Homologs in group_504

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00990 FBDBKF_00990 74.4 Morganella morganii S1 cysT sulfate/thiosulfate ABC transporter permease CysT
EHELCC_00555 EHELCC_00555 74.4 Morganella morganii S2 cysT sulfate/thiosulfate ABC transporter permease CysT
NLDBIP_02905 NLDBIP_02905 74.4 Morganella morganii S4 cysT sulfate/thiosulfate ABC transporter permease CysT
LHKJJB_04420 LHKJJB_04420 74.4 Morganella morganii S3 cysT sulfate/thiosulfate ABC transporter permease CysT
HKOGLL_02625 HKOGLL_02625 74.4 Morganella morganii S5 cysT sulfate/thiosulfate ABC transporter permease CysT
F4V73_RS07065 F4V73_RS07065 73.6 Morganella psychrotolerans cysT sulfate/thiosulfate ABC transporter permease CysT

Distribution of the homologs in the orthogroup group_504

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_504

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P16701 8.49e-146 412 80 0 277 3 cysU Sulfate transport system permease protein CysT Escherichia coli (strain K12)
P41032 3.19e-144 408 79 0 277 3 cysU Sulfate transport system permease protein CysT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q32RF7 4.97e-82 251 47 0 257 3 cysT Probable sulfate transport system permease protein cysT Zygnema circumcarinatum
Q9MUL9 8.56e-80 244 48 0 249 3 cysT Probable sulfate transport system permease protein cysT Mesostigma viride
A2CI71 1.81e-79 244 47 0 249 3 cysT Probable sulfate transport system permease protein cysT Chlorokybus atmophyticus
P26246 2.16e-77 239 44 1 268 3 cysT Probable sulfate transport system permease protein cysT Marchantia polymorpha
Q9TKU8 1.13e-75 234 47 0 255 3 cysT Probable sulfate transport system permease protein cysT Nephroselmis olivacea
Q9TJR4 6.41e-73 227 45 1 257 3 cysT Probable sulfate transport system permease protein cysT Prototheca wickerhamii
P56343 1.98e-68 216 46 0 237 3 cysT Probable sulfate transport system permease protein cysT Chlorella vulgaris
P27367 9.67e-66 209 47 1 257 2 cysT Sulfate transport system permease protein CysT Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q2EEX6 1.78e-64 206 43 1 240 3 cysT Probable sulfate transport system permease protein cysT Helicosporidium sp. subsp. Simulium jonesii
Q8RVC7 2.62e-64 209 42 1 269 1 SULP1 Sulfate permease 1, chloroplastic Chlamydomonas reinhardtii
Q85AI0 5.03e-63 202 42 0 260 2 cysT Probable sulfate transport system permease protein cysT Anthoceros angustus
Q01895 3.71e-59 192 45 0 218 2 cysT Sulfate transport system permease protein CysT Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P27370 1.96e-50 170 37 2 273 2 cysW Sulfate transport system permease protein CysW Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P0AEB0 2.28e-44 154 34 0 257 1 cysW Sulfate transport system permease protein CysW Escherichia coli (strain K12)
P0AEB1 2.28e-44 154 34 0 257 3 cysW Sulfate transport system permease protein CysW Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P74547 5.43e-43 150 42 1 190 3 cysW Sulfate transport system permease protein CysW Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6QJE2 2.61e-41 149 38 0 219 1 SULP2 Sulfate permease 2, chloroplastic Chlamydomonas reinhardtii
Q58763 1.01e-26 107 29 5 226 3 wtpB Molybdate/tungstate transport system permease protein WtpB Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P0AF01 2.25e-26 106 34 4 214 1 modB Molybdenum transport system permease protein ModB Escherichia coli (strain K12)
P0AF02 2.25e-26 106 34 4 214 3 modB Molybdenum transport system permease protein ModB Escherichia coli O157:H7
P45322 3.47e-25 103 34 2 176 3 modB Molybdenum transport system permease protein ModB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P37731 1.59e-24 101 31 1 208 3 modB Molybdenum transport system permease protein ModB Azotobacter vinelandii
O30143 2.45e-24 101 29 4 243 1 wtpB Molybdate/tungstate transport system permease protein WtpB Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P18795 5.05e-24 101 34 2 193 3 nifC Probable transport system permease protein NifC Clostridium pasteurianum
O32209 6.16e-22 94 30 1 204 3 yvgM Putative molybdenum transport system permease protein YvgM Bacillus subtilis (strain 168)
Q5JEB3 1.34e-21 94 25 3 235 3 wtpB Molybdate/tungstate transport system permease protein WtpB Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q08382 6.44e-21 91 30 1 207 3 modB Molybdenum transport system permease protein ModB Rhodobacter capsulatus
O57893 6.85e-21 92 25 2 207 3 wtpB Molybdate/tungstate transport system permease protein WtpB Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8U4K4 5.03e-19 87 24 2 207 3 wtpB Molybdate/tungstate transport system permease protein WtpB Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q9V2C1 5.04e-19 87 26 1 169 3 wtpB Molybdate/tungstate transport system permease protein WtpB Pyrococcus abyssi (strain GE5 / Orsay)
D4GQ17 1.2e-18 86 30 2 189 3 HVO_B0370 Probable molybdenum ABC transporter permease protein HVO_B0370 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P9WG13 3.05e-18 85 30 2 213 3 modB Molybdenum transport system permease protein ModB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG12 3.05e-18 85 30 2 213 3 modB Molybdenum transport system permease protein ModB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A625 3.05e-18 85 30 2 213 3 modB Molybdenum transport system permease protein ModB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q44123 5.06e-15 78 29 2 198 3 fbpB Ferric transport system permease protein FbpB Actinobacillus pleuropneumoniae
Q44123 3.83e-14 75 26 8 275 3 fbpB Ferric transport system permease protein FbpB Actinobacillus pleuropneumoniae
P0AFK6 1.25e-14 75 28 3 216 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli (strain K12)
P0AFK7 1.25e-14 75 28 3 216 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFK8 1.25e-14 75 28 3 216 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli O157:H7
Q83RR7 1.33e-14 75 28 3 216 3 potC Spermidine/putrescine transport system permease protein PotC Shigella flexneri
Q57341 1.71e-14 76 33 1 156 3 fbpB1 Putative ferric transport system permease protein FbpB 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57341 8.66e-14 74 27 10 276 3 fbpB1 Putative ferric transport system permease protein FbpB 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P96064 1.9e-11 66 26 7 256 2 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PFQ6 2.16e-11 66 26 7 256 3 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57SD7 4.29e-11 65 26 7 256 3 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella choleraesuis (strain SC-B67)
Q93KD5 1.77e-10 62 27 3 160 1 tupB Tungstate uptake system permease protein TupB Peptoclostridium acidaminophilum
Q8Z8W9 1.8e-10 63 26 7 256 3 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella typhi
P71338 6.56e-10 62 25 6 232 3 fbpB2 Fe(3+)-transport system permease protein FbpB 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P71338 1.92e-08 58 26 6 207 3 fbpB2 Fe(3+)-transport system permease protein FbpB 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45169 7.76e-10 61 27 3 218 3 potC Spermidine/putrescine transport system permease protein PotC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P31549 1.07e-09 62 26 4 219 1 thiP Thiamine transport system permease protein ThiP Escherichia coli (strain K12)
Q8ZRV1 1.98e-09 61 28 5 213 1 thiP Thiamine transport system permease protein ThiP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45170 7.88e-09 58 27 3 146 3 potB Spermidine/putrescine transport system permease protein PotB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P46340 1.26e-08 58 34 0 82 3 yqgI Probable ABC transporter permease protein YqgI Bacillus subtilis (strain 168)
P0AFK5 1.73e-08 57 24 3 202 3 potB Spermidine/putrescine transport system permease protein PotB Shigella flexneri
P0AFK4 1.73e-08 57 24 3 202 1 potB Spermidine/putrescine transport system permease protein PotB Escherichia coli (strain K12)
P9WG01 2.67e-08 57 25 4 194 1 sugB Trehalose transport system permease protein SugB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG00 2.67e-08 57 25 4 194 3 sugB Trehalose transport system permease protein SugB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0CL49 5.93e-08 56 24 3 202 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WF94 5.93e-08 56 24 3 202 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhimurium (strain SL1344)
P0A2J8 5.93e-08 56 24 3 202 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhi
P21409 1.25e-07 55 27 5 211 3 fbpB Fe(3+)-transport system permease protein SfuB Serratia marcescens
P0AFS0 1.57e-07 54 41 2 86 3 ydcV Inner membrane ABC transporter permease protein YdcV Shigella flexneri
P0AFR9 1.57e-07 54 41 2 86 1 ydcV Inner membrane ABC transporter permease protein YdcV Escherichia coli (strain K12)
P44985 2.34e-07 55 26 3 208 3 thiP Thiamine transport system permease protein ThiP Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5PFQ5 2.52e-07 54 27 6 206 3 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P46339 3.12e-07 54 29 6 179 3 yqgH Probable ABC transporter permease protein YqgH Bacillus subtilis (strain 168)
P55602 3.65e-07 53 25 5 189 3 NGR_a02190 Probable ABC transporter permease protein y4oQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P31135 4.74e-07 53 24 5 230 1 potH Putrescine transport system permease protein PotH Escherichia coli (strain K12)
P77156 5.17e-07 53 36 1 82 1 ydcU Inner membrane ABC transporter permease protein YdcU Escherichia coli (strain K12)
O58760 6.22e-07 53 26 2 169 3 PH1036 Probable ABC transporter permease protein PH1036 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q57380 6.41e-07 50 25 0 107 5 HI_1475 Putative uncharacterized protein HI_1475 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8Z8X0 1.19e-06 52 27 6 204 3 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella typhi
P96065 3.05e-06 50 27 6 206 2 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8FYV0 3.16e-06 51 26 4 193 3 thiP Thiamine transport system permease protein ThiP Brucella suis biovar 1 (strain 1330)
Q57BC3 4.92e-06 51 25 4 193 3 thiP Thiamine transport system permease protein ThiP Brucella abortus biovar 1 (strain 9-941)
Q2YLW7 4.92e-06 51 25 4 193 3 thiP Thiamine transport system permease protein ThiP Brucella abortus (strain 2308)
P75681 6.42e-06 47 27 1 97 5 afuB Putative ferric transport system permease-like protein AfuB Escherichia coli (strain K12)
P26468 9.7e-06 49 26 5 209 3 malG Maltose/maltodextrin transport system permease protein MalG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z1U3 9.97e-06 49 26 5 209 3 malG Maltose/maltodextrin transport system permease protein MalG Salmonella typhi
P45191 1.55e-05 49 34 0 70 3 pstC Phosphate transport system permease protein PstC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O51924 1.57e-05 48 26 7 222 1 malF Trehalose/maltose transport system permease protein MalF Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q9K489 1.73e-05 48 22 4 186 1 dasC Diacetylchitobiose uptake system permease protein DasC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q87C89 1.73e-05 48 33 1 86 3 pstA Phosphate transport system permease protein PstA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
P68186 1.91e-05 48 26 5 209 3 malG Maltose/maltodextrin transport system permease protein MalG Shigella flexneri
P68183 1.91e-05 48 26 5 209 1 malG Maltose/maltodextrin transport system permease protein MalG Escherichia coli (strain K12)
P68184 1.91e-05 48 26 5 209 3 malG Maltose/maltodextrin transport system permease protein MalG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P68185 1.91e-05 48 26 5 209 3 malG Maltose/maltodextrin transport system permease protein MalG Escherichia coli O157:H7
Q8YJ03 3.21e-05 48 25 4 193 3 thiP Thiamine transport system permease protein ThiP Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P18814 3.43e-05 48 25 4 207 3 malG Maltose/maltodextrin transport system permease protein MalG Klebsiella aerogenes
Q9PBK1 3.54e-05 47 33 1 86 3 pstA Phosphate transport system permease protein PstA Xylella fastidiosa (strain 9a5c)
Q98FL3 3.6e-05 48 29 0 78 3 pstC Phosphate transport system permease protein PstC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P46492 3.93e-05 47 34 0 66 3 metI Probable D-methionine transport system permease protein MetI Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7MFC1 4.16e-05 47 26 3 196 3 malG Maltose/maltodextrin transport system permease protein MalG Vibrio vulnificus (strain YJ016)
Q8D3U7 4.16e-05 47 26 3 196 3 malG Maltose/maltodextrin transport system permease protein MalG Vibrio vulnificus (strain CMCP6)
Q57SD8 4.32e-05 47 27 6 206 3 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella choleraesuis (strain SC-B67)
P0AFL1 4.35e-05 47 26 8 248 1 potI Putrescine transport system permease protein PotI Escherichia coli (strain K12)
P0AFL2 4.35e-05 47 26 8 248 3 potI Putrescine transport system permease protein PotI Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q87GB8 5.23e-05 47 26 3 187 3 malG Maltose/maltodextrin transport system permease protein MalG Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KL07 7.26e-05 47 25 3 196 3 malG Maltose/maltodextrin transport system permease protein MalG Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KTJ6 9.27e-05 46 32 1 73 3 metI Probable D-methionine transport system permease protein MetI Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O50501 0.000182 45 27 3 130 1 ngcG Diacetylchitobiose uptake system permease protein NgcG Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P07654 0.000184 45 24 8 207 1 pstA Phosphate transport system permease protein PstA Escherichia coli (strain K12)
P37730 0.000199 45 23 6 208 3 amyD Probable starch degradation products transport system permease protein AmyD Thermoanaerobacterium thermosulfurigenes
P0AGI0 0.000282 45 28 1 88 3 pstC Phosphate transport system permease protein PstC Shigella flexneri
P0AGH8 0.000282 45 28 1 88 1 pstC Phosphate transport system permease protein PstC Escherichia coli (strain K12)
P0AGH9 0.000282 45 28 1 88 3 pstC Phosphate transport system permease protein PstC Escherichia coli O157:H7
Q58420 0.000341 45 34 1 69 3 pstC Probable phosphate transport system permease protein PstC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P47290 0.000436 44 21 3 151 3 potC Spermidine/putrescine transport system permease protein PotC homolog Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q9KL06 0.000441 45 24 7 222 3 malF Maltose/maltodextrin transport system permease protein MalF Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9CNJ6 0.000535 44 27 2 121 3 pstA Phosphate transport system permease protein PstA Pasteurella multocida (strain Pm70)
Q9CK96 0.000536 43 34 0 66 3 metI Probable D-methionine transport system permease protein MetI Pasteurella multocida (strain Pm70)
Q9PBK2 0.000657 44 31 0 70 3 pstC Phosphate transport system permease protein PstC Xylella fastidiosa (strain 9a5c)
Q50097 0.000666 44 29 0 64 3 pstA Phosphate transport system permease protein PstA Mycobacterium leprae (strain TN)
Q74RF8 0.000708 43 28 4 182 3 malG Maltose/maltodextrin transport system permease protein MalG Yersinia pestis
Q87C90 0.000726 43 31 0 70 3 pstC Phosphate transport system permease protein PstC Xylella fastidiosa (strain Temecula1 / ATCC 700964)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09050
Feature type CDS
Gene cysT
Product sulfate/thiosulfate ABC transporter permease CysT
Location 1971578 - 1972411 (strand: -1)
Length 834 (nucleotides) / 277 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_504
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0555 Inorganic ion transport and metabolism (P) P ABC-type sulfate transport system, permease component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02046 sulfate/thiosulfate transport system permease protein Sulfur metabolism
ABC transporters		 Sulfate-sulfur assimilation

Protein Sequence

MFATASKRVLPGFGLSLGSTLFYTCLILLLPMSALVVQLSEMSWAQYWAVITHPQIVAAYKVTLLSAGVASIFNAIFGMLLAWIITRYRFPGRKFLDGLMDLPFALPTAVAGLTLATLFSTQGWYGLVLDKFDIKVINTWIGIAVAMSFTSLPFVVRTVQPVLEELGPEYEEAAETLGANRWQTFRKVMLPELSPALLAGTALSFTRSLGEFGAVIFIAGNIAWQTEVVSLMIFIRLQEFDYPAASAVASVILLVSLVLLFSINGLQSRFGKRLRGH

Flanking regions ( +/- flanking 50bp)

TTTGCTACAGATGGCACGCTAGATAAATTATTATTAGAAGGACGCCAATAATGTTTGCCACAGCCAGCAAGCGAGTATTACCCGGATTTGGGCTTAGTTTAGGTAGTACGCTTTTTTATACTTGTTTGATCTTATTACTACCTATGAGTGCGCTGGTTGTGCAGTTATCTGAAATGAGTTGGGCACAATATTGGGCGGTGATAACCCACCCTCAAATCGTGGCAGCGTATAAAGTCACTTTGTTGTCAGCCGGTGTTGCAAGTATTTTTAATGCTATTTTTGGCATGTTATTAGCGTGGATCATTACGCGCTATCGTTTCCCCGGCAGAAAATTTCTTGATGGATTAATGGATTTACCTTTTGCCTTACCTACAGCGGTAGCGGGATTGACCTTAGCAACGTTGTTTTCTACACAAGGATGGTATGGCTTGGTGTTAGATAAGTTTGATATCAAGGTGATCAATACATGGATTGGTATTGCTGTGGCGATGTCTTTTACTAGTTTGCCGTTTGTGGTCAGAACAGTGCAACCTGTTTTAGAAGAGTTAGGCCCTGAATATGAAGAAGCGGCTGAAACATTAGGGGCAAACCGTTGGCAAACGTTCCGTAAAGTTATGTTACCTGAATTGTCTCCGGCGTTATTAGCCGGTACTGCGCTCTCTTTTACGCGTAGTTTAGGGGAATTTGGTGCTGTTATTTTTATTGCTGGCAATATTGCATGGCAGACCGAAGTGGTTTCTTTGATGATATTTATTCGATTACAGGAGTTTGATTATCCTGCAGCCAGCGCGGTCGCTTCTGTTATTTTATTGGTTTCATTAGTCTTACTGTTTTCAATTAATGGATTACAAAGCCGCTTTGGCAAGCGATTAAGGGGGCACTAATGTCGGATATAGCGCAACAACGCTCTCTTTATCGTCGCCAAATTGATTGG