RHA1)
B8DDY7 4.58e-12 70 28 10 253 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Listeria monocytogenes serotype 4a (strain HCC23)
Q92AN8 5.53e-12 70 28 10 254 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q7M9X7 6e-12 70 28 8 231 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
P12041 6.43e-12 70 27 9 246 1 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus subtilis (strain 168)
Q8Y6C0 8.07e-12 70 28 10 253 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q3AYR1 8.6e-12 69 30 8 201 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Synechococcus sp. (strain CC9902)
Q9RXT3 9.35e-12 69 31 6 181 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q1IPG4 9.78e-12 69 31 8 183 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Koribacter versatilis (strain Ellin345)
Q037U8 1.1e-11 69 32 8 183 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q46LE9 2.15e-11 68 30 7 183 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Prochlorococcus marinus (strain NATL2A)
B1HTV3 2.32e-11 68 26 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Lysinibacillus sphaericus (strain C3-41)
Q7VC88 2.32e-11 68 31 7 183 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q9KF58 2.34e-11 68 28 9 250 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B3QMT1 2.6e-11 68 31 8 183 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B2GF73 3.51e-11 68 27 13 256 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q5WJ87 3.68e-11 68 29 7 229 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Shouchella clausii (strain KSM-K16)
Q1AXB7 3.93e-11 67 32 7 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q5L3D3 4.56e-11 67 29 8 205 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Geobacillus kaustophilus (strain HTA426)
Q6A6B0 4.95e-11 67 31 8 209 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q6N376 5.55e-11 67 32 10 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q65MS9 5.67e-11 67 29 10 232 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q5Z2C8 5.74e-11 67 29 8 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Nocardia farcinica (strain IFM 10152)
Q55843 5.81e-11 67 31 8 183 1 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q31B97 5.83e-11 67 30 7 197 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Prochlorococcus marinus (strain MIT 9312)
Q9ZB07 7.67e-11 67 25 8 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Lactococcus lactis subsp. cremoris
Q1J2B6 8.02e-11 67 33 7 181 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q4FLJ5 8.41e-11 67 28 8 239 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Pelagibacter ubique (strain HTCC1062)
Q7VFQ4 8.57e-11 66 30 10 223 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q8NMI4 9.31e-11 66 31 8 189 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A0AJM4 1.12e-10 66 26 10 250 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q218N7 1.12e-10 66 32 10 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Rhodopseudomonas palustris (strain BisB18)
Q2JWK2 1.2e-10 66 31 7 182 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Synechococcus sp. (strain JA-3-3Ab)
A4IJX2 1.2e-10 66 27 9 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Geobacillus thermodenitrificans (strain NG80-2)
A0B5C6 1.21e-10 67 26 11 275 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
O67190 1.28e-10 66 29 6 183 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Aquifex aeolicus (strain VF5)
Q3MG53 1.35e-10 66 33 8 177 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q6FZJ0 1.38e-10 66 26 10 246 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bartonella quintana (strain Toulouse)
Q5FNL1 1.51e-10 66 31 8 206 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Gluconobacter oxydans (strain 621H)
Q6G336 1.59e-10 65 26 12 258 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A6TLS2 2.08e-10 65 28 7 184 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Alkaliphilus metalliredigens (strain QYMF)
B7GFT7 3.1e-10 65 31 8 186 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q1GVL0 3.56e-10 65 33 10 204 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q8YU79 4.96e-10 64 32 8 177 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q77ZF7 6.8e-10 67 22 11 440 4 3 Probable tegument protein antigen 3 Alcelaphine herpesvirus 1 (strain C500)
Q8YGN4 6.84e-10 64 29 10 227 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q57DR5 6.84e-10 64 29 10 227 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Brucella abortus biovar 1 (strain 9-941)
Q2YNG3 6.84e-10 64 29 10 227 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Brucella abortus (strain 2308)
Q9CFE7 7.24e-10 63 25 8 224 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Lactococcus lactis subsp. lactis (strain IL1403)
Q8ES97 7.49e-10 64 30 9 185 3 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_00315
Feature type CDS
Gene purL
Product phosphoribosylformylglycinamidine synthase
Location 71850 - 75737 (strand: 1)
Length 3888 (nucleotides) / 1295 (amino acids)

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_537
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02769 AIR synthase related protein, C-terminal domain
PF13507 CobB/CobQ-like glutamine amidotransferase domain
PF18072 Formylglycinamide ribonucleotide amidotransferase linker domain
PF18076 Formylglycinamide ribonucleotide amidotransferase N-terminal
PF22689 FGAR-AT PurM_N-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0046 Nucleotide transport and metabolism (F) F Phosphoribosylformylglycinamidine (FGAM) synthase, synthetase domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01952 phosphoribosylformylglycinamidine synthase [EC:6.3.5.3] Purine metabolism
Metabolic pathways
Biosynthesis of secondary metabolites		 De novo purine biosynthesis, PRPP + glutamine => IMP

Protein Sequence

MEILRGSPVLSAFRVSKFISAFTEHHLPVTNIYAEYVHFADLSAPLTDDEHSKLQQLLRYGPSLAEHAPEGILFLVTPRPGTLSPWSSKATDIAHNCGLSAVTRLERGIAYYITTTGLTENEHQQLSALLHDRMTETVFSELSQAQALFARHEPAPLTVIDLAGQGRAALEKANISLGLALAEDEIDYLADAFTKLGRNPSDAELYMFAQANSEHCRHKIFNADWVIDGEEQPKSLFKMIKNTFEQTPDHVLSAYKDNAAVMEGSSAGRFFPQGEDRRYQYHQEETHILMKVETHNHPTAISPWPGAATGSGGEIRDEGATGRGAKPKAGLTGFSVSNLRIPGFTQPWEQDFGRPDRIVSAYDIMTEGPLGGAAFNNEFGRPALLGYFRTYEEKVSSHNGEELRGYHKPIMLAGGIGNIRADHVQKGEIQPGAKLIVLGGPSMNIGLGGGAASSMTSGQSDADLDFASVQRDNPEMERRCQEVIDACWQLGDNNPILFIHDVGAGGLSNAMPELVSDGGRGGRFELRDILSDEPGMSPLEIWCNESQERYVLAVSPEQLPLFEALCQRERAPYAVIGEATEKRDLILNDSHFDNQPIDMPLDILLGKTPKMRRDVTTLTADGTPIDRRDINLHEAVKRVLHLPAVAEKTFLITIGDRTVTGMVSRDQMVGPWQIPVADCAVTTASLDSYYGEAMSIGERAPVALLDFAASARMAVAEALLNIAGVQIGDIKRIKLSANWMAAAGHPGEDAGLYAAVKAVGEELCPALGLTIPVGKDSMSMKTRWNEQGEEREMTSPLSLVITAFARVDDVRRTVTPQLRSDVPNRLLLVDLGEGRNTLGATALAQVYRQLGQKGADLRNPQALRAFFDTMQTLVRDEKLLAYHDRSDGGLFVTLAEMAFAGHCGVNADISAFDEDILGALFTEEPGAVLQVREADLDGVVQAFTGAGLADMLHVLGEAVPGDDFIVCSHNTEVYHQSCRELRIMWAETTWQMQRQRDNPACADEEHEAKQDLTDPGLNVVLTFDQNDDIAAPYIVKGVRPRVAVLREQGVNSHVEMAAAFHRAGFDAIDVHMSDLLNGHLPLDSFQALVACGGFSYGDVLGAGEGWAKSILFNPQVRDEFAQFFARPDTLSLGVCNGCQMMSNLRDLIPGADLWPRFTHNRSERFEARFSLVEVAQSPSLLLSGMAGSRMPIAVSHGEGLAEFRDAAHQQALTERGLVALQYVDNYGQVTERYPANPNGSPDGITAVTTDDGRTTIMMPHPERVFRTVSNSWHPENWGEDGPWLRIFRNARKQLG

Flanking regions ( +/- flanking 50bp)

TCCCCTCCGGGCCGATGGCTCTGCGTGTTAAAAAGAGAGAACTGACAACTATGGAAATTTTGCGTGGCTCACCTGTGTTATCTGCGTTTCGCGTATCAAAATTTATCAGCGCGTTCACTGAACACCACCTGCCGGTGACCAACATCTATGCGGAATATGTGCATTTTGCTGATCTTTCCGCACCCCTGACCGACGATGAGCACTCCAAATTACAGCAGTTGCTCCGCTACGGCCCGTCGCTGGCGGAACATGCGCCGGAAGGGATCCTGTTTCTTGTCACGCCGCGCCCGGGAACATTATCTCCCTGGTCATCGAAAGCCACGGATATCGCGCATAACTGCGGTCTGTCAGCCGTTACCCGGCTGGAGCGGGGGATCGCCTACTATATTACTACCACAGGGCTGACAGAGAATGAACATCAGCAACTGAGTGCGCTGTTGCATGACCGCATGACAGAAACGGTTTTCAGCGAACTGTCACAGGCACAGGCGCTGTTTGCCCGTCATGAACCGGCACCGCTGACCGTGATTGACCTCGCGGGTCAGGGCCGAGCGGCACTGGAAAAAGCCAACATTTCGCTGGGGCTGGCGCTGGCGGAAGATGAAATCGATTATCTGGCTGATGCATTCACGAAACTCGGCCGCAATCCGTCCGATGCGGAACTCTATATGTTTGCCCAGGCAAACTCTGAGCACTGCCGCCACAAGATTTTTAATGCTGACTGGGTGATTGACGGCGAAGAACAGCCGAAATCCCTGTTTAAGATGATTAAAAATACCTTCGAGCAGACACCGGATCATGTGCTGTCCGCCTATAAAGATAACGCGGCGGTGATGGAAGGCTCCTCTGCCGGGCGTTTCTTCCCGCAGGGGGAAGACCGCCGTTATCAGTATCATCAGGAAGAAACCCATATCCTGATGAAAGTGGAAACCCATAACCACCCGACCGCCATTTCCCCGTGGCCGGGGGCGGCAACCGGCTCCGGCGGTGAAATTCGTGACGAAGGCGCGACCGGGCGCGGCGCCAAGCCAAAAGCGGGATTAACCGGTTTTTCTGTCTCCAACCTGCGTATCCCGGGCTTTACCCAGCCTTGGGAGCAGGATTTCGGCAGACCGGACCGCATTGTCAGCGCCTATGACATCATGACTGAAGGTCCGCTCGGCGGCGCGGCATTTAATAACGAATTCGGTCGTCCGGCACTGCTCGGCTATTTCCGGACCTATGAAGAGAAAGTCAGCAGCCACAACGGCGAGGAACTGCGCGGCTACCATAAGCCCATTATGCTGGCGGGCGGTATCGGTAATATCCGTGCTGATCACGTGCAGAAAGGAGAGATCCAGCCGGGGGCGAAACTGATTGTATTAGGCGGCCCGTCGATGAATATCGGCCTGGGCGGTGGTGCGGCATCTTCCATGACATCCGGTCAGTCGGATGCGGATCTGGATTTTGCCTCTGTGCAGCGCGATAACCCGGAAATGGAACGTCGCTGCCAGGAAGTGATCGACGCCTGCTGGCAACTGGGTGATAACAACCCGATCCTGTTTATCCATGATGTCGGTGCGGGCGGCCTGTCCAACGCCATGCCGGAGCTGGTCAGTGACGGCGGGCGCGGCGGACGTTTTGAGCTGCGCGATATCCTCAGTGATGAGCCGGGTATGAGCCCGCTGGAAATCTGGTGTAACGAATCCCAGGAACGCTATGTGCTGGCAGTCTCGCCTGAGCAACTGCCGCTGTTTGAGGCACTCTGTCAGCGCGAGCGCGCGCCGTATGCCGTGATTGGTGAGGCGACAGAAAAGCGTGACCTGATCCTGAATGACAGCCATTTTGATAATCAGCCGATTGATATGCCGCTGGATATCCTGCTGGGTAAAACCCCGAAAATGCGCCGCGATGTCACCACACTGACTGCGGATGGCACACCGATTGACCGCCGTGATATTAATTTGCATGAAGCGGTAAAACGCGTGCTGCACTTACCGGCGGTAGCGGAAAAAACCTTCCTGATCACCATAGGTGACCGTACGGTAACCGGCATGGTTTCCCGTGATCAGATGGTCGGTCCGTGGCAGATCCCGGTAGCAGATTGCGCGGTGACTACCGCCAGCCTCGACAGTTACTACGGCGAGGCGATGTCCATCGGTGAACGCGCCCCGGTTGCTCTGCTTGATTTTGCCGCCTCCGCACGGATGGCGGTGGCGGAAGCGCTGCTGAACATTGCCGGTGTGCAGATTGGCGATATTAAGCGGATTAAATTATCCGCCAACTGGATGGCTGCAGCCGGACATCCGGGCGAAGATGCCGGGTTATACGCGGCGGTAAAAGCGGTGGGTGAGGAGTTATGCCCGGCGCTCGGCCTGACGATCCCGGTCGGTAAAGATTCCATGTCGATGAAAACCCGCTGGAACGAGCAGGGCGAAGAGCGCGAGATGACATCGCCGCTGTCGCTGGTGATCACGGCATTTGCCCGTGTGGATGATGTGCGCCGGACCGTCACGCCGCAACTGCGGAGTGATGTGCCGAACCGTCTGCTGCTGGTGGATCTGGGGGAAGGCCGTAATACCCTCGGCGCAACCGCGCTGGCGCAGGTGTATCGTCAGCTGGGACAGAAAGGCGCGGATCTGCGTAATCCGCAGGCGCTGCGCGCATTCTTTGACACCATGCAGACCCTGGTGCGGGATGAAAAACTGCTGGCGTATCATGACCGTTCAGATGGCGGCCTGTTTGTCACCCTGGCGGAAATGGCCTTTGCCGGACACTGCGGTGTGAATGCGGATATCAGTGCATTTGATGAGGATATCCTTGGCGCACTGTTTACCGAAGAGCCGGGTGCCGTGCTCCAGGTGCGGGAAGCGGATCTGGATGGCGTTGTGCAGGCCTTCACCGGTGCCGGTCTGGCAGATATGCTGCATGTTCTCGGTGAAGCTGTACCGGGGGATGATTTTATTGTCTGCAGCCATAATACCGAAGTCTATCACCAGTCCTGCCGTGAACTGCGGATCATGTGGGCAGAAACCACCTGGCAGATGCAGCGTCAGCGTGATAACCCGGCCTGTGCGGATGAAGAGCATGAAGCGAAGCAGGATCTGACAGACCCCGGCCTTAATGTGGTACTGACATTCGATCAGAATGACGATATCGCTGCGCCGTATATTGTAAAAGGCGTGCGTCCGCGTGTCGCGGTACTGCGTGAGCAGGGGGTTAACTCCCATGTGGAAATGGCGGCCGCCTTCCACCGTGCCGGGTTTGATGCCATCGATGTGCATATGAGCGACCTGCTGAACGGGCATCTTCCGCTGGACAGTTTTCAGGCGCTGGTTGCCTGCGGCGGCTTCTCTTACGGGGACGTACTGGGTGCCGGTGAAGGCTGGGCGAAATCGATTCTGTTCAATCCGCAGGTACGGGATGAATTTGCGCAGTTCTTTGCGCGTCCGGATACCTTATCACTCGGGGTCTGTAACGGCTGTCAGATGATGTCAAACCTGCGGGATCTGATTCCGGGGGCGGATTTATGGCCGCGCTTTACCCATAACCGCTCTGAACGTTTTGAAGCGCGTTTCAGTCTGGTCGAAGTGGCACAAAGCCCGTCACTGCTGCTGAGCGGCATGGCCGGTTCGCGGATGCCGATTGCGGTCTCTCACGGCGAAGGGCTGGCGGAATTCCGTGATGCAGCACATCAGCAGGCGCTGACGGAACGCGGCCTGGTGGCGCTGCAATATGTGGATAACTACGGACAGGTCACTGAACGCTATCCGGCCAACCCGAACGGCTCACCGGACGGTATCACTGCAGTCACGACCGATGACGGACGTACCACTATTATGATGCCGCATCCGGAGCGTGTTTTCCGTACCGTCAGCAACTCCTGGCATCCGGAAAACTGGGGAGAGGACGGACCGTGGTTGCGGATCTTCCGTAATGCCCGCAAACAATTAGGCTGATAAACACGCGGGTATAACTTTTCAGTTTTACCCGCTTTTTTACTTACCAC