Homologs in group_510

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01045 FBDBKF_01045 46.6 Morganella morganii S1 yfgM Putative negative regulator of RcsB-dependent stress response, UPF0070 family
EHELCC_00500 EHELCC_00500 46.6 Morganella morganii S2 yfgM Putative negative regulator of RcsB-dependent stress response, UPF0070 family
NLDBIP_02960 NLDBIP_02960 46.6 Morganella morganii S4 yfgM Putative negative regulator of RcsB-dependent stress response, UPF0070 family
LHKJJB_04475 LHKJJB_04475 46.6 Morganella morganii S3 yfgM Putative negative regulator of RcsB-dependent stress response, UPF0070 family
HKOGLL_02570 HKOGLL_02570 46.6 Morganella morganii S5 yfgM Putative negative regulator of RcsB-dependent stress response, UPF0070 family
F4V73_RS07120 F4V73_RS07120 43.1 Morganella psychrotolerans - tetratricopeptide repeat protein

Distribution of the homologs in the orthogroup group_510

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_510

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P76576 2.19e-48 160 37 0 205 1 yfgM Ancillary SecYEG translocon subunit Escherichia coli (strain K12)
P43989 1.31e-31 117 32 4 205 1 HI_0370 Ancillary SecYEG translocon subunit Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O52728 1.87e-31 116 36 7 208 3 1057 Ancillary SecYEG translocon subunit Aggregatibacter actinomycetemcomitans
O51880 2.36e-13 68 27 0 133 3 BUsg_583 Ancillary SecYEG translocon subunit Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57663 3.97e-13 68 24 0 130 3 BU608 Ancillary SecYEG translocon subunit Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89A13 1.82e-06 50 20 2 197 3 bbp_550 Ancillary SecYEG translocon subunit Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09095
Feature type CDS
Gene -
Product tetratricopeptide repeat protein
Location 1980540 - 1981160 (strand: -1)
Length 621 (nucleotides) / 206 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_510
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF09976 Tetratricopeptide repeat-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2976 Signal transduction mechanisms (T) T Putative negative regulator of RcsB-dependent stress response, UPF0070 family

Protein Sequence

MEVYSTENEQVDAIKQFLKNYGLTIILAIVIGVGGIWGWKYWQSHQANRLQESAGEFATINEALTKPTPENIALAEKFVSETNDIYGALASLELAQLAIDANDLAKGETHLTKAISMVKNEAFADMLNLRLARVQLALDKTDAALISLEQVKSKAWDGMKNYIRGDVLAKKGDNAGAAAAYRNALNDENAGAIRSLVELKLNNLSN

Flanking regions ( +/- flanking 50bp)

TAGCGAACTGGCCCAACAATTGACGCTGTTATTAGGTTAAGGAGAGACTTGTGGAAGTTTATAGCACCGAAAACGAACAAGTTGATGCAATTAAACAGTTTTTAAAAAATTATGGTTTAACGATCATTCTCGCTATTGTCATTGGCGTGGGTGGAATTTGGGGTTGGAAATATTGGCAATCACATCAAGCCAACCGTCTACAAGAAAGTGCGGGTGAATTTGCAACAATAAATGAAGCATTAACGAAACCAACGCCTGAAAATATCGCATTAGCCGAAAAATTTGTTTCTGAAACTAACGATATTTATGGTGCTTTAGCCTCTTTAGAGTTAGCTCAATTAGCAATTGATGCCAACGATTTAGCCAAAGGTGAAACTCACCTGACTAAAGCAATATCTATGGTAAAGAATGAAGCATTTGCAGATATGCTTAACCTTCGCTTAGCTCGTGTGCAACTGGCATTAGATAAAACTGATGCTGCGTTAATTTCATTAGAGCAAGTGAAAAGTAAAGCATGGGATGGAATGAAAAATTATATCCGTGGTGATGTATTAGCGAAAAAAGGCGATAACGCAGGTGCAGCCGCCGCTTATCGTAATGCATTGAATGATGAAAATGCAGGCGCTATTCGCTCATTGGTTGAACTTAAACTCAATAATTTATCCAATTAAAGGGATCTTCAGACATGCAACTGCGTAAAACTCTCCTGATCGGTCTACTA